Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR740758 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old chromosome APEC5202 7 crisprs DinG,cas1,cas3f,cas8f,cas7f,cas6f,cas3,c2c9_V-U4,DEDDh,csa3,WYL,RT 2 17 12 0
NZ_LR740759 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202 0 crisprs csa3 0 0 2 1
NZ_LR740760 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid pbAPEC5202 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LR740758
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_1 707531-707661 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_2 886551-887058 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_3 896119-896507 TypeI-F I-F
6 spacers
cas6f,cas7f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_4 1530307-1530430 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_5 4369072-4369273 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_6 4696208-4696335 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR740758_7 4925040-4925179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LR740760.1 42751-42782 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LR740759.1 111571-111602 1 0.969

1. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to position: 42751-42782, mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgtgaccgtctctcctt	Protospacer
*****************.**************

2. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to position: 111571-111602, mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 37753-37784 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 32193-32224 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 37753-37784 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 32193-32224 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 37753-37784 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KX246268 Escherichia coli strain RD174 plasmid pHNRD174, complete sequence 19997-20028 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 37753-37784 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 37753-37784 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KU355874 Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence 31200-31231 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 75310-75341 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP022456 Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence 9090-9121 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025455 Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76334 plasmid pSAG-76334, complete sequence 31379-31410 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 114745-114776 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KP987217 Klebsiella pneumoniae strain 628 plasmid p628-CTXM, complete sequence 19989-20020 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 54904-54935 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM409652 Escherichia coli strain REL5382 plasmid pB15, complete sequence 32253-32284 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 165362-165393 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KJ866866 Escherichia coli strain SKLX3330 plasmid pSKLX3330, complete sequence 67666-67697 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_020991 Shigella sonnei 10188 plasmid pKHSB1 complete sequence 9904-9935 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 664-695 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 109557-109588 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP035009 Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence 19588-19619 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028485 Escherichia coli strain E41-1 plasmid p2, complete sequence 34330-34361 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP010142 Escherichia coli strain D3 plasmid B, complete sequence 14722-14753 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP014494 Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence 15853-15884 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 89367-89398 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 98987-99018 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 75900-75931 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 154755-154786 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 283767-283798 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024226 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3 1400-1431 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 146195-146226 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 21904-21935 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 31524-31555 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024468 Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence 108419-108450 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 54904-54935 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053733 Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence 46543-46574 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045523 Shigella flexneri strain 5908.2 plasmid p5908-2 49620-49651 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP009105 Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence 165362-165393 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 44699-44730 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 53841-53872 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 277186-277217 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP054316 Escherichia coli strain SCU-483 plasmid pSCU-483-1 70678-70709 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP039714 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence 21952-21983 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 65772-65803 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 65018-65049 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT838199 Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence 47131-47162 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_EU418931 Escherichia coli strain JIE174 plasmid pJIE174, complete sequence 27171-27202 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_EU418923 Escherichia coli strain JIE113 plasmid pJIE113, complete sequence 22813-22844 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_013120 Escherichia coli plasmid pEK204, complete sequence 24983-25014 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019253 Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence 58853-58884 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 252212-252243 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032524 Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence 20516-20547 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 37514-37545 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LT985289 Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p 22836-22867 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 31695-31726 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 167879-167910 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 15438-15469 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024887 Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence 12939-12970 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_018659 Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence 58883-58914 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH579767 Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence 14281-14312 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 46398-46429 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 144934-144965 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP038417 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence 24011-24042 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP045527 Shigella sonnei strain 6607.69 plasmid p6607-69, complete sequence 39702-39733 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 166654-166685 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 298856-298887 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 11191-11222 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027463 Escherichia coli isolate 07-4299 plasmid unnamed 46-77 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018993 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_2, complete sequence 112269-112300 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_024977 Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence 27182-27213 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP031286 Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence 44330-44361 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985295 Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII 22813-22844 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 44166-44197 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019044 Escherichia coli plasmid pND12_96, complete sequence 22477-22508 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 122308-122339 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021693 Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence 19207-19238 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP050747 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence 49986-50017 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052382 Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence 24476-24507 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 276501-276532 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LN735558 Escherichia coli plasmid pC193, complete sequence, strain C193 60180-60211 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LN735559 Escherichia coli plasmid pM105, complete sequence, strain M105 58940-58971 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LN735560 Escherichia coli plasmid pV408, complete sequence, strain V408 50599-50630 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LN735561 Escherichia coli plasmid pC271, complete sequence, strain C271 61003-61034 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021208 Escherichia coli strain strain Z247 plasmid p2474-3, complete sequence 47047-47078 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 72567-72598 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040270 Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence 24460-24491 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 260501-260532 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 53087-53118 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040808 Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence 36552-36583 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 41750-41781 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019954 Escherichia coli M8 plasmid unnamed1, complete sequence 114254-114285 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP010831 Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence 47261-47292 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 244452-244483 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024152 Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence 48293-48324 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 5476-5507 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP051745 Escherichia coli strain SCU-484 plasmid pSCU-484-1, complete sequence 16531-16562 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 241015-241046 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025147 Escherichia coli plasmid pV404, complete sequence 30726-30757 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027324 Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence 28414-28445 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 260433-260464 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049180 Shigella sonnei strain L4094 plasmid pL4094, complete sequence 32632-32663 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_014383 Escherichia coli plasmid pEC_Bactec, complete sequence 28957-28988 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KJ406378 Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence 24904-24935 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 42230-42261 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042944 Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35472_2 74231-74262 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 244452-244483 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027341 Escherichia coli strain 2015C-3121 plasmid unnamed 30510-30541 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 10996-11027 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_017642 Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence 22465-22496 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 12111-12142 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 244447-244478 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 244452-244483 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024233 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed1 24988-25019 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP047578 Escherichia coli strain 94EC plasmid p94EC-2, complete sequence 67166-67197 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049176 Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence 41898-41929 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 242065-242096 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018946 Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence 23461-23492 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018975 Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence 56014-56045 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 4588-4619 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042886 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence 23963-23994 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 248549-248580 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028120 Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence 51623-51654 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 65553-65584 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN125610 Salmonella enterica subsp. enterica serovar Enteritidis strain 1.11-3A7 plasmid pIncI1-CTX-M-14, complete sequence 91990-92021 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 145884-145915 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP052880 Escherichia coli strain C21 plasmid pC21-3, complete sequence 19781-19812 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 76723-76754 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 54909-54940 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019996 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence 19782-19813 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 94526-94557 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031111 Escherichia coli strain AMSCJX02 plasmid pAMSC6, complete sequence 62109-62140 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 156835-156866 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019215 Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence 19374-19405 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP019762 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence 50732-50763 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023534 Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence 64097-64128 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 37498-37529 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP047572 Escherichia coli strain 2EC1 plasmid p2EC1-1, complete sequence 62925-62956 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023144 Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence 29240-29271 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 18533-18564 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP053331 Salmonella enterica subsp. salamae serovar 60:z10:z39 strain 2011K-1889 plasmid unnamed2, complete sequence 36572-36603 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 41059-41090 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP018797 Escherichia coli strain E2855 plasmid pE2855-1, complete sequence 54104-54135 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LN890525 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence 76565-76596 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029842 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence 28867-28898 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032880 Escherichia coli strain SCEC020022 plasmid p1_020022, complete sequence 14853-14884 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP034804 Escherichia coli strain 2009C-3554 plasmid p2009C-3554-1, complete sequence 46595-46626 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022742 Escherichia coli plasmid pHUSEC2011-1, complete sequence 22502-22533 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029903 Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence 22502-22533 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH430881 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence 47369-47400 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP050758 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence 22644-22675 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 15269-15300 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 24520-24551 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP027673 Escherichia coli strain 2014C-3003 plasmid unnamed1 78797-78828 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH884653 Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence 204438-204469 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH884654 Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence 66677-66708 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 66755-66786 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021739 Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence 30885-30916 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019905 Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence 8657-8688 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN335919 Escherichia coli strain SD-2 plasmid pNDM-T2, complete sequence 38038-38069 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN335921 Escherichia coli strain SD-6 plasmid pNDM-T6, complete sequence 46957-46988 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MK088173 Salmonella enterica subsp. enterica strain H-185 plasmid R805a, complete sequence 17936-17967 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN276083 Escherichia coli strain GZ7DS11 plasmid pHN7DS11,complete sequence 44698-44729 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 167186-167217 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG825375 Escherichia coli strain 1106 plasmid p1106-NDM, complete sequence 45425-45456 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG838206 Escherichia coli strain 92944 plasmid p92944-NDM, complete sequence 47675-47706 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG904995 Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence 57561-57592 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG271839 Escherichia coli strain SDX5C138 plasmid pHNSD138-1, complete sequence 35246-35277 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG825371 Escherichia coli strain 1106 plasmid p1106-IncFII, complete sequence 22807-22838 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MH257955 Escherichia coli strain 104 plasmid pHXH-3, complete sequence 44641-44672 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MH430883 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence 47111-47142 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG196294 Escherichia coli strain THSJ02 plasmid pHNTH02-1, complete sequence 50085-50116 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MK238490 Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence 52047-52078 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MN702386 Escherichia coli strain LWY24J plasmid pLWY24J-4, complete sequence 24729-24760 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 23505-23536 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MF078004 Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence 75987-76018 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 23044-23075 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MF156268 Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence 22204-22235 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MF344575 Escherichia coli strain 140611011 plasmid p11011-CTXM, complete sequence 67764-67795 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG601057 Escherichia coli strain EC1107 plasmid pEC1107-NDM-116K, complete sequence 47780-47811 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG545910 Escherichia coli strain EC014 plasmid pEC014, complete sequence 54883-54914 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 43282-43313 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP037994 Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5 50074-50105 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028611 Escherichia coli strain 142 plasmid pTA142-2, complete sequence 18165-18196 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028611 Escherichia coli strain 142 plasmid pTA142-2, complete sequence 27396-27427 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP031903 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence 65341-65372 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025949 Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence 23281-23312 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KX608544 Escherichia coli strain FA27 plasmid pFA27_2, complete sequence 20219-20250 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY751926 Klebsiella pneumoniae strain HK02-026 plasmid pHK02-026, complete sequence 74015-74046 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY751925 Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence 22024-22055 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 75593-75624 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LR213453 Shigella flexneri strain AUSMDU00008355 isolate AUSMDU00008355 plasmid 2 79718-79749 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU355874 Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence 27369-27400 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 28413-28444 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU288634 Escherichia coli strain FAM22321 plasmid pFAM22321, complete sequence 29122-29153 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 94719-94750 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT879914 Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence 20728-20759 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 2487-2518 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 52170-52201 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KX503323 Escherichia coli strain HNEC46 plasmid PHNEC46, complete sequence 22479-22510 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP022456 Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence 12707-12738 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032991 Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence 13905-13936 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015072 Escherichia coli strain Ecol_743 plasmid pEC743_3, complete sequence 63227-63258 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 92467-92498 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 152451-152482 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 7965-7996 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT818627 Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence 44194-44225 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 62764-62795 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 8616-8647 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KR078259 Escherichia coli strain YD472 plasmid pYHCC, complete sequence 24502-24533 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP038792 Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence 91775-91806 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 82152-82183 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041339 Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence 36380-36411 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042338 Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence 23341-23372 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP022460 Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence 11907-11938 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP035009 Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence 18099-18130 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040124 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence 59659-59690 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010138 Escherichia coli strain D2 plasmid A, complete sequence 7071-7102 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014494 Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence 14365-14396 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 74411-74442 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_020278 Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence 24383-24414 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_022267 Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence 20343-20374 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 52341-52372 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 53413-53444 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042601 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence 35511-35542 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024226 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3 2888-2919 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014622 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence 21564-21595 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 130305-130336 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP049350 Escherichia coli strain 3R plasmid p3R-2, complete sequence 36055-36086 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP049351 Escherichia coli strain 3R plasmid p3R-3, complete sequence 23757-23788 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT754160 Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence 64029-64060 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 77394-77425 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010174 Escherichia coli strain H8 plasmid B, complete sequence 50667-50698 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024468 Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence 109908-109939 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LS992187 Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence 62338-62369 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP053734 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFII, complete sequence 20076-20107 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP045523 Shigella flexneri strain 5908.2 plasmid p5908-2 48132-48163 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 128211-128242 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 40457-40488 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 32339-32370 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP020511 Escherichia coli strain 165 plasmid unnamed2, complete sequence 72828-72859 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 102686-102717 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP043737 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence 172922-172953 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 46188-46219 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029734 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence 17676-17707 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034964 Escherichia coli strain WCHEC020032 plasmid pCTXM3_020032, complete sequence 37039-37070 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LS999562 Escherichia coli isolate EC-TO143 plasmid 3, complete sequence 39089-39120 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 127099-127130 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 138565-138596 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 36062-36093 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 50498-50529 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 136255-136286 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 57735-57766 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP047091 Salmonella sp. S13 plasmid pS13-2, complete sequence 39147-39178 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP039714 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence 23441-23472 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012835 Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence 41535-41566 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012627 Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence 78725-78756 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT077885 Escherichia coli plasmid p37, complete sequence 24350-24381 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT077887 Escherichia coli plasmid p62, complete sequence 62315-62346 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN007140 Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence 16372-16403 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KX023260 Escherichia coli plasmid pSCE516-3, complete sequence 19195-19226 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024475 Shigella flexneri 7b strain 94-3007 plasmid unnamed2, complete sequence 25111-25142 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LR213457 Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 3 73446-73477 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP044156 Shigella flexneri strain AR-0424 plasmid pAR-0424-1, complete sequence 10359-10390 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_EU418931 Escherichia coli strain JIE174 plasmid pJIE174, complete sequence 25683-25714 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_EU418923 Escherichia coli strain JIE113 plasmid pJIE113, complete sequence 21325-21356 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 42438-42469 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_013121 Escherichia coli plasmid pEK516, complete sequence 55558-55589 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_025198 Escherichia coli plasmid pJIE512b, complete sequence 26107-26138 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019276 Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence 15330-15361 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033629 Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence 17196-17227 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 28798-28829 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP049078 Escherichia coli strain p11A plasmid p11A_p1, complete sequence 49084-49115 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 42945-42976 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 129900-129931 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 19566-19597 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 57352-57383 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 33781-33812 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041621 Shigella flexneri strain C32 plasmid pC32_2, complete sequence 41226-41257 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 36026-36057 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 LT985289 Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p 21348-21379 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 67244-67275 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 92131-92162 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012139 Shigella flexneri 2a strain 981 plasmid 981p2, complete sequence 34455-34486 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014966 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence 174572-174603 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP022064 Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence 46512-46543 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021841 Escherichia coli strain EC974 plasmid pEC974-1, complete sequence 47796-47827 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 25099-25130 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 25479-25510 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 25430-25461 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 23243-23274 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 25411-25442 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 25395-25426 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 86131-86162 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016572 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence 30569-30600 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041415 Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence 56272-56303 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015161 Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence 41192-41223 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_018659 Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence 57395-57426 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP035752 Escherichia coli E110019 plasmid pE110019_66, complete sequence 62298-62329 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 25566-25597 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 25361-25392 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP047380 Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence 146705-146736 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP038385 Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence 32253-32284 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP038347 Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence 17170-17201 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP045525 Shigella sonnei strain 6904.27 plasmid p6904-27 37266-37297 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP044137 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence 55857-55888 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP044183 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence 12908-12939 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024281 Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence 57747-57778 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030329 Escherichia coli strain AR_452 plasmid unnamed1, complete sequence 67065-67096 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032264 Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence 88243-88274 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 15176-15207 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 37412-37443 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030000 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence 30159-30190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 3367-3398 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041421 Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence 60283-60314 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024652 Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence 23846-23877 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016387 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence 91348-91379 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016389 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pESBL931, complete sequence 28206-28237 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042618 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence 37149-37180 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 79454-79485 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027463 Escherichia coli isolate 07-4299 plasmid unnamed 1518-1549 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_024976 Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence 23315-23346 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_024977 Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence 25694-25725 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP031286 Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence 48143-48174 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015239 Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence 102555-102586 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK492260 Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence 65935-65966 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985283 Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI 26040-26071 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985295 Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII 21325-21356 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 123167-123198 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP053755 Shigella sonnei strain 506 plasmid pMHMC-004, complete sequence 41568-41599 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 78972-79003 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040548 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence 29213-29244 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019044 Escherichia coli plasmid pND12_96, complete sequence 20988-21019 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP014876 Escherichia coli plasmid pV021-b DNA, complete sequence, strain: V021 26326-26357 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP030839 Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence 18170-18201 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 137468-137499 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010124 Escherichia coli strain C5 plasmid B, complete genome 83745-83776 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP046261 Escherichia coli strain ECO2947 plasmid p2947-NDM5, complete sequence 15382-15413 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021693 Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence 17719-17750 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027438 Escherichia coli strain 2012C-4221 plasmid unnamed1, complete sequence 49589-49620 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029110 Escherichia coli strain AR436 plasmid unnamed2 85693-85724 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034255 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11 11676-11707 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP035314 Escherichia coli strain D72 plasmid pD72-F33, complete sequence 20508-20539 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KY463221 Escherichia coli plasmid pCMY-42, complete sequence 17485-17516 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034932 Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence 4233-4264 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 28104-28135 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041303 Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence 13455-13486 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP039513 Salmonella enterica subsp. enterica serovar Worthington strain 7102.58 plasmid p7102_58-6, complete sequence 30595-30626 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 68649-68680 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021533 Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence 16777-16808 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021684 Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence 35922-35953 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024854 Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence 25727-25758 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 27637-27668 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 58391-58422 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 125312-125343 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021210 Escherichia coli strain strain Z247 plasmid p2474-NDM1, complete sequence 32442-32473 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 71078-71109 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_025180 Escherichia coli plasmid pC23-89, complete sequence 50218-50249 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 65034-65065 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019205 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence 64070-64101 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985236 Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI 23316-23347 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985231 Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII 47817-47848 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985238 Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI 23319-23350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985320 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII 98055-98086 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 27970-28001 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_AP019677 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-2, complete sequence 24637-24668 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP042897 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_01, complete sequence 146379-146410 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP031615 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence 4044-4075 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_AP019190 Escherichia coli strain M217 plasmid pM217_I1, complete sequence 15479-15510 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP033160 Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM 35535-35566 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP051690 Escherichia coli strain SCU-387 plasmid pSCU-387-2, complete sequence 37954-37985 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019095 Escherichia coli plasmid pXZ, complete sequence 25050-25081 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 82915-82946 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040808 Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence 40381-40412 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010241 Escherichia coli strain C7 plasmid A, complete sequence 55175-55206 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP046117 Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence 22663-22694 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023376 Escherichia coli strain 1283 plasmid p92, complete sequence 25688-25719 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024823 Escherichia coli strain CREC-591 plasmid pCREC-591_2, complete sequence 31673-31704 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 21444-21475 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 40261-40292 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024481 Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence 20909-20940 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 59528-59559 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP036181 Escherichia coli strain WCHEC025970 plasmid p2_025970, complete sequence 32572-32603 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 65035-65066 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KU932026 Escherichia coli plasmid pEC14II_1, complete sequence 51615-51646 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KU932027 Escherichia coli plasmid pEC14II_2, complete sequence 51433-51464 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KU932029 Escherichia coli plasmid pEC15I_1, complete sequence 73398-73429 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KU932030 Escherichia coli plasmid pEC15I_2, complete sequence 73354-73385 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MG516908 Escherichia coli plasmid pEc42, complete sequence 46087-46118 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP017852 Klebsiella variicola strain GJ2 plasmid pKPGJ-2c, complete sequence 60872-60903 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP017287 Klebsiella variicola strain GJ3 plasmid pKPGJ-3c, complete sequence 40326-40357 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 47115-47146 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019444 Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence 30601-30632 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023733 Escherichia coli strain FORC 064 plasmid pFORC64.2, complete sequence 19940-19971 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 67188-67219 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_025147 Escherichia coli plasmid pV404, complete sequence 29237-29268 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016533 Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence 25703-25734 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027256 Escherichia coli strain EC11 plasmid unnamed1, complete sequence 96329-96360 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP009566 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence 88439-88470 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029119 Escherichia coli strain AR435 plasmid unnamed6 6170-6201 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049180 Shigella sonnei strain L4094 plasmid pL4094, complete sequence 34121-34152 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_014383 Escherichia coli plasmid pEC_Bactec, complete sequence 30445-30476 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019131 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence 20338-20369 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_032100 Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence 91710-91741 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 105837-105868 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015388 Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence 34941-34972 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KJ201887 Shigella flexneri 4c strain 072 plasmid pSF07201, complete sequence 17095-17126 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KX008967 Shigella sonnei strain 183660 plasmid p183660, complete sequence 48971-49002 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 54495-54526 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030025 Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence 30159-30190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_006856 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence 94094-94125 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016516 Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence 30568-30599 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016520 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence 26520-26551 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP048312 Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence 56108-56139 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 113698-113729 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010120 Escherichia coli strain C3 plasmid A, complete sequence 7168-7199 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP043759 Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence 27432-27463 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032810 Escherichia coli strain ERL04-3476 plasmid pERL04-3476-2, complete sequence 12809-12840 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP022166 Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence 125750-125781 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 80185-80216 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_017642 Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence 20884-20915 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_017640 Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence 69895-69926 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 13599-13630 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MF918372 Klebsiella pneumoniae plasmid p1512-KPC, complete sequence 23784-23815 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP051282 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence 12894-12925 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP009167 Escherichia coli 1303 plasmid p1303_109, complete sequence 59459-59490 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019424 Escherichia coli plasmid pFOS-HK151325, complete sequence 19898-19929 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024233 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed1 23499-23530 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012936 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence 30568-30599 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP050372 Klebsiella pneumoniae strain 50595 plasmid p50595_ERM, complete sequence 56787-56818 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049176 Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence 43387-43418 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010345 Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence 53510-53541 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019073 Escherichia coli plasmid pHN7A8, complete sequence 25159-25190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041363 Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence 30706-30737 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018946 Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence 24950-24981 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023365 Escherichia coli strain 144 plasmid p92, complete sequence 27070-27101 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023385 Escherichia coli strain 1223 plasmid p87, complete sequence 21042-21073 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027367 Escherichia coli strain 89-3156 plasmid unnamed, complete sequence 108605-108636 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012923 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence 30568-30599 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 31344-31375 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026158 Klebsiella pneumoniae strain F93-2 plasmid pF93-2_1, complete sequence 813-844 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049174 Shigella sonnei strain 19.0820.1561 plasmid p19-0820-1561, complete sequence 12469-12500 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023918 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed 20582-20613 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023918 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed 104708-104739 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023957 Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence 2739-2770 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023959 Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence 77010-77041 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042886 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence 22475-22506 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042887 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_03, complete sequence 17969-18000 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP043408 Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_02, complete sequence 16418-16449 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP012929 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence 29572-29603 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018462 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence 7081-7112 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040542 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence 29218-29249 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_002483 Escherichia coli K-12 plasmid F DNA, complete sequence 56779-56810 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 27970-28001 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP045934 Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_02, complete sequence 29033-29064 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023382 Escherichia coli strain 127 plasmid p95, complete sequence 25686-25717 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP048440 Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence 79597-79628 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049186 Shigella sonnei strain 19.0821.3486 plasmid p19-0821-3486, complete sequence 38389-38420 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP043735 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence 18439-18470 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019207 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence 39775-39806 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP045020 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-6, complete sequence 13404-13435 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021882 Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence 18742-18773 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023362 Escherichia coli strain 1943 plasmid p85, complete sequence 15051-15082 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023356 Escherichia coli strain 746 plasmid p95, complete sequence 28191-28222 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 102084-102115 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 24454-24485 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 67042-67073 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 23505-23536 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 27219-27250 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041679 Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence 22899-22930 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN822125 Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence 56141-56172 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025709 Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized 30370-30401 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026576 Escherichia coli strain WCHEC005237 plasmid pCTX-M-55_005237, complete sequence 20563-20594 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010239 Escherichia coli strain S50 plasmid A, complete sequence 8758-8789 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP010239 Escherichia coli strain S50 plasmid A, complete sequence 149947-149978 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015914 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence 59269-59300 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015916 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence 91121-91152 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 54524-54555 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 134419-134450 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 94369-94400 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN823987 Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence 193433-193464 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 116365-116396 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049172 Shigella sonnei strain 0401930105 plasmid p0401930105 73129-73160 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 JX486126 Uncultured bacterium plasmid pEFC36a, complete sequence 53034-53065 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021711 Klebsiella pneumoniae strain AR_0143 plasmid tig00000856, complete sequence 53671-53702 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP047660 Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence 118403-118434 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP011496 Escherichia coli strain NCM3722 isolate K-12 plasmid F, complete sequence 60313-60344 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 KY749247 Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence 48085-48116 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049170 Shigella sonnei strain 19.1125.3493 plasmid p19-1125-3493, complete sequence 72681-72712 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP043949 Escherichia coli strain AR202.2 plasmid pMPCMY-2, complete sequence 60433-60464 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 40259-40290 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025139 Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence 28767-28798 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049168 Shigella sonnei strain 09163633 plasmid p09163633, complete sequence 62796-62827 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019173 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence 80013-80044 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP023221 Escherichia coli M505 plasmid pM505-a DNA, complete genome 53074-53105 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP023232 Escherichia coli YJ4 plasmid pYJ4-a DNA, complete genome 117739-117770 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019090 Escherichia coli plasmid pHK23a, complete sequence 21382-21413 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 25319-25350 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023534 Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence 65585-65616 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 18380-18411 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 65077-65108 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049166 Shigella sonnei strain 0401952027 plasmid p0401952027, complete sequence 69472-69503 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_019111 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence 67788-67819 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016522 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence 30574-30605 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019190 Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence 179681-179712 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN335639 Escherichia coli strain SFE059 plasmid pSFE059, complete sequence 41795-41826 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN419308 Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence 25879-25910 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 17193-17224 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029974 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_A, complete sequence 18843-18874 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 23223-23254 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_012944 Escherichia coli Vir68 plasmid pVir68, complete sequence 44400-44431 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040455 Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence 60293-60324 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018343 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-6, complete sequence 10410-10441 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015836 Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence 31331-31362 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015838 Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence 35697-35728 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034056 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed3, complete sequence 35769-35800 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034592 Escherichia coli strain L37 plasmid pL37-4, complete sequence 38603-38634 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP049611 Escherichia coli strain 06-3538 plasmid p06-3538-2 74055-74086 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025339 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence 72109-72140 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016865 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence 30114-30145 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029842 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence 27378-27409 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018104 Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence 141047-141078 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 107457-107488 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032888 Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence 39723-39754 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP043229 Escherichia coli strain Ec-050 plasmid pEc-050-CMY-2, complete sequence 48719-48750 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_022742 Escherichia coli plasmid pHUSEC2011-1, complete sequence 21014-21045 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019220 Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence 2998-3029 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP043945 Escherichia coli strain AR216.2b plasmid pMPCMY-2, complete sequence 14888-14919 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027415 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence 50982-51013 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP034048 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed3, complete sequence 32998-33029 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP029903 Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence 21014-21045 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP020340 Shigella flexneri 4c strain 0702 plasmid unnamed1, complete sequence 17403-17434 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 12629-12660 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 23224-23255 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_023915 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome 30756-30787 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP027673 Escherichia coli strain 2014C-3003 plasmid unnamed1 77324-77355 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MH884650 Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence 47782-47813 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 47782-47813 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP042936 Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence 14214-14245 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 65267-65298 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025253 Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence 23847-23878 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_AP014806 Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-3, complete sequence 21603-21634 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_AP018136 Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence 31105-31136 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LR213461 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 4 80736-80767 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 135932-135963 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP021739 Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence 32373-32404 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 128428-128459 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985248 Escherichia coli strain 720 plasmid RCS48_pI, complete sequence 13196-13227 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP019905 Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence 10146-10177 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MK295829 Escherichia coli O25b:H4-ST131 strain 13.1 plasmid p131, complete sequence 8397-8428 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP026589 Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence 25874-25905 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP049102 Escherichia coli strain EC28 plasmid p2, complete sequence 126637-126668 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 56596-56627 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 2930-2961 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041441 Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence 51843-51874 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025254 Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence 23844-23875 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 109382-109413 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP014320 Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence 55779-55810 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985306 Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence 52869-52900 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985275 Escherichia coli strain R71 plasmid RCS70_p, complete sequence 79548-79579 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985305 Escherichia coli strain ECOR 48 plasmid RCS84_p, complete sequence 16269-16300 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985227 Escherichia coli strain 518 plasmid RCS28_pI, complete sequence 14562-14593 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985288 Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence 18631-18662 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985267 Escherichia coli strain 637 plasmid RCS61_p, complete sequence 69801-69832 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985281 Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence 23316-23347 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_LT985256 Escherichia coli strain 580 plasmid RCS49_p, complete sequence 13363-13394 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP031656 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence 15079-15110 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 137764-137795 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK416152 Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence 33563-33594 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK291500 Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence 77011-77042 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK878893 Escherichia coli strain J53 plasmid pMG335, complete sequence 67650-67681 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN101852 Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence 48144-48175 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN101857 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-92, complete sequence 42483-42514 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 169083-169114 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN101854 Escherichia coli strain 13ZX36 plasmid p13ZX36-70, complete sequence 9759-9790 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 144948-144979 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 55156-55187 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MH674341 Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence 37679-37710 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN702385 Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence 18635-18666 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN540570 Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence 77792-77823 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 48215-48246 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK778454 Salmonella enterica strain W043 plasmid pYUW043, complete sequence 24866-24897 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MN241905 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence 69306-69337 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_005327 Escherichia coli plasmid pC15-1a, complete sequence 35175-35206 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 110388-110419 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 47096-47127 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP053082 Escherichia coli strain HB37 plasmid pHB37-2, complete sequence 18208-18239 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP045943 Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_02, complete sequence 31606-31637 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MH255829 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence 45571-45602 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK079570 Klebsiella pneumoniae strain BC6-3 plasmid pHNBC6-3, complete sequence 21231-21262 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 39391-39422 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 43821-43852 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK238490 Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence 53535-53566 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MH472638 Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence 30159-30190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 23784-23815 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK048477 Escherichia coli strain U-5227 plasmid pUB_DHA-1, complete sequence 73771-73802 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK079574 Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence 64896-64927 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK092064 Escherichia coli strain 39R861 plasmid 39R861-3, complete sequence 12853-12884 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 25879-25910 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MK416155 Escherichia coli strain AR24.2b plasmid pCMY-42, complete sequence 43873-43904 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027127 Escherichia coli strain AR_0374 plasmid unnamed2 13026-13057 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP038858 Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence 82440-82471 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT090959 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence 96275-96306 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 24093-24124 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197492 Escherichia coli strain GDK4P177 plasmid pHNGD4P177, complete sequence 21231-21262 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF168403 Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence 25878-25909 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197488 Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence 55229-55260 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 29410-29441 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197489 Escherichia coli strain MC02 plasmid pHNMC02, complete sequence 21231-21262 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 59797-59828 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197497 Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence 25159-25190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 25877-25908 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197496 Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence 23593-23624 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 93514-93545 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 96416-96447 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF363048 Klebsiella pneumoniae strain SB4816 plasmid pSB4816, complete sequence 6073-6104 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 96416-96447 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197499 Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence 23064-23095 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 128886-128917 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF168405 Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence 25877-25908 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF370216 Escherichia coli strain J53 plasmid pOX38-Gen, complete sequence 52097-52128 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF535908 Escherichia coli strain 2269 plasmid pCTXM-2269, complete sequence 17250-17281 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF168406 Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence 25697-25728 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG825370 Escherichia coli strain 974 plasmid p974-NDM, complete sequence 23341-23372 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF078004 Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence 77475-77506 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF156697 Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence 108757-108788 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 39391-39422 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG825377 Escherichia coli strain 1108 plasmid p1108-emrB, complete sequence 31329-31360 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MF174860 Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence 120194-120225 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG764548 Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence 52349-52380 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG825376 Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence 29941-29972 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 56623-56654 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG844436 Escherichia coli strain EC13 plasmid pCMY-136, complete sequence 24106-24137 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197490 Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence 55229-55260 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197494 Escherichia coli strain AHC17 plasmid pHNAH17, complete sequence 46988-47019 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 96416-96447 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG591701 Escherichia coli strain EC36 plasmid pEC36-2, complete sequence 15928-15959 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 LN897474 Klebsiella pneumoniae p397Kp plasmid, complete sequence 25159-25190 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 LN897475 Klebsiella pneumoniae p477Kp plasmid, complete sequence 23064-23095 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 148439-148470 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP016568 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318 plasmid pAMR588-04-00318_99, complete sequence 30568-30599 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP032226 Klebsiella pneumoniae strain AR_0046 plasmid unnamed4, complete sequence 76832-76863 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN823991 Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence 43713-43744 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 55298-55329 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY865321 Escherichia coli strain CH292B plasmid pECB11, complete sequence 42483-42514 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY865322 Escherichia coli strain DH286F plasmid pECF12, complete sequence 28318-28349 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY964068 Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence 10869-10900 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197500 Klebsiella pneumoniae strain HZMPC51-2 plasmid pHNMPC51, complete sequence 17914-17945 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG197501 Klebsiella pneumoniae strain HZMPC43 plasmid pHNMPC43, complete sequence 17914-17945 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 41488-41519 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 CP043740 Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence 69049-69080 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 101242-101273 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 71410-71441 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MN548042 Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence 33209-33240 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT108205 Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence 44282-44313 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT108206 Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence 652-683 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 MT108208 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence 70144-70175 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP028611 Escherichia coli strain 142 plasmid pTA142-2, complete sequence 16692-16723 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 92446-92477 0 1.0
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP040536 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence 29213-29244 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 22967-22998 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031904 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed19, complete sequence 38744-38775 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 214923-214954 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KY075650 Escherichia coli strain GD17 plasmid pGD17-2, complete sequence 54291-54322 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP018456 Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP018457 Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP018458 Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN783745 Escherichia coli plasmid pFII-FIB, complete sequence 52610-52641 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KX808482 Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence 42975-43006 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KU355873 Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence 93665-93696 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP045828 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_01, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015070 Escherichia coli strain Ecol_743 plasmid pEC743_1, complete sequence 15213-15244 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 85639-85670 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 10249-10280 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038792 Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP019526 Escherichia coli O25b:H4-ST131 B0018 plasmid pB0018 DNA, complete sequence 84378-84409 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042630 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence 55268-55299 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041338 Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence 35672-35703 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP035517 Escherichia coli strain U14A plasmid pU14A_A, complete sequence 43857-43888 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LR130565 Escherichia coli strain MS14387 isolate MS14387 plasmid 2 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP054346 Escherichia coli strain SCU-176 plasmid pSCU-176-1, complete sequence 13692-13723 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024272 Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence 121279-121310 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028484 Escherichia coli strain E41-1 plasmid p1, complete sequence 69110-69141 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP030112 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75A, complete sequence 885-916 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025857 Escherichia coli strain 504838 plasmid p504838_108, complete sequence 69778-69809 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP035478 Escherichia coli strain U13A plasmid pU13A_A, complete sequence 87898-87929 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014493 Escherichia coli strain MVAST0167 plasmid pMVAST0167_1, complete sequence 69394-69425 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013354 Escherichia coli O103:H2 str. 12009 plasmid pO103, complete sequence 58096-58127 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013655 Escherichia coli SE15 plasmid pECSF1, complete sequence 97839-97870 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP013192 Escherichia coli strain FORC_031 plasmid pFORC31.2, complete sequence 25863-25894 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024227 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence 58354-58385 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP011136 Escherichia coli VR50 plasmid pVR50B, complete sequence 13773-13804 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031909 Escherichia coli O103:H2 strain FWSEC0007 plasmid unnamed16, complete sequence 36684-36715 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 85638-85669 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS992186 Escherichia coli isolate Escherichia coli str. 3426 plasmid 2, complete sequence 58950-58981 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP009105 Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence 10247-10278 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP017846 Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence 16317-16348 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021289 Escherichia coli strain PA45B plasmid pPA45B, complete sequence 113743-113774 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053724 Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFIC, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044404 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS992181 Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence 8827-8858 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS992181 Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence 142920-142951 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014496 Escherichia coli strain SaT040 plasmid pSaT040, complete sequence 100756-100787 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP046678 Escherichia coli strain 152661 plasmid p152661_p2, complete sequence 26150-26181 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024248 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence 94752-94783 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024274 Escherichia coli strain F9792 plasmid unnamed, complete sequence 71979-72010 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041619 Shigella flexneri strain C32 plasmid pC32_1, complete sequence 9826-9857 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP030770 Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence 92545-92576 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP054941 Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence 115899-115930 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012683 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence 25300-25331 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024286 Escherichia albertii strain 2014C-4356 plasmid unnamed4, complete sequence 98409-98440 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027326 Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence 36267-36298 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP020515 Escherichia coli strain 219 plasmid unnamed, complete sequence 95945-95976 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019261 Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence 106503-106534 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012634 Escherichia coli strain SF-166 plasmid pSF-166-1, complete sequence 99899-99930 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042640 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-2, complete sequence 55317-55348 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP045279 Escherichia coli strain LAU-OXA plasmid pLAU-OXA2, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 48820-48851 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 101898-101929 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023845 Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence 86212-86243 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021180 Escherichia coli strain 81009 plasmid pEC-81009, complete sequence 51340-51371 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024229 Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed1 35045-35076 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024887 Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence 94932-94963 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027460 Escherichia coli strain 90-3040 plasmid unnamed, complete sequence 72957-72988 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027343 Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence 51246-51277 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041415 Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence 39289-39320 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015160 Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence 211816-211847 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_018666 Escherichia coli O104:H4 str. 2011C-3493 plasmid pAA-EA11, complete sequence 32566-32597 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038384 Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-3, complete sequence 64-95 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038388 Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence 15596-15627 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_008460 Escherichia coli plasmid pO86A1, complete sequence 35907-35938 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014523 Escherichia coli strain ZH063 plasmid pZH063_1, complete sequence 69248-69279 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP007150 Escherichia coli RS218 plasmid pRS218, complete sequence 46339-46370 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029580 Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence 43082-43113 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014498 Escherichia coli strain ZH193 plasmid pZH193, complete sequence 82466-82497 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053232 Escherichia coli strain SCU-306 plasmid pSCU-306-1, complete sequence 36449-36480 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053248 Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053246 Escherichia coli strain SCU-485 plasmid pSCU-485-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_007941 Escherichia coli UTI89 plasmid pUTI89, complete sequence 46340-46371 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027389 Escherichia coli strain 2011C-4251 plasmid unnamed 31232-31263 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029577 Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence 95938-95969 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038298 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-4, complete sequence 9367-9398 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019018 Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence 2574-2605 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014753 Escherichia coli strain PSUO103 plasmid, complete sequence 55546-55577 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019456 Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence 6876-6907 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027463 Escherichia coli isolate 07-4299 plasmid unnamed 19250-19281 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LT985303 Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pII 12076-12107 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038397 Escherichia coli O157:H7 strain DEC5A plasmid pDEC5A-4, complete sequence 9337-9368 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012498 Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence 182933-182964 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015239 Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence 125472-125503 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP043415 Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010882 Escherichia coli strain MNCRE44 plasmid pMNCRE44_6, complete sequence 78386-78417 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP039842 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_2, complete sequence 48945-48976 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP014654 Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence 22014-22045 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012500 Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence 189461-189492 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015131 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence 53665-53696 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 78532-78563 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024831 Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence 27787-27818 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051655 Escherichia coli strain RM13745 plasmid pRM13745-2 3734-3765 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051657 Escherichia coli strain SJ7 plasmid pSJ7-1 13470-13501 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051656 Escherichia coli strain RM11911 plasmid pRM11911 9709-9740 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_011964 Escherichia coli plasmid pAPEC-O103-ColBM, complete sequence 4452-4483 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_014233 Escherichia coli ETEC 1392/75 plasmid p557, complete sequence 43410-43441 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_018662 Escherichia coli O104:H4 str. 2009EL-2071 plasmid pAA-09EL71, complete sequence 4797-4828 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027311 Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence 106262-106293 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027549 Escherichia coli strain 2014C-3061 plasmid unnamed, complete sequence 48690-48721 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 36971-37002 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LT985252 Escherichia coli strain 666 plasmid RCS51_p, complete sequence 27206-27237 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032202 Escherichia coli strain AR_0086 plasmid unnamed1, complete sequence 93992-94023 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025841 Escherichia coli strain 214-4 plasmid p214_4_132, complete sequence 46515-46546 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP009233 Escherichia coli strain CA08 plasmid pCA08, complete sequence 133766-133797 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP017221 Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP007135 Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence 75079-75110 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_017647 Escherichia coli O7:K1 str. CE10 plasmid pCE10A, complete sequence 39460-39491 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP035468 Escherichia coli strain U12A plasmid pU12A_A, complete sequence 87898-87929 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051707 Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LR130563 Escherichia coli strain MS14384 isolate MS14384 plasmid 2 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051701 Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_018654 Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence 70285-70316 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027585 Escherichia coli strain 00-3076 plasmid unnamed, complete sequence 66539-66570 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP006263 Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence 75078-75109 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051712 Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051689 Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 18029-18060 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051726 Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP018785 Escherichia coli strain SK1144 plasmid pSK1144 125122-125153 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021690 Escherichia coli strain AR_0058 plasmid tig00007555j7554, complete sequence 51441-51472 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023372 Escherichia coli strain 1283 plasmid p109, complete sequence 95729-95760 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024816 Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence 60626-60657 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024039 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ndm, complete sequence 26409-26440 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP043544 Escherichia coli strain F2_81 plasmid pF2_18C_FIB, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024480 Escherichia coli strain 2011C-4315 plasmid unnamed1, complete sequence 36237-36268 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027545 Escherichia coli strain 2013C-3264 plasmid unnamed, complete sequence 2757-2788 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019954 Escherichia coli M8 plasmid unnamed1, complete sequence 67412-67443 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042900 Escherichia coli strain CFSAN061763 plasmid pCFSAN061763, complete sequence 81583-81614 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024265 Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence 35265-35296 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024151 Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence 10075-10106 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051734 Escherichia coli strain SCU-109 plasmid pSCU-109-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051736 Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023734 Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence 49171-49202 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051715 Escherichia coli strain SCU-122 plasmid pSCU-122-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013175 Escherichia coli plasmid pEC14_114, complete sequence 46340-46371 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042296 Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence 70335-70366 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP022913 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence 16578-16609 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024258 Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence 74820-74851 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 31000-31031 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018982 Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence 96801-96832 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018952 Escherichia coli strain Ecol_276 plasmid pEC276_1, complete sequence 33387-33418 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042879 Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042881 Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_03, complete sequence 33231-33262 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018998 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_2, complete sequence 71387-71418 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023530 Escherichia coli strain FDAARGOS_401 plasmid unnamed, complete sequence 60229-60260 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_019122 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence 87234-87265 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP022280 Escherichia coli strain STEC299 plasmid pSTEC299_1, complete sequence 121242-121273 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042902 Escherichia coli strain CFSAN061762 plasmid pCFSAN061762, complete sequence 93991-94022 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018207 Escherichia coli strain MRSN346647 plasmid pMRSN346647_113.1, complete sequence 63867-63898 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027364 Escherichia coli strain 88-3001 plasmid unnamed, complete sequence 74103-74134 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032165 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence 108302-108333 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015242 Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence 11558-11589 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024129 Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence 122573-122604 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027446 Escherichia coli strain 2013C-3492 plasmid unnamed, complete sequence 27697-27728 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027458 Escherichia coli strain 88-3493 plasmid unnamed, complete sequence 38181-38212 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 40254-40285 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027453 Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence 24468-24499 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP016498 Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence 141278-141309 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP009167 Escherichia coli 1303 plasmid p1303_109, complete sequence 35877-35908 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054382 Escherichia coli strain SCU-175 plasmid pSCU-175-3, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP022610 Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence 124934-124965 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041111 Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042247 Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042974 Escherichia coli strain CFSAN061768 plasmid pCFSAN061768, complete sequence 34437-34468 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024235 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed3, complete sequence 37781-37812 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015140 Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence 58372-58403 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041358 Escherichia coli strain U1 plasmid unnamed1, complete sequence 29248-29279 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018947 Escherichia coli strain Ecol_224 plasmid pEC224_1, complete sequence 116578-116609 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018969 Escherichia coli strain Ecol_542 plasmid pEC542_1, complete sequence 60987-61018 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023384 Escherichia coli strain 1223 plasmid p147, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027367 Escherichia coli strain 89-3156 plasmid unnamed, complete sequence 4512-4543 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 71544-71575 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS992169 Escherichia coli isolate Escherichia coli str. TO60 plasmid 2, complete sequence 29066-29097 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019028 Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence 87809-87840 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_011416 Escherichia coli SE11 plasmid pSE11-3, complete sequence 10570-10601 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP043407 Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP047406 Escherichia coli strain MS6193 plasmid pMS6193A-NDM, complete sequence 115903-115934 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054450 Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence 38608-38639 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LN908840 Escherichia coli plasmid pCss_E1373 131291-131322 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023378 Escherichia coli strain 127 plasmid p123, complete sequence 41505-41536 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 41994-42025 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP011418 Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_02, complete sequence 23699-23730 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP013028 Escherichia coli strain 2012C-4227 plasmid unnamed1, complete sequence 19224-19255 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_017630 Escherichia coli UM146 plasmid pUM146, complete sequence 68059-68090 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP048648 Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012499 Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence 63889-63920 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 110628-110659 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028121 Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence 85656-85687 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025708 Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014668 Escherichia coli strain ECONIH2 plasmid pECO-bc6, complete sequence 33287-33318 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041001 Escherichia coli strain FDAARGOS_772 plasmid unnamed1, complete sequence 41652-41683 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021871 Escherichia coli strain H105 plasmid pH105, complete sequence 124280-124311 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015914 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence 104706-104737 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028576 Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032258 Escherichia coli strain AR_0067 plasmid unnamed1, complete sequence 51088-51119 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP034167 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence 5450-5481 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP030786 Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence 74219-74250 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN823989 Klebsiella pneumoniae strain 283149 plasmid p283149-FII, complete sequence 32620-32651 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP025574 Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence 27659-27690 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024249 Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence 132235-132266 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 85643-85674 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_017657 Escherichia coli O55:H7 str. RM12579 plasmid p12579_2, complete sequence 57320-57351 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023533 Escherichia coli strain FDAARGOS_403 plasmid unnamed2, complete sequence 2536-2567 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP022087 Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence 61857-61888 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP014110 Escherichia coli strain FDAARGOS_144 plasmid unnamed1, complete sequence 45851-45882 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024291 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence 18684-18715 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_019117 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence 83855-83886 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023164 Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence 112803-112834 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019055 Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence 88925-88956 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023821 Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence 69821-69852 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054321 Escherichia coli strain SCU-390 plasmid pSCU-390-1, complete sequence 67738-67769 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027106 Escherichia coli strain RM14721 plasmid pRM14721, complete sequence 39862-39893 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP022357 Escherichia coli E119 plasmid pE119_6kIMP6 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 AP022359 Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence 146311-146342 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028321 Escherichia coli O18:H1 strain CFSAN067215 plasmid p0.1229_1, complete sequence 5000-5031 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520279 Escherichia coli H0063 plasmid pH0063 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520280 Escherichia coli H0106 plasmid pH0106 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520281 Escherichia coli H0130 plasmid pH0130 DNA, complete sequence 21104-21135 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520282 Escherichia coli I0082 plasmid pI0082 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520283 Escherichia coli I0128 plasmid pI0128 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520284 Escherichia coli HP003 plasmid pHP003 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520285 Escherichia coli HP030 plasmid pHP030 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520286 Escherichia coli HP050 plasmid pHP050 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520287 Escherichia coli HP129 plasmid pHP129 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520288 Escherichia coli HP223 plasmid pHP223 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520289 Escherichia coli HP243 plasmid pHP243 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_012944 Escherichia coli Vir68 plasmid pVir68, complete sequence 24117-24148 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013951 Klebsiella pneumoniae plasmid pKF3-140, complete sequence 144657-144688 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520268 Escherichia coli C0044 plasmid pC0044 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520269 Escherichia coli A0084 plasmid pA0084 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520270 Escherichia coli A0086 plasmid pA0086 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520271 Escherichia coli A0140 plasmid pA0140 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520272 Escherichia coli A0145 plasmid pA0145 DNA, complete sequence 20547-20578 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520273 Escherichia coli A0150 plasmid pA0150 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520274 Escherichia coli C0079 plasmid pC0079 DNA, complete sequence 74409-74440 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520274 Escherichia coli C0079 plasmid pC0079 DNA, complete sequence 81777-81808 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520274 Escherichia coli C0079 plasmid pC0079 DNA, complete sequence 89154-89185 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520274 Escherichia coli C0079 plasmid pC0079 DNA, complete sequence 96526-96557 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520274 Escherichia coli C0079 plasmid pC0079 DNA, complete sequence 103896-103927 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520275 Escherichia coli C0122 plasmid pC0122 DNA, complete sequence 21104-21135 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520276 Escherichia coli F0090 plasmid pF0090 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520277 Escherichia coli G0138 plasmid pG0138 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LC520278 Escherichia coli H0005 plasmid pH0005 DNA, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP054355 Escherichia coli strain SCU-172 plasmid pSCU-172-2, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013942 Escherichia coli O55:H7 str. CB9615 plasmid pO55, complete sequence 57354-57385 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP045999 Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence 59174-59205 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_022743 Escherichia coli plasmid pHUSEC2011-2, complete sequence 228-259 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP027581 Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence 52608-52639 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP027674 Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence 33408-33439 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP027676 Escherichia coli strain 88-3510 plasmid unnamed 12741-12772 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010201 Escherichia coli strain M10 plasmid A, complete sequence 102833-102864 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027392 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence 58254-58285 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP033847 Escherichia coli strain FDAARGOS_497 plasmid unnamed1, complete sequence 79594-79625 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031323 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence 21811-21842 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP014804 Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence 326-357 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP022651 Escherichia coli strain 09-02E plasmid p1-09-02E, complete sequence 163-194 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054414 Escherichia coli strain SCU-204 plasmid pSCU-204-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019009 Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_3, complete sequence 105249-105280 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295824 Escherichia coli O25b:H4-ST131 strain 26 plasmid p26, complete sequence 87185-87216 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295827 Escherichia coli O25b:H4-ST131 strain U17 plasmid pU17, complete sequence 69883-69914 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295828 Escherichia coli O25b:H4-ST131 strain U23 plasmid pU23, complete sequence 101238-101269 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295829 Escherichia coli O25b:H4-ST131 strain 13.1 plasmid p131, complete sequence 127205-127236 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295830 Escherichia coli O25b:H4-ST131 strain 425 plasmid p425, complete sequence 114909-114940 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295834 Escherichia coli O25b:H4-ST131 strain 56 plasmid p56, complete sequence 90056-90087 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP026930 Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP037904 Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LT985219 Escherichia coli strain 497 plasmid RCS21_p, complete sequence 3903-3934 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LT985226 Escherichia coli strain 525 plasmid RCS27_p, complete sequence 3872-3903 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LT985309 Escherichia coli strain CIP106223 plasmid RCS93_pI, complete sequence 55852-55883 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295817 Escherichia coli O25b:H4-ST131 strain B9 plasmid pB9, complete sequence 98006-98037 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MK295819 Escherichia coli O25b:H4-ST131 strain U10 plasmid pU10, complete sequence 127367-127398 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023471 Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence 56005-56036 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP026934 Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_MK134376 Escherichia coli strain 47EC plasmid p47EC, complete sequence 29284-29315 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN124286 Escherichia coli strain RKI3099 plasmid pRKI3099b, complete sequence 63-94 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP039405 Escherichia coli strain 377323_2f plasmid unnamed, complete sequence 32688-32719 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_MH523448 Klebsiella pneumoniae strain KL8 plasmid pKL8-NDM, complete sequence 70347-70378 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_MN218686 Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence 51254-51285 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_MG886288 Escherichia coli strain MO plasmid pMO, complete sequence 66562-66593 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029422 Escherichia coli strain 3385 plasmid unnamed2, complete sequence 17285-17316 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LC492469 Escherichia coli strain M216 plasmid pM216_mF, complete sequence 120578-120609 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044190 Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence 105518-105549 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023827 Escherichia coli strain 4/4 plasmid p4_4.1, complete sequence 55308-55339 0 1.0
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054318 Escherichia coli strain SCU-479 plasmid pSCU-479-1, complete sequence 111248-111279 0 1.0
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14191-14244 0 1.0
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 156235-156266 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP009105 Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence 156234-156265 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 133692-133723 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028120 Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence 61346-61377 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP019762 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence 41043-41074 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP018797 Escherichia coli strain E2855 plasmid pE2855-1, complete sequence 44415-44446 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP027673 Escherichia coli strain 2014C-3003 plasmid unnamed1 88033-88064 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 32732-32763 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 32271-32302 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031903 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence 66829-66860 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP038793 Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence 13793-13824 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP038793 Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence 23542-23573 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 22824-22855 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN612051 Escherichia coli strain BM21 plasmid pIP72, complete sequence 3936-3967 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP053754 Shigella sonnei strain 506 plasmid pMHMC-003, complete sequence 74906-74937 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_012487 Escherichia coli plasmid pO26-Vir, complete sequence 79462-79493 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985300 Escherichia coli strain ECOR 24 genome assembly, plasmid: RCS90_pI 10641-10672 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP035469 Escherichia coli strain U12A plasmid pU12A_B, complete sequence 45526-45557 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP051713 Escherichia coli strain SCU-123 plasmid pSCU-123-2, complete sequence 15287-15318 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023387 Escherichia coli strain 1190 plasmid p86, complete sequence 15439-15470 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 65466-65497 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025145 Escherichia coli plasmid pL2-87, complete sequence 83591-83622 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025145 Escherichia coli plasmid pL2-87, complete sequence 6298-6329 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024254 Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence 1713-1744 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024254 Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence 97501-97532 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP054380 Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence 22591-22622 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP035721 Escherichia coli strain U15A plasmid pU15A_A, complete sequence 45526-45557 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032260 Escherichia coli strain AR_0067 plasmid unnamed3, complete sequence 71448-71479 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP022673 Shigella sonnei strain 866 plasmid p866, complete sequence 93878-93909 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP054354 Escherichia coli strain SCU-172 plasmid pSCU-172-1, complete sequence 15574-15605 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 15364-15395 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MK396099 Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence 97430-97461 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MK455767 Escherichia coli strain Ec-2Lar plasmid pB-Ec2, complete sequence 86559-86590 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 18684-18715 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 16977-17008 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 77081-77112 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG569891 Shigella sonnei strain DE105 plasmid pDE105, complete sequence 73758-73789 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 29903-29934 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 1001-1032 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 50682-50713 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_015965 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence 16964-16995 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KT779550 Escherichia coli strain 369 plasmid p369, complete sequence 51423-51454 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM377238 Escherichia coli strain HV114 plasmid pHV114, complete sequence 43156-43187 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM377239 Escherichia coli strain HV292 plasmid pHV292, complete sequence 49436-49467 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KP198616 Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence 44710-44741 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM377240 Escherichia coli strain HV295 plasmid pHV295, complete sequence 37253-37284 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 7126-7157 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KP789019 Escherichia coli strain WCHEC13-8 plasmid pCMY42, complete sequence 49947-49978 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 80664-80695 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042631 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence 85853-85884 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP046284 Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence 7410-7441 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024918 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.2, complete sequence 31831-31862 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 122267-122298 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 244379-244410 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP017613 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence 67852-67883 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP017613 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence 77577-77608 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022996 Escherichia coli plasmid pO26-CRL-125, complete sequence 48821-48852 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022996 Escherichia coli plasmid pO26-CRL-125, complete sequence 58546-58577 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032445 Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence 19350-19381 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KT754167 Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence 116123-116154 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022992 Escherichia coli plasmid pO111-CRL-115, complete sequence 48965-48996 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022267 Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence 21831-21862 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP013193 Escherichia coli strain FORC_031 plasmid pFORC31.3, complete sequence 10776-10807 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 53830-53861 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 54902-54933 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP014622 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence 23052-23083 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP049350 Escherichia coli strain 3R plasmid p3R-2, complete sequence 34566-34597 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP039299 Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence 37319-37350 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP042951 Escherichia coli strain D8-1 plasmid pD8-1_2, complete sequence 91658-91689 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LS992187 Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence 66169-66200 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053786 Escherichia coli isolate 2-101 plasmid p2-101, complete sequence 41190-41221 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 36206-36237 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP043738 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence 26869-26900 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP020511 Escherichia coli strain 165 plasmid unnamed2, complete sequence 68997-69028 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 101198-101229 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LS999562 Escherichia coli isolate EC-TO143 plasmid 3, complete sequence 40579-40610 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053788 Escherichia coli isolate J31 plasmid pJ31, complete sequence 41190-41221 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KF290378 Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence 32278-32309 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 56247-56278 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP020494 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-2, complete sequence 26106-26137 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP012627 Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence 77234-77265 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_009788 Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence 2028-2059 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN007140 Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence 17860-17891 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_EU418926 Escherichia coli strain JIE139 plasmid pJIE139, complete sequence 20737-20768 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP044402 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence 18825-18856 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 43927-43958 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025198 Escherichia coli plasmid pJIE512b, complete sequence 27597-27628 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP026726 Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence 16555-16586 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019252 Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence 67429-67460 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP006641 Escherichia coli PCN061 plasmid PCN061p5, complete sequence 36232-36263 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 131388-131419 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 21054-21085 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 58839-58870 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 35270-35301 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041621 Shigella flexneri strain C32 plasmid pC32_2, complete sequence 39736-39767 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015996 Escherichia coli strain S51 plasmid pS51_1, complete sequence 50160-50191 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045189 Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence 19766-19797 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 30654-30685 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 90641-90672 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP026855 Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence 80706-80737 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019248 Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence 52649-52680 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP014096 Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence 40946-40977 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_023329 Escherichia coli strain B3804 plasmid pIFM3804, complete sequence 36938-36969 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP014966 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence 173083-173114 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP022064 Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence 48001-48032 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021841 Escherichia coli strain EC974 plasmid pEC974-1, complete sequence 49284-49315 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027374 Escherichia coli strain 05-3629 plasmid unnamed1, complete sequence 82493-82524 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP009052 Escherichia coli NCCP15648 plasmid p15648-2, complete sequence 16576-16607 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016572 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence 32058-32089 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041959 Escherichia coli strain EC2 plasmid pEC2_4, complete sequence 16626-16657 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041413 Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence 59335-59366 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015161 Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence 39704-39735 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP053576 Salmonella enterica strain 2012K-0845 plasmid unnamed1, complete sequence 8438-8469 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP038347 Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence 15682-15713 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_014477 Escherichia coli plasmid pCT, complete sequence 20638-20669 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040923 Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence 45185-45216 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP044137 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence 54367-54398 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP044183 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence 14397-14428 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 78795-78826 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032264 Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence 86754-86785 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 31102-31133 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181557 Escherichia coli plasmid p14019095, complete sequence 40610-40641 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181558 Escherichia coli plasmid p15076331, complete sequence 40618-40649 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181559 Escherichia coli plasmid p199, complete sequence 52196-52227 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181560 Escherichia coli plasmid p14006165, complete sequence 40781-40812 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181561 Escherichia coli plasmid p14011252, complete sequence 40334-40365 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181562 Escherichia coli plasmid p15090172, complete sequence 38997-39028 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181563 Escherichia coli plasmid p15095941, complete sequence 41847-41878 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181564 Escherichia coli plasmid p15124679, complete sequence 40781-40812 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181565 Escherichia coli plasmid pESBL20140131, complete sequence 41980-42011 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181566 Escherichia coli plasmid p15078279, complete sequence 41236-41267 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MK181568 Escherichia coli plasmid pESBL20150178, complete sequence 40577-40608 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 65208-65239 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 11345-11376 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 41243-41274 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030000 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence 31648-31679 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MF152729 Escherichia coli plasmid pCTXM1-MU2, complete sequence 42478-42509 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN334219 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence 28433-28464 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN334219 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence 38158-38189 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN334220 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence 38483-38514 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN334220 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence 48208-48239 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_024979 Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence 42255-42286 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016387 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence 89860-89891 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042618 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence 38637-38668 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_024976 Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence 24803-24834 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_024978 Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence 41516-41547 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LC019731 Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01 53235-53266 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985283 Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI 27528-27559 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040548 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence 33044-33075 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 AP017892 Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23 84341-84372 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 AP017893 Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11 81986-82017 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP030839 Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence 19659-19690 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029110 Escherichia coli strain AR436 plasmid unnamed2 87182-87213 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030232 Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence 19889-19920 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP034255 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11 10188-10219 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP018803 Escherichia coli strain E2863 plasmid pE2863-1, complete sequence 46143-46174 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP018803 Escherichia coli strain E2863 plasmid pE2863-1, complete sequence 55867-55898 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KY463221 Escherichia coli plasmid pCMY-42, complete sequence 18973-19004 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053867 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence 22911-22942 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053868 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence 22911-22942 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040264 Escherichia coli strain 631 plasmid pEc631_1, complete sequence 18448-18479 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040264 Escherichia coli strain 631 plasmid pEc631_1, complete sequence 28161-28192 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021533 Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence 15289-15320 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024854 Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence 29560-29591 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027600 Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence 8508-8539 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027600 Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence 119391-119422 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 7507-7538 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045519 Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_CMY, complete sequence 29765-29796 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045467 Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence 67465-67496 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025180 Escherichia coli plasmid pC23-89, complete sequence 48730-48761 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_005014 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence 55991-56022 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_023290 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dT, complete sequence 44119-44150 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019205 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence 65559-65590 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985236 Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI 24804-24835 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985231 Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII 49306-49337 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985238 Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI 24807-24838 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985320 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII 6552-6583 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985320 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII 99544-99575 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP051702 Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence 21916-21947 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_023275 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134, complete sequence 50630-50661 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_023276 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dAT, complete sequence 26340-26371 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP039490 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence 61479-61510 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031615 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence 5532-5563 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_AP019190 Escherichia coli strain M217 plasmid pM217_I1, complete sequence 16967-16998 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP033160 Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM 37023-37054 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP048373 Escherichia coli strain 164 plasmid pC-F-163_B, complete sequence 16493-16524 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP051720 Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence 15068-15099 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023376 Escherichia coli strain 1283 plasmid p92, complete sequence 27176-27207 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024822 Escherichia coli strain CREC-591 plasmid pCREC-591_1, complete sequence 27625-27656 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024976 Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence 42080-42111 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 22932-22963 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024481 Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence 22398-22429 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP036181 Escherichia coli strain WCHEC025970 plasmid p2_025970, complete sequence 34060-34091 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932026 Escherichia coli plasmid pEC14II_1, complete sequence 53103-53134 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932027 Escherichia coli plasmid pEC14II_2, complete sequence 52921-52952 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932029 Escherichia coli plasmid pEC15I_1, complete sequence 71910-71941 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932030 Escherichia coli plasmid pEC15I_2, complete sequence 71866-71897 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932032 Escherichia coli plasmid pEC16I_1, complete sequence 55052-55083 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 KU932033 Escherichia coli plasmid pEC16I_2, complete sequence 56107-56138 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MG516908 Escherichia coli plasmid pEc42, complete sequence 47577-47608 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025176 Escherichia coli plasmid pH2291-112, complete sequence 1398-1429 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 48603-48634 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025138 Escherichia coli plasmid pH2332-107, complete sequence 14248-14279 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025138 Escherichia coli plasmid pH2332-107, complete sequence 23972-24003 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025140 Escherichia coli plasmid pH1519-88, complete sequence 5152-5183 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025142 Escherichia coli plasmid pC60-108, complete sequence 60897-60928 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025143 Escherichia coli plasmid pC59-112, complete sequence 87609-87640 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_025144 Escherichia coli plasmid pC49-108, complete sequence 65130-65161 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016533 Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence 27191-27222 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024146 Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence 5485-5516 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027535 Escherichia coli strain AR_0081 plasmid unnamed1, complete sequence 79605-79636 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP009566 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence 86949-86980 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP013024 Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence 79506-79537 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP013024 Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence 89231-89262 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029119 Escherichia coli strain AR435 plasmid unnamed6 4682-4713 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030921 Escherichia coli strain KL53 plasmid pKL53-M, complete sequence 44326-44357 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP054459 Escherichia coli strain SCU-103 plasmid pSCU-103-2 34516-34547 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019131 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence 21826-21857 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019099 Salmonella enterica plasmid pNF1358, complete sequence 31885-31916 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_032099 Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence 12655-12686 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_032100 Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence 82-113 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP030025 Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence 31648-31679 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_006856 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence 92606-92637 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016516 Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence 32057-32088 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016520 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence 28008-28039 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025751 Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence 51938-51969 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP048312 Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence 54626-54657 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049178 Shigella sonnei strain 1205.3131 plasmid p1205-3131, complete sequence 73598-73629 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP051282 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence 14383-14414 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP014972 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence 26384-26415 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042247 Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence 114879-114910 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032495 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence 51896-51927 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP012936 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence 32057-32088 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 67895-67926 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019061 Escherichia coli plasmid pPWD4_103, complete sequence 30103-30134 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019097 Escherichia coli plasmid Plm, complete sequence 26529-26560 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023365 Escherichia coli strain 144 plasmid p92, complete sequence 25582-25613 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023370 Escherichia coli strain 1428 plasmid p96, complete sequence 9188-9219 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023385 Escherichia coli strain 1223 plasmid p87, complete sequence 22532-22563 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 100976-101007 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP012923 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence 32057-32088 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_011419 Escherichia coli SE11 plasmid pSE11-1, complete sequence 38042-38073 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023957 Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence 4227-4258 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP012929 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence 31061-31092 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP040542 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence 33049-33080 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_002122 Shigella sonnei plasmid P9 DNA, complete sequence 27982-28013 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP039475 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence 86421-86452 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023382 Escherichia coli strain 127 plasmid p95, complete sequence 27175-27206 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 9968-9999 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419430 Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence 67732-67763 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419431 Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence 77151-77182 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419432 Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence 34870-34901 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419433 Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence 96218-96249 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419434 Escherichia coli strain 2016-40-21249 plasmid p21249, complete sequence 96778-96809 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419435 Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence 70654-70685 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419436 Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence 69637-69668 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419437 Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence 66442-66473 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN419438 Escherichia coli strain 2016-40-24003 plasmid p24003, complete sequence 73814-73845 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025279 Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence 24417-24448 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 180051-180082 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053560 Escherichia coli strain EC1 plasmid pEC1, complete sequence 40781-40812 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053677 Escherichia coli strain EC38 plasmid pEC38, complete sequence 40555-40586 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_011081 Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 plasmid pSL476_91, complete sequence 27983-28014 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019207 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence 38286-38317 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP021882 Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence 20230-20261 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023362 Escherichia coli strain 1943 plasmid p85, complete sequence 16539-16570 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP023356 Escherichia coli strain 746 plasmid p95, complete sequence 29679-29710 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP039604 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence 19419-19450 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041679 Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence 24389-24420 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_KT868530 Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence 18161-18192 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP043035 Escherichia coli strain XDL plasmid pXDL-2, complete sequence 18913-18944 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025709 Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized 31858-31889 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP044960 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence 69498-69529 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015916 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence 92609-92640 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049876 Salmonella enterica subsp. enterica serovar Adjame strain 388789 plasmid unnamed, complete sequence 42735-42766 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LC480203 Escherichia coli B64 plasmid pB64 DNA, complete sequence 44702-44733 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024253 Escherichia coli O182:H21 strain D181 plasmid unnamed4 13525-13556 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP043947 Escherichia coli strain AR202.2 plasmid pMPTEM-30, complete sequence 102563-102594 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019173 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence 78524-78555 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029837 Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093A, complete sequence 92156-92187 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP024292 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence 27768-27799 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP033633 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence 105973-106004 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP047610 Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_1, complete sequence 18825-18856 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_019111 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence 66300-66331 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016522 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence 32063-32094 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029742 Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence 136134-136165 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN335638 Escherichia coli strain SFE199 plasmid pSFE199, complete sequence 38971-39002 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN335638 Escherichia coli strain SFE199 plasmid pSFE199, complete sequence 48683-48714 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN335639 Escherichia coli strain SFE059 plasmid pSFE059, complete sequence 42198-42229 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027135 Escherichia coli strain AR_0369 plasmid unnamed3 55695-55726 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP026778 Shigella dysenteriae strain 69-3818 plasmid unnamed1 111247-111278 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 18681-18712 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP029975 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence 44862-44893 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 LC485173 Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence 19144-19175 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP015838 Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence 31866-31897 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_016904 Escherichia coli KO11FL plasmid pEKO1101, complete sequence 19527-19558 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_017665 Escherichia coli W plasmid pRK1, complete sequence 95896-95927 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049611 Escherichia coli strain 06-3538 plasmid p06-3538-2 75543-75574 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP049613 Escherichia coli O157:H7 strain K1516 plasmid pK1516-1 49384-49415 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP025339 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence 70621-70652 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP016865 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence 31603-31634 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053678 Escherichia coli strain EC28 plasmid pEC28, complete sequence 43307-43338 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP018104 Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence 142536-142567 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP032888 Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence 43554-43585 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP043228 Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence 19415-19446 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_024955 Escherichia coli strain AHC4 plasmid pHNAH4-1, complete sequence 44724-44755 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP019220 Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence 4486-4517 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP043943 Escherichia coli strain AR216.2b plasmid pMPTEM-30, complete sequence 46437-46468 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP027415 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence 52471-52502 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP033883 Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence 74628-74659 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_023915 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome 32245-32276 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH884650 Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence 46294-46325 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 46294-46325 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP042936 Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence 15702-15733 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NC_021155 Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence 8515-8546 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP052260 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence 32335-32366 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 CP054413 Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence 21363-21394 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985248 Escherichia coli strain 720 plasmid RCS48_pI, complete sequence 14685-14716 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP036203 Escherichia coli strain L725 plasmid punnamed1, complete sequence 87561-87592 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP026941 Escherichia coli strain CFS3313 plasmid pCFS3313-2, complete sequence 44056-44087 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041441 Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence 55674-55705 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985270 Escherichia coli strain 716 plasmid RCS56_p, complete sequence 31226-31257 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985273 Escherichia coli strain 03-235 plasmid RCS72_pI, complete sequence 41190-41221 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985280 Escherichia coli strain 13947 plasmid RCS75_pI, complete sequence 40023-40054 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985286 Escherichia coli strain 13948 plasmid RCS76_pI, complete sequence 41188-41219 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985288 Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence 20121-20152 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985281 Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence 24804-24835 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985256 Escherichia coli strain 580 plasmid RCS49_p, complete sequence 14853-14884 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985268 Escherichia coli strain 699 plasmid RCS58_p, complete sequence 53385-53416 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985278 Escherichia coli strain 499 plasmid RCS68_p, complete sequence 5070-5101 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_LT985235 Escherichia coli strain 654 plasmid RCS34_p, complete sequence 41190-41221 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP031656 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence 16567-16598 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MH674341 Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence 39167-39198 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MK758104 Escherichia coli strain 0126:B16 plasmid R16, complete sequence 40952-40983 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MN540570 Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence 79282-79313 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MN241905 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence 67818-67849 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 114219-114250 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 136130-136161 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP045951 Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_02, complete sequence 26155-26186 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 48586-48617 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 MN124285 Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence 46035-46066 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_CP053081 Escherichia coli strain HB37 plasmid pHB37-1, complete sequence 38668-38699 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MH847038 Escherichia coli strain 04-021 plasmid p04-021, complete sequence 54799-54830 1 0.969
NZ_LR740758_2 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886939-886970 32 NZ_MG948334 Escherichia coli strain 2305 plasmid p2305, complete sequence 42587-42618 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 110749-110780 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 157711-157742 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP015086 Escherichia coli O25b:H4 plasmid unnamed, complete sequence 53997-54028 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP030765 Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence 80702-80733 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU987452 Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence 24678-24709 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 185651-185682 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY288024 Klebsiella pneumoniae strain ST709 plasmid pCC1410-2, complete sequence 80273-80304 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 1580-1611 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 96621-96652 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP018456 Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence 130565-130596 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP018457 Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence 57319-57350 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 AP018458 Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence 88799-88830 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NC_022651 Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence 15112-15143 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP023854 Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence 10769-10800 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KT988018 Escherichia coli strain V282 plasmid pEcoV282, complete sequence 58630-58661 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_KU355873 Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence 57559-57590 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP051656 Escherichia coli strain RM11911 plasmid pRM11911 118304-118335 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015086 Escherichia coli O25b:H4 plasmid unnamed, complete sequence 30933-30964 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP030765 Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence 1317-1348 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025882 Escherichia coli strain 503440 plasmid p503440_52, complete sequence 14845-14876 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025895 Escherichia coli strain 503025 plasmid p503025_52, complete sequence 43336-43367 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025867 Escherichia coli strain 504211 plasmid p504211_50, complete sequence 4312-4343 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KX683283 Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence 52890-52921 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP026494 Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence 5913-5944 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP023854 Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence 114477-114508 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MF679146 Escherichia coli plasmid pBJ114-141, complete sequence 76257-76288 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MF679147 Escherichia coli plasmid pBJ114T-190, complete sequence 124576-124607 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP051632 Escherichia coli O121 strain FDA858783-1-52 plasmid pFNW19M81, complete sequence 51166-51197 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KU664810 Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence 127299-127330 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KY007017 Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence 120601-120632 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 160524-160555 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025981 Escherichia marmotae strain HT073016 plasmid pEM76, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP048377 Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015077 Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence 64977-65008 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025861 Escherichia coli strain 504239 plasmid p504239_155, complete sequence 35212-35243 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025861 Escherichia coli strain 504239 plasmid p504239_155, complete sequence 151367-151398 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 KR827684 Escherichia coli plasmid pCERC3, complete sequence 129298-129329 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP045864 Escherichia coli O157:H7 strain ATCC 43890 plasmid p1CFSAN076619, complete sequence 38859-38890 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KP119165 Escherichia coli strain QT598 plasmid pEC598, complete sequence 2801-2832 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KP398867 Escherichia coli strain DB04277 plasmid pDB4277, complete sequence 62513-62544 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_KP789020 Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence 115931-115962 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018626 Escherichia coli strain FORC_044 plasmid pFORC44_2, complete sequence 21402-21433 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP043016 Escherichia coli strain 388808_gen plasmid unnamed1, complete sequence 4444-4475 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP043023 Escherichia coli strain 399730_gen plasmid unnamed1, complete sequence 67057-67088 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP043012 Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence 33723-33754 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010147 Escherichia coli strain D5 plasmid B, complete genome 21987-22018 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010187 Escherichia coli strain M6 plasmid A, complete genome 126542-126573 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032806 Escherichia coli strain ERL05-0623 plasmid pERL05-0623-1, complete sequence 46410-46441 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 81370-81401 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010232 Escherichia coli strain S30 plasmid A, complete sequence 94946-94977 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP017611 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042337 Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015816 Escherichia coli O157:H7 strain JEONG-1266 plasmid p0157, complete sequence 85453-85484 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028608 Escherichia coli strain 143 plasmid pTA143, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP040398 Escherichia coli strain BA22372 plasmid pCTX-M-15_22372, complete sequence 53905-53936 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_011752 Escherichia coli 55989 plasmid 55989p, complete sequence 228-259 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041624 Escherichia coli O157:H7 strain ATCC 43888 plasmid pO157_like, complete sequence 26203-26234 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010158 Escherichia coli strain D10 plasmid A, complete genome 72558-72589 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP043952 Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence 59485-59516 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032798 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-1, complete sequence 46417-46448 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028113 Escherichia coli O103 str. RM8385 plasmid pRM8385-1, complete sequence 35103-35134 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010141 Escherichia coli strain D3 plasmid A, complete sequence 93448-93479 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025871 Escherichia coli strain 503829 plasmid p503829_52, complete sequence 15128-15159 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP025905 Escherichia coli strain 300709 plasmid p300709_60, complete sequence 1937-1968 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP034401 Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence 59275-59306 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 61179-61210 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 71883-71914 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP054336 Escherichia coli strain SCU-120 plasmid pSCU-120-1, complete sequence 491-522 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028651 Escherichia coli strain 124 plasmid pTA124, complete sequence 46418-46449 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028653 Escherichia coli strain 123 plasmid pTA123, complete sequence 46414-46445 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028679 Escherichia coli strain 114 plasmid pTA114, complete sequence 46415-46446 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028701 Escherichia coli strain 105 plasmid pTA105, complete sequence 46412-46443 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010207 Escherichia coli strain M11 plasmid A, complete sequence 72803-72834 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028587 Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042600 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence 114-145 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041032 Escherichia coli strain PT109 plasmid pLB_CTX-M-15_PT109, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP048331 Escherichia coli strain 10 plasmid p010_A, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP034956 Escherichia coli strain SCEC020026 plasmid pCTXM15_020026, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP049349 Escherichia coli strain 3R plasmid p3R-1, complete sequence 61074-61105 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038182 Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031911 Escherichia coli O121:H19 strain FWSEC0006 plasmid unnamed15, complete sequence 23594-23625 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031923 Escherichia coli O26:H11 strain FWSEC0001 plasmid unnamed6, complete sequence 62143-62174 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028634 Escherichia coli strain 135 plasmid pTA135, complete sequence 46419-46450 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028637 Escherichia coli strain 134 plasmid pTA134, complete sequence 46414-46445 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP040573 Escherichia coli O157:H7 strain ECP17-46 plasmid pCFSAN059540, complete sequence 64668-64699 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 112231-112262 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP042952 Escherichia coli strain D8-1 plasmid pD8-1_1, complete sequence 16648-16679 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010305 Escherichia coli O157:H7 str. SS52 plasmid p0157, complete sequence 10326-10357 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032804 Escherichia coli strain ERL05-1306 plasmid pERL05-1306, complete sequence 46842-46873 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021087 Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence 153675-153706 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP048338 Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053732 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028640 Escherichia coli strain 133 plasmid pTA133, complete sequence 46412-46443 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LN850163 Escherichia coli plasmid pI1-34TF, strain I1-34 138488-138519 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010197 Escherichia coli strain M9 plasmid A, complete genome 126543-126574 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032802 Escherichia coli strain ERL06-2442 plasmid pERL06-2442, complete sequence 48868-48899 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP022688 Escherichia coli strain CDC#03-98 plasmid p0157, complete sequence 47184-47215 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 33905-33936 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP020546 Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence 12082-12113 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP043737 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence 131273-131304 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010316 Escherichia coli strain 789 plasmid pAPEC-O78-ColV 39749-39780 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029575 Escherichia coli strain DA33133 plasmid pDA33133-157, complete sequence 29111-29142 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS999561 Escherichia coli isolate EC-TO143 plasmid 2, complete sequence 71029-71060 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS992167 Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence 45663-45694 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LS998786 Escherichia coli isolate EC-TO75 plasmid 2, complete sequence 55708-55739 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 107847-107878 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053722 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncFIB, complete sequence 44465-44496 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 117003-117034 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028595 Escherichia coli strain 150 plasmid pTA150, complete sequence 48851-48882 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028616 Escherichia coli strain 141 plasmid pTA141, complete sequence 46408-46439 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_010488 Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence 69140-69171 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_013010 Escherichia coli O157:H7 str. TW14359 plasmid pO157, complete sequence 26408-26439 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032796 Escherichia coli strain ERL06-2503 plasmid pERL06-2503, complete sequence 48851-48882 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019282 Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence 85383-85414 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012626 Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence 18712-18743 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP034739 Escherichia coli strain L65 plasmid pL65-2, complete sequence 19537-19568 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MT077881 Escherichia coli plasmid p2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MT077882 Escherichia coli plasmid p4, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN007143 Escherichia coli strain 100 plasmid p100_NDM5, complete sequence 58820-58851 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_LR130556 Escherichia coli strain MS14385 isolate MS14385 plasmid 2 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP054369 Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP054364 Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 6420-6451 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP010372 Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence 138338-138369 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032790 Escherichia coli strain NZRM4169 plasmid pNZRM4169, complete sequence 48845-48876 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024244 Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence 98395-98426 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019251 Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence 97621-97652 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP021728 Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence 106386-106417 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP020519 Escherichia coli strain 222 plasmid unnamed1, complete sequence 32721-32752 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP005931 Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence 82354-82385 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP035367 Escherichia coli O157:H7 strain C1-057 plasmid pC1-057, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP049082 Escherichia coli strain p10A plasmid p10A_p1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP049079 Escherichia coli strain p11A plasmid p11A_p2, complete sequence 171958-171989 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MT077880 Escherichia coli plasmid p1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN158990 Escherichia coli strain TREC4 plasmid pTREC4, complete sequence 72600-72631 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN158992 Escherichia coli strain TREC9 plasmid pTREC9, complete sequence 63265-63296 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CP051693 Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence 58060-58091 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP015847 Escherichia coli O157:H7 strain FRIK2069 plasmid p0157, complete sequence 6526-6557 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027220 Escherichia coli strain 2015C-3163 plasmid unnamed, complete sequence 1985-2016 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP026854 Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence 119245-119276 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019247 Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence 82936-82967 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019268 Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence 88854-88885 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029243 Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence 85842-85873 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 150563-150594 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP020496 Escherichia coli strain 103 plasmid unnamed1, complete sequence 51307-51338 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_019000 Escherichia coli plasmid pHUSEC41-2, complete sequence 228-259 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024718 Escherichia coli strain LS4 plasmid p1LS4, complete sequence 18203-18234 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027578 Escherichia coli strain 2013C-4225 plasmid unnamed 70907-70938 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP029748 Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence 242835-242866 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP009053 Escherichia coli NCCP15648 plasmid p15648-3, complete sequence 228-259 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP037942 Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence 28038-28069 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038410 Escherichia coli O157:H7 strain 86-24 plasmid p86-24-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038422 Escherichia coli O157:H7 strain 7636 plasmid p7636-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_009602 Escherichia coli plasmid pSFO157, complete sequence 18946-18977 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NC_009602 Escherichia coli plasmid pSFO157, complete sequence 60480-60511 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044146 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence 87440-87471 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 CM019851 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence 62108-62139 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024721 Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence 106797-106828 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027350 Escherichia coli strain 2014C-3655 plasmid unnamed 1508-1539 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027350 Escherichia coli strain 2014C-3655 plasmid unnamed 82195-82226 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041427 Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence 28207-28238 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 28518-28549 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027130 Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence 164070-164101 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP049355 Escherichia coli strain T28R plasmid pT28R-2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP035753 Escherichia coli E110019 plasmid pE110019_65, complete sequence 50628-50659 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP047380 Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038356 Escherichia coli O157:H7 str. F8092B plasmid pF8092B-1, complete sequence 31125-31156 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038371 Escherichia coli O157:H7 strain F6321 plasmid pF6321-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038404 Escherichia coli O157:H7 strain BB24-1 plasmid pBB24-1, complete sequence 26224-26255 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038406 Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence 46414-46445 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038418 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038420 Escherichia coli O157:H7 strain 2-6-2 plasmid pEX262-1, complete sequence 26224-26255 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038429 Escherichia coli O157:H7 strain 611 plasmid p611-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038335 Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038348 Escherichia coli O157:H7 strain G5295 plasmid pG5295-1, complete sequence 48801-48832 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038359 Escherichia coli O157:H7 strain F7508 plasmid pF7508-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038373 Escherichia coli O157:H7 strain F6294 plasmid pF6294-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038375 Escherichia coli O157:H7 strain F3113 plasmid pF3113-1, complete sequence 64888-64919 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038382 Escherichia coli O157:H7 strain E32511 plasmid pE32511-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP033091 Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 LT906556 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I 155046-155077 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP040922 Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence 104503-104534 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044139 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-3, complete sequence 20383-20414 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044144 Escherichia coli O157 strain AR-0429 plasmid pAR-0429-2, complete sequence 4845-4876 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024055 Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence 47426-47457 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP024617 Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence 66445-66476 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032263 Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence 140551-140582 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP032877 Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence 132824-132855 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 MN158991 Escherichia coli strain TREC8 plasmid pTREC8, complete sequence 53030-53061 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP037944 Escherichia coli strain CFSAN027343 plasmid pCFSAN027343, complete sequence 71775-71806 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP053236 Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP012803 Escherichia coli O157:H7 strain WS4202 isolate laboratory strain plasmid pO157-WS4202, complete sequence 26234-26265 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP028606 Escherichia coli strain 144 plasmid pTA144, complete sequence 48871-48902 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP013832 Escherichia coli strain CD306 plasmid pCD306, complete sequence 45915-45946 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP044347 Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence 133925-133956 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027357 Escherichia coli strain 2013C-4991 plasmid unnamed2 62312-62343 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 77574-77605 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027547 Escherichia coli strain 2013C-4187 plasmid unnamed, complete sequence 33938-33969 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP027119 Escherichia coli strain 26561 plasmid unnamed1, complete sequence 1903-1934 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041421 Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence 40051-40082 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP049937 Escherichia coli strain JL05 plasmid pARG01, complete sequence 97004-97035 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038332 Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038345 Escherichia coli O157:H7 strain Gim1-1 plasmid pGM11-1, complete sequence 26224-26255 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038293 Escherichia coli O157:H7 strain TB21-1 plasmid pTB21-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038308 Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038312 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038327 Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-1, complete sequence 46413-46444 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038343 Escherichia coli O157:H7 strain H2495 plasmid pH2495-1, complete sequence 46424-46455 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038354 Escherichia coli O157:H7 strain F8797 plasmid pF8797-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038368 Escherichia coli O157:H7 strain F6667 plasmid pF6667-1, complete sequence 26224-26255 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038379 Escherichia coli O157:H7 strain F1273 plasmid pF1273-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038401 Escherichia coli O157:H7 strain DEC4E plasmid pDEC4E-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038415 Escherichia coli O157:H7 strain 17B6-2 plasmid p17B6-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038426 Escherichia coli O157:H7 strain 2571 plasmid p2571-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038286 Escherichia coli O157:H7 strain YB14-1 plasmid pYB14-1, complete sequence 53707-53738 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038314 Escherichia coli O157:H7 strain OK1 plasmid pOK1-1, complete sequence 68165-68196 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018240 Escherichia coli strain 272 plasmid pO157, complete sequence 26226-26257 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 114-145 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP040306 Escherichia coli strain HB6 plasmid pO157, complete sequence 48829-48860 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP040310 Escherichia coli strain 21B8 plasmid pO157, complete sequence 46383-46414 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP019007 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence 110892-110923 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP011916 Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence 41264-41295 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP041436 Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence 70441-70472 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP018994 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence 101402-101433 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP037912 Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence 24289-24320 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038291 Escherichia coli O157:H7 strain TX 265-1 plasmid pTX265-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038304 Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-1, complete sequence 26224-26255 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038320 Escherichia coli O157:H7 strain NE122 plasmid pNE122-1, complete sequence 28675-28706 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038323 Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-1, complete sequence 63-94 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038338 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence 24970-25001 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038338 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence 105089-105120 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038341 Escherichia coli O157:H7 strain H6437 plasmid pH6437-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038350 Escherichia coli O157:H7 strain F8952 plasmid pF8952-1, complete sequence 46410-46441 1 0.969
NZ_LR740758_3 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896328-896359 32 NZ_CP038352 Escherichia coli O157:H7 strain F8798 plasmid pF8798-1, complete sequence 26225-26256 1 0.969
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_MG764548 Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence 159080-159111 2 0.938
NZ_LR740758_4 4.1|1530350|38|NZ_LR740758|CRISPRCasFinder 1530350-1530387 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP037905 Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence 97908-97939 3 0.906
NZ_LR740758_2 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT 886999-887030 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 129452-129483 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 63802-63833 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 JQ011316 Escherichia phage TL-2011a, partial genome 3859-3890 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_019709 Enterobacteria phage mEpX1, complete genome 24114-24145 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP044141 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4 26829-26860 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 85378-85409 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012531 Stx2-converting phage Stx2a_F422 proviral DNA, complete genome 61481-61512 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_011802 Salmonella enterica bacteriophage SE1, complete genome 6218-6249 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682385 Escherichia phage PA33, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP051272 Salmonella phage SW-70, complete genome 2149-2180 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP051278 Salmonella phage ST-87, complete genome 17141-17172 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP051288 Salmonella phage ST-29, complete genome 29938-29969 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682382 Escherichia phage PA29, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_016160 Escherichia phage HK75, complete genome 22619-22650 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682389 Escherichia phage PA45, complete genome 63600-63631 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682383 Escherichia phage PA30, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP051285 Salmonella phage ST-32, complete genome 23077-23108 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_004914 Stx2 converting phage II DNA, complete genome 30154-30185 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682375 Escherichia phage PA11, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682387 Escherichia phage PA42, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KJ909655 Escherichia Stx1-converting recombinant phage HUN/2013, complete genome 21490-21521 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU238068 Stx converting phage vB_EcoS_P32, complete genome 60770-60801 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682384 Escherichia phage PA32, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682386 Escherichia phage PA36, complete genome 62287-62318 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682376 Escherichia phage PA12, complete genome 59654-59685 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP000422 Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7 61523-61554 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682391 Escherichia phage PA51, complete genome 59654-59685 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682388 Escherichia phage PA44, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682372 Escherichia phage PA4, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682377 Escherichia phage PA16, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_000902 Enterobacteria phage VT2-Sakai, complete genome 59209-59240 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP000363 Enterobacteria phage VT2-Sakai proviral DNA, complete genome 59209-59240 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682380 Escherichia phage PA27, complete genome 62287-62318 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP005153 Stx1 converting phage DNA, complete genome 30154-30185 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682379 Escherichia phage PA21, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_014900 Salmonella phage ST160, complete genome 6236-6267 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682373 Escherichia phage PA5, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682378 Escherichia phage PA18, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU238069 Stx converting phage vB_EcoS_P22, complete genome 60566-60597 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP051279 Salmonella phage ST-35, complete genome 20927-20958 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682390 Escherichia phage PA50, complete genome 60974-61005 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682392 Escherichia phage PA52, complete genome 63600-63631 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_005344 Enterobacteria phage Sf6, complete genome 19844-19875 4 0.875
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP044141 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4 20251-20282 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012531 Stx2-converting phage Stx2a_F422 proviral DNA, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682385 Escherichia phage PA33, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682382 Escherichia phage PA29, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682389 Escherichia phage PA45, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682383 Escherichia phage PA30, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_004914 Stx2 converting phage II DNA, complete genome 36733-36764 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682375 Escherichia phage PA11, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682387 Escherichia phage PA42, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KJ909655 Escherichia Stx1-converting recombinant phage HUN/2013, complete genome 28069-28100 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU238068 Stx converting phage vB_EcoS_P32, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682384 Escherichia phage PA32, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682386 Escherichia phage PA36, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682376 Escherichia phage PA12, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP000422 Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7 5399-5430 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682391 Escherichia phage PA51, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682388 Escherichia phage PA44, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682372 Escherichia phage PA4, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682377 Escherichia phage PA16, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_000902 Enterobacteria phage VT2-Sakai, complete genome 4844-4875 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP000363 Enterobacteria phage VT2-Sakai proviral DNA, complete genome 4844-4875 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682380 Escherichia phage PA27, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP005153 Stx1 converting phage DNA, complete genome 36733-36764 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682379 Escherichia phage PA21, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682373 Escherichia phage PA5, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682378 Escherichia phage PA18, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU238069 Stx converting phage vB_EcoS_P22, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682390 Escherichia phage PA50, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682392 Escherichia phage PA52, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 86864-86895 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_KY565557 Escherichia coli strain Mcp0221 plasmid pMcp0221, complete sequence 40594-40625 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_KP792123 Escherichia coli strain MG1655 YFP plasmid ESBL242, complete sequence 99568-99599 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_011917 Escherichia coli LF82 plasmid plLF82, complete sequence 83615-83646 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 LT906557 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II 63337-63368 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MK125034 Escherichia coli O25b:H4-ST131 plasmid p7.2.1, complete sequence 87402-87433 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MK125035 Escherichia coli O25b:H4-ST131 plasmid pB20 clone ST131-Rx_O25b:fimH30, complete sequence 87400-87431 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP027358 Escherichia coli strain 2013C-4991 plasmid unnamed3, complete sequence 27828-27859 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 68793-68824 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP027369 Escherichia coli strain 2014C-3307 plasmid unnamed1, complete sequence 55765-55796 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_023916 Escherichia coli H89 plasmid pECOH89, complete sequence 87400-87431 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 47289-47320 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 35762-35793 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_MG825385 Escherichia coli strain 1107 plasmid p1107-111K, complete sequence 83951-83982 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_KY792081 Escherichia coli strain EC-MCR1.8 plasmid unnamed, complete sequence 12627-12658 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NZ_KY853650 Escherichia coli strain 347-43491A plasmid p977565, complete sequence 44291-44322 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG792102 Escherichia phage P13803, complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 LC487997 Stx2-converting phage Stx2a F578 genes for Shiga toxin 2 production region, complete sequence 4835-4866 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_004813 Enterobacteria phage BP-4795, complete genome 3645-3676 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012539 Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome 6167-6198 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG803184 Escherichia phage P13353 complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU298437 Escherichia phage phiON-2011, complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG803185 Escherichia phage P13357 complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HE664024 Escherichia phage P13374 complete proviral genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG792104 Escherichia phage P13771, complete genome 7022-7053 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_000924 Enterobacteria phage 933W, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_000924 Enterobacteria phage 933W, complete genome 60169-60200 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049924 Stx2-converting phage Stx2a_F451 proviral DNA, complete genome 8004-8035 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG792105 Escherichia phage P14437, complete genome 6995-7026 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG792103 Escherichia phage P8983, complete genome 6873-6904 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KP682381 Escherichia phage PA28, complete genome 7283-7314 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KM389362 UNVERIFIED: Escherichia phage Phi05_1387 B clone contig00003 genomic sequence 497-528 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MG986485 Escherichia phage SH2026Stx1, complete genome 3233-3264 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_019714 Enterobacteria phage HK446, complete genome 22480-22511 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AF125520 Bacteriophage 933W, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AF125520 Bacteriophage 933W, complete genome 60169-60200 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 FM180578 Enterobacteria phage 2851, complete genome 4316-4347 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU238070 Stx converting phage vB_EcoS_ST2-8624, complete genome 4863-4894 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MH370387 Salmonella phage S149, complete genome 5880-5911 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012533 Stx2-converting phage Stx2a_F723 proviral DNA, complete genome 7265-7296 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MG407615 Salmonella phage Bp96115, partial genome 37189-37220 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 FJ188381 Stx2-converting phage 1717, complete genome 4977-5008 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MT225101 Escherichia phage Lys19259Vzw, complete genome 7376-7407 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 LC487996 Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence 7316-7347 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU977419 Stx1 converting phage AU5Stx1, complete genome 7259-7290 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AF069529 Bacteriophage HK97, complete genome 22744-22775 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_002167 Enterobacteria phage HK97, complete genome 22744-22775 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP004402 Stx2 converting phage I DNA, complete genome 30254-30285 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP004402 Stx2 converting phage I DNA, complete genome 36593-36624 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_008464 Stx2-converting phage 86, complete genome 43779-43810 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_011356 Enterobacteria phage YYZ-2008, complete prophage genome 4500-4531 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_002730 Enterobacteria phage HK620, complete genome 3479-3510 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MT833387 Escherichia phage HF4s, complete genome 22975-23006 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 JQ086374 Enterobacteria phage HK544, complete genome 22853-22884 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049944 Stx2-converting phage Stx2a_WGPS8 proviral DNA, complete genome 4325-4356 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HM208303 Stx2 converting phage vB_EcoP_24B, complete genome 3704-3735 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012536 Stx2-converting phage Stx2a_1447 proviral DNA, complete genome 2880-2911 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 FJ184280 Enterobacteria phage YYZ-2008, complete genome 4500-4531 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG803182 Escherichia phage P13363 complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MH717096 Escherichia phage N7, complete genome 22605-22636 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_028660 Escherichia phage phi191, complete genome 27405-27436 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_019769 Enterobacteria phage HK542, complete genome 22066-22097 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 GQ422451 Enterobacteria phage Phi75, partial genome 6810-6841 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049923 Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome 54730-54761 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KY979108 Escherichia phage ECP1, complete genome 34593-34624 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU977420 Stx1 converting phage AU6Stx1, complete genome 3233-3264 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012538 Stx2-converting phage Stx2a_WGPS4 proviral DNA, complete genome 4321-4352 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 GQ422450 Enterobacteria phage UAB_Phi20, complete genome 34969-35000 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 CP053388 Escherichia phage CMS-2020a, complete sequence 83329-83360 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 HG803183 Escherichia phage P13368 complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AB255436 Stx2-converting phage 86 DNA, complete genome 43779-43810 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_005841 Enterobacteria phage ST104 DNA, complete genome 5880-5911 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AF335538 Bacteriophage HK620, complete genome 3479-3510 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049925 Stx converting phage vB_EcoS_P27, complete genome 4633-4664 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_011357 Stx2-converting phage 1717, complete prophage genome 4977-5008 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_018846 Escherichia phage P13374, complete genome 6471-6502 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049941 Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome 2880-2911 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AJ556162 Phage BP-4795 complete genome 3645-3676 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_019719 Enterobacteria phage HK633, complete genome 24285-24316 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_010237 Enterobacteria phage Min27, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_010237 Enterobacteria phage Min27, complete genome 61870-61901 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_028685 Shigella phage Ss-VASD, complete genome 7746-7777 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012530 Stx2-converting phage Stx2a_F349 proviral DNA, complete genome 4321-4352 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049942 Escherichia phage JLK-2012, complete sequence 4452-4483 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AJ304858 Bacteriophage CP-1639 and chromosomal integration site 10019-10050 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012529 Stx2-converting phage Stx2a_F403 proviral DNA, complete genome 4845-4876 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP012529 Stx2-converting phage Stx2a_F403 proviral DNA, complete genome 61868-61899 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 NC_049917 Escherichia phage Lys12581Vzw, complete genome 37315-37346 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 AP000400 Enterobacteria phage VT1-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7 51657-51688 5 0.844
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 KU052037 Escherichia phage Rac-SA53, complete genome 13367-13398 6 0.812
NZ_LR740758_2 2.4|886759|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886759-886790 32 NZ_CP021332 Maritalea myrionectae strain HL2708#5 plasmid pHL2708Y3, complete sequence 44692-44723 7 0.781
NZ_LR740758_2 2.6|886879|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886879-886910 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 8740-8771 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1012677-1012708 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1168655-1168686 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 800193-800224 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 591865-591896 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1388266-1388297 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 455964-455995 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 800041-800072 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 800019-800050 7 0.781
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1373834-1373865 7 0.781
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 66317-66348 7 0.781
NZ_LR740758_3 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896388-896419 32 JF974339 Enterobacteria phage IME10, complete genome 1738-1769 7 0.781
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102532-102590 8 0.864
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NC_047804 Ralstonia phage RS-PII-1, complete genome 29825-29856 8 0.75
NZ_LR740758_3 3.6|896448|32|NZ_LR740758|CRISPRCasFinder,CRT 896448-896479 32 NZ_AP017915 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1 2921-2952 8 0.75
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31294-31347 8 0.852
NZ_LR740758_2 2.2|886639|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886639-886670 32 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 122085-122116 9 0.719
NZ_LR740758_3 3.6|896448|32|NZ_LR740758|CRISPRCasFinder,CRT 896448-896479 32 NZ_LN908215 Clostridium beijerinckii isolate C. beijerinckii DSM 6423 plasmid III 14910-14941 9 0.719
NZ_LR740758_5 5.2|4369207|56|NZ_LR740758|PILER-CR 4369207-4369262 56 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14043 9 0.839
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58261-58314 9 0.833
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 106198-106229 10 0.688
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 137973-138026 10 0.815
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12154-12207 10 0.815
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12113-12164 10 0.808
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 272-323 10 0.808
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31252-31303 10 0.808
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194098-194156 11 0.814
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204592-204650 11 0.814
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195426-195484 11 0.814
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176381-176439 11 0.814
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 114002-114033 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 110923-110954 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 185071-185102 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 104520-104551 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 64126-64157 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 91315-91346 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 156505-156536 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 91315-91346 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 169599-169630 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 89880-89911 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 207228-207259 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 189862-189893 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 91316-91347 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 201352-201383 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 107433-107464 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 18752-18783 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 60556-60587 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 161006-161037 11 0.656
NZ_LR740758_2 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 886579-886610 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 178268-178299 11 0.656
NZ_LR740758_3 3.1|896147|33|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896147-896179 33 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 2283-2315 11 0.667
NZ_LR740758_3 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT 896268-896299 32 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 5772-5803 11 0.656
NZ_LR740758_5 5.2|4369207|56|NZ_LR740758|PILER-CR 4369207-4369262 56 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87116-87171 11 0.804
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110239 11 0.796
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63884-63937 11 0.796
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4115-4166 11 0.788
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4114-4165 11 0.788
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4114-4165 11 0.788
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4114-4165 11 0.788
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 152-203 11 0.788
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208982-209033 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 44-95 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219476-219527 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 43-94 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18332-18383 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210310-210361 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 43-94 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191265-191316 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 43-94 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7393-7444 12 0.769
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84217-84268 12 0.769
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8883-8936 13 0.759
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3373-3424 13 0.75
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3372-3423 13 0.75
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15000-15051 13 0.75
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3372-3423 13 0.75
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3372-3423 13 0.75
NZ_LR740758_1 1.1|707567|59|NZ_LR740758|CRISPRCasFinder 707567-707625 59 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 82-140 14 0.763
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 89-142 14 0.741
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NC_049343 Escherichia phage 500465-2, complete genome 31797-31850 14 0.741
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 70-121 14 0.731
NZ_LR740758_7 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder 4925084-4925135 52 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30159-30210 14 0.731
NZ_LR740758_5 5.1|4369108|63|NZ_LR740758|PILER-CR 4369108-4369170 63 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87115-87177 15 0.762
NZ_LR740758_6 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder 4696245-4696298 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397141 15 0.722

1. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

2. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

3. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

4. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

5. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

6. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX246268 (Escherichia coli strain RD174 plasmid pHNRD174, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

7. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

8. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

9. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU355874 (Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

10. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

11. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP022456 (Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

12. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025455 (Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76334 plasmid pSAG-76334, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

13. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

14. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP987217 (Klebsiella pneumoniae strain 628 plasmid p628-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

15. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

16. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM409652 (Escherichia coli strain REL5382 plasmid pB15, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

17. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

18. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ866866 (Escherichia coli strain SKLX3330 plasmid pSKLX3330, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

19. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_020991 (Shigella sonnei 10188 plasmid pKHSB1 complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

20. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

21. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

22. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP035009 (Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

23. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028485 (Escherichia coli strain E41-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

24. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010142 (Escherichia coli strain D3 plasmid B, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

25. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014494 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

26. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

27. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

28. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

29. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

30. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

31. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024226 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

32. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

33. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

34. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

35. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

36. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

37. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053733 (Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

38. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045523 (Shigella flexneri strain 5908.2 plasmid p5908-2) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

39. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

40. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

41. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

42. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

43. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

44. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039714 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

45. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

46. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

47. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT838199 (Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

48. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_EU418931 (Escherichia coli strain JIE174 plasmid pJIE174, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

49. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_EU418923 (Escherichia coli strain JIE113 plasmid pJIE113, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

50. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013120 (Escherichia coli plasmid pEK204, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

51. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019253 (Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

52. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

53. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032524 (Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

54. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

55. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LT985289 (Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

56. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

57. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

58. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

59. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024887 (Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

60. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018659 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

61. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH579767 (Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

62. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

63. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

64. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038417 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

65. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP045527 (Shigella sonnei strain 6607.69 plasmid p6607-69, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

66. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

67. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

68. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

69. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

70. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018993 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

71. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_024977 (Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

72. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP031286 (Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

73. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985295 (Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

74. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

75. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019044 (Escherichia coli plasmid pND12_96, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

76. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

77. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021693 (Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

78. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050747 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

79. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052382 (Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

80. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

81. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN735558 (Escherichia coli plasmid pC193, complete sequence, strain C193) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

82. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN735559 (Escherichia coli plasmid pM105, complete sequence, strain M105) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

83. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN735560 (Escherichia coli plasmid pV408, complete sequence, strain V408) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

84. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN735561 (Escherichia coli plasmid pC271, complete sequence, strain C271) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

85. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021208 (Escherichia coli strain strain Z247 plasmid p2474-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

86. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

87. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040270 (Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

88. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

89. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

90. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040808 (Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

91. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

92. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019954 (Escherichia coli M8 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

93. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP010831 (Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

94. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

95. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024152 (Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

96. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

97. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051745 (Escherichia coli strain SCU-484 plasmid pSCU-484-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

98. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

99. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025147 (Escherichia coli plasmid pV404, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

100. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027324 (Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

101. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

102. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049180 (Shigella sonnei strain L4094 plasmid pL4094, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

103. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_014383 (Escherichia coli plasmid pEC_Bactec, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

104. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ406378 (Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

105. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

106. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042944 (Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35472_2) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

107. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

108. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027341 (Escherichia coli strain 2015C-3121 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

109. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

110. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017642 (Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

111. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

112. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

113. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

114. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024233 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

115. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047578 (Escherichia coli strain 94EC plasmid p94EC-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

116. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049176 (Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

117. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

118. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018946 (Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

119. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018975 (Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

120. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

121. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042886 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

122. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

123. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

124. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

125. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN125610 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.11-3A7 plasmid pIncI1-CTX-M-14, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

126. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

127. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

128. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

129. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

130. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019996 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

131. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

132. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031111 (Escherichia coli strain AMSCJX02 plasmid pAMSC6, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

133. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

134. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

135. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019762 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

136. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023534 (Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

137. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

138. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047572 (Escherichia coli strain 2EC1 plasmid p2EC1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

139. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023144 (Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

140. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

141. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP053331 (Salmonella enterica subsp. salamae serovar 60:z10:z39 strain 2011K-1889 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

142. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

143. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018797 (Escherichia coli strain E2855 plasmid pE2855-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

144. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

145. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029842 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

146. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032880 (Escherichia coli strain SCEC020022 plasmid p1_020022, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

147. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034804 (Escherichia coli strain 2009C-3554 plasmid p2009C-3554-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

148. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022742 (Escherichia coli plasmid pHUSEC2011-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

149. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029903 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

150. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH430881 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

151. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050758 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

152. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027379 (Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

153. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027379 (Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

154. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027673 (Escherichia coli strain 2014C-3003 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

155. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

156. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH884654 (Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

157. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

158. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021739 (Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

159. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019905 (Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

160. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN335919 (Escherichia coli strain SD-2 plasmid pNDM-T2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

161. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN335921 (Escherichia coli strain SD-6 plasmid pNDM-T6, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

162. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK088173 (Salmonella enterica subsp. enterica strain H-185 plasmid R805a, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

163. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN276083 (Escherichia coli strain GZ7DS11 plasmid pHN7DS11,complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

164. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

165. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG825375 (Escherichia coli strain 1106 plasmid p1106-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

166. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG838206 (Escherichia coli strain 92944 plasmid p92944-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

167. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG904995 (Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

168. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG271839 (Escherichia coli strain SDX5C138 plasmid pHNSD138-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

169. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG825371 (Escherichia coli strain 1106 plasmid p1106-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

170. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH257955 (Escherichia coli strain 104 plasmid pHXH-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

171. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH430883 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

172. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG196294 (Escherichia coli strain THSJ02 plasmid pHNTH02-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

173. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK238490 (Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

174. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN702386 (Escherichia coli strain LWY24J plasmid pLWY24J-4, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

175. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

176. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF078004 (Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

177. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

178. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF156268 (Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

179. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF344575 (Escherichia coli strain 140611011 plasmid p11011-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

180. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG601057 (Escherichia coli strain EC1107 plasmid pEC1107-NDM-116K, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

181. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG545910 (Escherichia coli strain EC014 plasmid pEC014, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

182. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

183. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037994 (Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

184. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028611 (Escherichia coli strain 142 plasmid pTA142-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

185. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028611 (Escherichia coli strain 142 plasmid pTA142-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgcca	Protospacer
********************************

186. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP031903 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

187. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

188. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KX608544 (Escherichia coli strain FA27 plasmid pFA27_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

189. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY751926 (Klebsiella pneumoniae strain HK02-026 plasmid pHK02-026, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

190. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY751925 (Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

191. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

192. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

193. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LR213453 (Shigella flexneri strain AUSMDU00008355 isolate AUSMDU00008355 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

194. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU355874 (Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

195. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

196. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU288634 (Escherichia coli strain FAM22321 plasmid pFAM22321, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

197. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

198. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

199. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

200. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

201. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KX503323 (Escherichia coli strain HNEC46 plasmid PHNEC46, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

202. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP022456 (Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

203. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

204. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015072 (Escherichia coli strain Ecol_743 plasmid pEC743_3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

205. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

206. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

207. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

208. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT818627 (Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

209. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

210. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

211. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

212. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

213. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

214. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041339 (Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

215. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042338 (Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

216. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP022460 (Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

217. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP035009 (Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

218. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

219. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010138 (Escherichia coli strain D2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

220. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014494 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

221. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

222. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

223. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_022267 (Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

224. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

225. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

226. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

227. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024226 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

228. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014622 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

229. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

230. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

231. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP049350 (Escherichia coli strain 3R plasmid p3R-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

232. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

233. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT754160 (Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

234. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

235. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010174 (Escherichia coli strain H8 plasmid B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

236. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

237. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LS992187 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

238. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP053734 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

239. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP045523 (Shigella flexneri strain 5908.2 plasmid p5908-2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

240. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

241. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

242. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

243. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP020511 (Escherichia coli strain 165 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

244. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

245. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

246. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

247. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029734 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

248. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034964 (Escherichia coli strain WCHEC020032 plasmid pCTXM3_020032, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

249. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LS999562 (Escherichia coli isolate EC-TO143 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

250. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

251. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

252. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

253. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

254. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

255. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

256. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021845 (Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

257. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP047091 (Salmonella sp. S13 plasmid pS13-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

258. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP039714 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

259. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

260. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012627 (Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

261. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT077885 (Escherichia coli plasmid p37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

262. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT077887 (Escherichia coli plasmid p62, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

263. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN007140 (Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

264. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KX023260 (Escherichia coli plasmid pSCE516-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

265. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024475 (Shigella flexneri 7b strain 94-3007 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

266. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LR213457 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 3) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

267. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP044156 (Shigella flexneri strain AR-0424 plasmid pAR-0424-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

268. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_EU418931 (Escherichia coli strain JIE174 plasmid pJIE174, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

269. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_EU418923 (Escherichia coli strain JIE113 plasmid pJIE113, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

270. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP048295 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

271. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_013121 (Escherichia coli plasmid pEK516, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

272. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

273. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019276 (Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

274. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033629 (Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

275. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

276. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP049078 (Escherichia coli strain p11A plasmid p11A_p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

277. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

278. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

279. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

280. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

281. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP028315 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

282. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041621 (Shigella flexneri strain C32 plasmid pC32_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

283. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

284. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to LT985289 (Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

285. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

286. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

287. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

288. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012139 (Shigella flexneri 2a strain 981 plasmid 981p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

289. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014966 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

290. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP022064 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

291. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021841 (Escherichia coli strain EC974 plasmid pEC974-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

292. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

293. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

294. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

295. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

296. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

297. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

298. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

299. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016572 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

300. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041415 (Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

301. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015161 (Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

302. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_018659 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

303. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP035752 (Escherichia coli E110019 plasmid pE110019_66, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

304. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

305. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

306. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP047380 (Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

307. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP038385 (Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

308. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP038347 (Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

309. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP045525 (Shigella sonnei strain 6904.27 plasmid p6904-27) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

310. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

311. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP044183 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

312. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024281 (Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

313. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030329 (Escherichia coli strain AR_452 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

314. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032264 (Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

315. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

316. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

317. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030000 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

318. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

319. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041421 (Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

320. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

321. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016387 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

322. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016389 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pESBL931, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

323. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

324. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

325. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

326. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_024976 (Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

327. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_024977 (Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

328. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

329. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP031286 (Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

330. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015239 (Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

331. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

332. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

333. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985283 (Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

334. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985295 (Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

335. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

336. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP053755 (Shigella sonnei strain 506 plasmid pMHMC-004, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

337. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

338. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040548 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

339. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019044 (Escherichia coli plasmid pND12_96, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

340. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP014876 (Escherichia coli plasmid pV021-b DNA, complete sequence, strain: V021) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

341. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP030839 (Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

342. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

343. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010124 (Escherichia coli strain C5 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

344. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP046261 (Escherichia coli strain ECO2947 plasmid p2947-NDM5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

345. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021693 (Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

346. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027438 (Escherichia coli strain 2012C-4221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

347. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

348. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029110 (Escherichia coli strain AR436 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

349. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034255 (Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

350. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP035314 (Escherichia coli strain D72 plasmid pD72-F33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

351. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KY463221 (Escherichia coli plasmid pCMY-42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

352. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034932 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

353. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

354. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041303 (Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

355. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP039513 (Salmonella enterica subsp. enterica serovar Worthington strain 7102.58 plasmid p7102_58-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

356. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

357. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021533 (Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

358. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021684 (Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

359. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024854 (Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

360. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

361. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

362. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

363. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021210 (Escherichia coli strain strain Z247 plasmid p2474-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

364. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

365. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_025180 (Escherichia coli plasmid pC23-89, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

366. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

367. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019205 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

368. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985236 (Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

369. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985231 (Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

370. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985238 (Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

371. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985320 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

372. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

373. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_AP019677 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

374. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP042897 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

375. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP031615 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

376. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_AP019190 (Escherichia coli strain M217 plasmid pM217_I1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

377. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP033160 (Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

378. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP051690 (Escherichia coli strain SCU-387 plasmid pSCU-387-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

379. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

380. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

381. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040808 (Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

382. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010241 (Escherichia coli strain C7 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

383. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

384. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023376 (Escherichia coli strain 1283 plasmid p92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

385. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024823 (Escherichia coli strain CREC-591 plasmid pCREC-591_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

386. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

387. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

388. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024481 (Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

389. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

390. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP036181 (Escherichia coli strain WCHEC025970 plasmid p2_025970, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

391. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

392. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KU932026 (Escherichia coli plasmid pEC14II_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

393. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KU932027 (Escherichia coli plasmid pEC14II_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

394. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KU932029 (Escherichia coli plasmid pEC15I_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

395. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KU932030 (Escherichia coli plasmid pEC15I_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

396. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MG516908 (Escherichia coli plasmid pEc42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

397. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP017852 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2c, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

398. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP017287 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3c, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

399. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

400. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

401. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019444 (Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

402. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023733 (Escherichia coli strain FORC 064 plasmid pFORC64.2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

403. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

404. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_025147 (Escherichia coli plasmid pV404, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

405. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016533 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

406. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027256 (Escherichia coli strain EC11 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

407. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP009566 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

408. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029119 (Escherichia coli strain AR435 plasmid unnamed6) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

409. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049180 (Shigella sonnei strain L4094 plasmid pL4094, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

410. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_014383 (Escherichia coli plasmid pEC_Bactec, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

411. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019131 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

412. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_032100 (Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

413. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

414. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015388 (Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

415. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KJ201887 (Shigella flexneri 4c strain 072 plasmid pSF07201, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

416. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KX008967 (Shigella sonnei strain 183660 plasmid p183660, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

417. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

418. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030025 (Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

419. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_006856 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

420. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016516 (Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

421. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016520 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

422. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP048312 (Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

423. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

424. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010120 (Escherichia coli strain C3 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

425. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP043759 (Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

426. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032810 (Escherichia coli strain ERL04-3476 plasmid pERL04-3476-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

427. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP022166 (Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

428. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

429. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

430. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_017642 (Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

431. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_017640 (Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

432. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

433. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

434. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP051282 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

435. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP009167 (Escherichia coli 1303 plasmid p1303_109, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

436. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019424 (Escherichia coli plasmid pFOS-HK151325, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

437. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024233 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

438. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012936 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

439. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP050372 (Klebsiella pneumoniae strain 50595 plasmid p50595_ERM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

440. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049176 (Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

441. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010345 (Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

442. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

443. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

444. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041363 (Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

445. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018946 (Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

446. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023365 (Escherichia coli strain 144 plasmid p92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

447. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023385 (Escherichia coli strain 1223 plasmid p87, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

448. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027367 (Escherichia coli strain 89-3156 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

449. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012923 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

450. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

451. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026158 (Klebsiella pneumoniae strain F93-2 plasmid pF93-2_1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

452. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049174 (Shigella sonnei strain 19.0820.1561 plasmid p19-0820-1561, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

453. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023918 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

454. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023918 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

455. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023957 (Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

456. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023959 (Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

457. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042886 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

458. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042887 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_03, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

459. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP043408 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

460. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP012929 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

461. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018462 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

462. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

463. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040542 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

464. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_002483 (Escherichia coli K-12 plasmid F DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

465. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

466. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP045934 (Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

467. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023382 (Escherichia coli strain 127 plasmid p95, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

468. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP048440 (Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

469. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049186 (Shigella sonnei strain 19.0821.3486 plasmid p19-0821-3486, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

470. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

471. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019207 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

472. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP045020 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

473. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021882 (Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

474. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023362 (Escherichia coli strain 1943 plasmid p85, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

475. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023356 (Escherichia coli strain 746 plasmid p95, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

476. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

477. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

478. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

479. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

480. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

481. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041679 (Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

482. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

483. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025709 (Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

484. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026576 (Escherichia coli strain WCHEC005237 plasmid pCTX-M-55_005237, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

485. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

486. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

487. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015914 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

488. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015916 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

489. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

490. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

491. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

492. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN823987 (Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

493. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

494. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049172 (Shigella sonnei strain 0401930105 plasmid p0401930105) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

495. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to JX486126 (Uncultured bacterium plasmid pEFC36a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

496. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021711 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000856, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

497. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

498. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP011496 (Escherichia coli strain NCM3722 isolate K-12 plasmid F, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

499. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to KY749247 (Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

500. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049170 (Shigella sonnei strain 19.1125.3493 plasmid p19-1125-3493, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

501. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP043949 (Escherichia coli strain AR202.2 plasmid pMPCMY-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

502. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

503. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025139 (Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

504. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049168 (Shigella sonnei strain 09163633 plasmid p09163633, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

505. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019173 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

506. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP023221 (Escherichia coli M505 plasmid pM505-a DNA, complete genome) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

507. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP023232 (Escherichia coli YJ4 plasmid pYJ4-a DNA, complete genome) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

508. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019090 (Escherichia coli plasmid pHK23a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

509. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

510. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023534 (Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

511. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

512. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

513. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049166 (Shigella sonnei strain 0401952027 plasmid p0401952027, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

514. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_019111 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

515. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016522 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

516. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019190 (Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

517. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

518. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

519. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

520. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029974 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

521. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

522. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

523. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040455 (Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

524. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018343 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

525. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015836 (Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

526. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015838 (Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

527. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034056 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

528. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034592 (Escherichia coli strain L37 plasmid pL37-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

529. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP049611 (Escherichia coli strain 06-3538 plasmid p06-3538-2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

530. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025339 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

531. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016865 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

532. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

533. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029842 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

534. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018104 (Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

535. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

536. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032888 (Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

537. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP043229 (Escherichia coli strain Ec-050 plasmid pEc-050-CMY-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

538. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_022742 (Escherichia coli plasmid pHUSEC2011-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

539. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

540. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019220 (Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

541. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP043945 (Escherichia coli strain AR216.2b plasmid pMPCMY-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

542. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027415 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

543. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP034048 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

544. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP029903 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

545. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP020340 (Shigella flexneri 4c strain 0702 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

546. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

547. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

548. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_023915 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

549. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP027673 (Escherichia coli strain 2014C-3003 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

550. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MH884650 (Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

551. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

552. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP042936 (Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

553. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

554. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025253 (Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

555. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_AP014806 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

556. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

557. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LR213461 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 4) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

558. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

559. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP021739 (Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

560. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

561. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985248 (Escherichia coli strain 720 plasmid RCS48_pI, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

562. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP019905 (Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

563. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MK295829 (Escherichia coli O25b:H4-ST131 strain 13.1 plasmid p131, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

564. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

565. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP049102 (Escherichia coli strain EC28 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

566. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

567. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

568. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041441 (Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

569. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025254 (Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

570. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

571. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP014320 (Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

572. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985306 (Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

573. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985275 (Escherichia coli strain R71 plasmid RCS70_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

574. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985305 (Escherichia coli strain ECOR 48 plasmid RCS84_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

575. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985227 (Escherichia coli strain 518 plasmid RCS28_pI, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

576. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985288 (Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

577. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985267 (Escherichia coli strain 637 plasmid RCS61_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

578. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985281 (Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

579. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LT985256 (Escherichia coli strain 580 plasmid RCS49_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

580. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP031656 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

581. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

582. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK416152 (Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

583. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK291500 (Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

584. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

585. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN101852 (Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

586. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN101857 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

587. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

588. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN101854 (Escherichia coli strain 13ZX36 plasmid p13ZX36-70, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

589. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

590. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

591. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MH674341 (Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

592. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

593. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN540570 (Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

594. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

595. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK778454 (Salmonella enterica strain W043 plasmid pYUW043, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

596. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MN241905 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

597. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_005327 (Escherichia coli plasmid pC15-1a, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

598. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

599. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

600. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

601. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP045943 (Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

602. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

603. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK079570 (Klebsiella pneumoniae strain BC6-3 plasmid pHNBC6-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

604. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

605. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

606. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK238490 (Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

607. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MH472638 (Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

608. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

609. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK048477 (Escherichia coli strain U-5227 plasmid pUB_DHA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

610. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

611. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK092064 (Escherichia coli strain 39R861 plasmid 39R861-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

612. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

613. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MK416155 (Escherichia coli strain AR24.2b plasmid pCMY-42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

614. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027127 (Escherichia coli strain AR_0374 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

615. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP038858 (Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

616. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

617. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

618. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197492 (Escherichia coli strain GDK4P177 plasmid pHNGD4P177, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

619. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

620. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

621. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

622. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197489 (Escherichia coli strain MC02 plasmid pHNMC02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

623. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

624. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

625. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

626. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

627. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

628. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

629. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF363048 (Klebsiella pneumoniae strain SB4816 plasmid pSB4816, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

630. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

631. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

632. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

633. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

634. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF370216 (Escherichia coli strain J53 plasmid pOX38-Gen, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

635. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF535908 (Escherichia coli strain 2269 plasmid pCTXM-2269, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

636. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

637. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG825370 (Escherichia coli strain 974 plasmid p974-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

638. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF078004 (Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

639. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF156697 (Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

640. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

641. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG825377 (Escherichia coli strain 1108 plasmid p1108-emrB, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

642. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

643. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

644. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG825376 (Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

645. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

646. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG844436 (Escherichia coli strain EC13 plasmid pCMY-136, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

647. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

648. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197494 (Escherichia coli strain AHC17 plasmid pHNAH17, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

649. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

650. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

651. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

652. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

653. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

654. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP016568 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318 plasmid pAMR588-04-00318_99, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

655. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP032226 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

656. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

657. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

658. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY865321 (Escherichia coli strain CH292B plasmid pECB11, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

659. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY865322 (Escherichia coli strain DH286F plasmid pECF12, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

660. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY964068 (Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

661. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197500 (Klebsiella pneumoniae strain HZMPC51-2 plasmid pHNMPC51, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

662. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG197501 (Klebsiella pneumoniae strain HZMPC43 plasmid pHNMPC43, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

663. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

664. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to CP043740 (Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

665. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

666. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

667. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MN548042 (Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

668. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

669. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

670. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

671. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP028611 (Escherichia coli strain 142 plasmid pTA142-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

672. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

673. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP040536 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctctcctt	Protospacer
********************************

674. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

675. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031904 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed19, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

676. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

677. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY075650 (Escherichia coli strain GD17 plasmid pGD17-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

678. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP018456 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

679. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP018457 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

680. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP018458 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

681. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN783745 (Escherichia coli plasmid pFII-FIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

682. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

683. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

684. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045828 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_01, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

685. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015070 (Escherichia coli strain Ecol_743 plasmid pEC743_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

686. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

687. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

688. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

689. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP019526 (Escherichia coli O25b:H4-ST131 B0018 plasmid pB0018 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

690. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042630 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

691. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041338 (Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

692. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035517 (Escherichia coli strain U14A plasmid pU14A_A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

693. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130565 (Escherichia coli strain MS14387 isolate MS14387 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

694. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054346 (Escherichia coli strain SCU-176 plasmid pSCU-176-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

695. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024272 (Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

696. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028484 (Escherichia coli strain E41-1 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

697. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030112 (Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

698. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025857 (Escherichia coli strain 504838 plasmid p504838_108, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

699. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035478 (Escherichia coli strain U13A plasmid pU13A_A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

700. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014493 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

701. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013354 (Escherichia coli O103:H2 str. 12009 plasmid pO103, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

702. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013655 (Escherichia coli SE15 plasmid pECSF1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

703. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013192 (Escherichia coli strain FORC_031 plasmid pFORC31.2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

704. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024227 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

705. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011136 (Escherichia coli VR50 plasmid pVR50B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

706. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031909 (Escherichia coli O103:H2 strain FWSEC0007 plasmid unnamed16, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

707. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

708. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992186 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

709. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

710. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017846 (Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

711. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021289 (Escherichia coli strain PA45B plasmid pPA45B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

712. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053724 (Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFIC, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

713. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044404 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

714. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992181 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

715. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992181 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

716. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014496 (Escherichia coli strain SaT040 plasmid pSaT040, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

717. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP046678 (Escherichia coli strain 152661 plasmid p152661_p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

718. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024248 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

719. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024274 (Escherichia coli strain F9792 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

720. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041619 (Shigella flexneri strain C32 plasmid pC32_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

721. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030770 (Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

722. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054941 (Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

723. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012683 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

724. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024286 (Escherichia albertii strain 2014C-4356 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

725. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027326 (Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

726. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

727. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019261 (Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

728. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012634 (Escherichia coli strain SF-166 plasmid pSF-166-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

729. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042640 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

730. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045279 (Escherichia coli strain LAU-OXA plasmid pLAU-OXA2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

731. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

732. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

733. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023845 (Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

734. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021180 (Escherichia coli strain 81009 plasmid pEC-81009, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

735. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024229 (Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

736. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024887 (Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

737. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027460 (Escherichia coli strain 90-3040 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

738. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027343 (Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

739. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041415 (Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

740. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015160 (Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

741. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018666 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pAA-EA11, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

742. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038384 (Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

743. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038388 (Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

744. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_008460 (Escherichia coli plasmid pO86A1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

745. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014523 (Escherichia coli strain ZH063 plasmid pZH063_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

746. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007150 (Escherichia coli RS218 plasmid pRS218, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

747. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029580 (Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

748. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014498 (Escherichia coli strain ZH193 plasmid pZH193, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

749. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053232 (Escherichia coli strain SCU-306 plasmid pSCU-306-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

750. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053248 (Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

751. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053246 (Escherichia coli strain SCU-485 plasmid pSCU-485-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

752. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_007941 (Escherichia coli UTI89 plasmid pUTI89, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

753. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027389 (Escherichia coli strain 2011C-4251 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

754. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029577 (Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

755. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038298 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

756. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019018 (Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

757. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014753 (Escherichia coli strain PSUO103 plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

758. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019456 (Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

759. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

760. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985303 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pII) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

761. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038397 (Escherichia coli O157:H7 strain DEC5A plasmid pDEC5A-4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

762. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012498 (Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

763. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015239 (Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

764. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043415 (Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

765. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010882 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_6, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

766. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039842 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

767. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP014654 (Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

768. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

769. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015131 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

770. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

771. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

772. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051655 (Escherichia coli strain RM13745 plasmid pRM13745-2) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

773. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051657 (Escherichia coli strain SJ7 plasmid pSJ7-1) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

774. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051656 (Escherichia coli strain RM11911 plasmid pRM11911) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

775. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011964 (Escherichia coli plasmid pAPEC-O103-ColBM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

776. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_014233 (Escherichia coli ETEC 1392/75 plasmid p557, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

777. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018662 (Escherichia coli O104:H4 str. 2009EL-2071 plasmid pAA-09EL71, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

778. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027311 (Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

779. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027549 (Escherichia coli strain 2014C-3061 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

780. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

781. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

782. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032202 (Escherichia coli strain AR_0086 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

783. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025841 (Escherichia coli strain 214-4 plasmid p214_4_132, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

784. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009233 (Escherichia coli strain CA08 plasmid pCA08, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

785. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017221 (Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

786. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007135 (Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

787. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017647 (Escherichia coli O7:K1 str. CE10 plasmid pCE10A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

788. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035468 (Escherichia coli strain U12A plasmid pU12A_A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

789. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051707 (Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

790. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130563 (Escherichia coli strain MS14384 isolate MS14384 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

791. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051701 (Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

792. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018654 (Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

793. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

794. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006263 (Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

795. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051712 (Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

796. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051689 (Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

797. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

798. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051726 (Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

799. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018785 (Escherichia coli strain SK1144 plasmid pSK1144) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

800. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021690 (Escherichia coli strain AR_0058 plasmid tig00007555j7554, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

801. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023372 (Escherichia coli strain 1283 plasmid p109, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

802. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024816 (Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

803. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024039 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ndm, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

804. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043544 (Escherichia coli strain F2_81 plasmid pF2_18C_FIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

805. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024480 (Escherichia coli strain 2011C-4315 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

806. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027545 (Escherichia coli strain 2013C-3264 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

807. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019954 (Escherichia coli M8 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

808. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042900 (Escherichia coli strain CFSAN061763 plasmid pCFSAN061763, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

809. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024265 (Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

810. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024151 (Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

811. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051734 (Escherichia coli strain SCU-109 plasmid pSCU-109-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

812. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051736 (Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

813. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023734 (Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

814. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051715 (Escherichia coli strain SCU-122 plasmid pSCU-122-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

815. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013175 (Escherichia coli plasmid pEC14_114, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

816. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

817. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022913 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

818. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024258 (Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

819. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

820. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018982 (Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

821. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018952 (Escherichia coli strain Ecol_276 plasmid pEC276_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

822. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042879 (Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

823. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042881 (Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_03, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

824. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018998 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

825. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023530 (Escherichia coli strain FDAARGOS_401 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

826. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

827. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022280 (Escherichia coli strain STEC299 plasmid pSTEC299_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

828. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042902 (Escherichia coli strain CFSAN061762 plasmid pCFSAN061762, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

829. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018207 (Escherichia coli strain MRSN346647 plasmid pMRSN346647_113.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

830. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027364 (Escherichia coli strain 88-3001 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

831. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032165 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

832. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015242 (Escherichia coli strain 2013C-4465 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

833. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

834. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027446 (Escherichia coli strain 2013C-3492 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

835. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

836. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

837. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

838. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016498 (Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

839. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009167 (Escherichia coli 1303 plasmid p1303_109, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

840. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054382 (Escherichia coli strain SCU-175 plasmid pSCU-175-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

841. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

842. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041111 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

843. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042247 (Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

844. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042974 (Escherichia coli strain CFSAN061768 plasmid pCFSAN061768, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

845. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024235 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

846. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015140 (Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

847. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041358 (Escherichia coli strain U1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

848. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018947 (Escherichia coli strain Ecol_224 plasmid pEC224_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

849. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018969 (Escherichia coli strain Ecol_542 plasmid pEC542_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

850. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023384 (Escherichia coli strain 1223 plasmid p147, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

851. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027367 (Escherichia coli strain 89-3156 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

852. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

853. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992169 (Escherichia coli isolate Escherichia coli str. TO60 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

854. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019028 (Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

855. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011416 (Escherichia coli SE11 plasmid pSE11-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

856. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043407 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

857. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047406 (Escherichia coli strain MS6193 plasmid pMS6193A-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

858. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054450 (Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

859. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN908840 (Escherichia coli plasmid pCss_E1373) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

860. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023378 (Escherichia coli strain 127 plasmid p123, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

861. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

862. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011418 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_02, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

863. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013028 (Escherichia coli strain 2012C-4227 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

864. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017630 (Escherichia coli UM146 plasmid pUM146, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

865. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048648 (Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

866. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

867. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

868. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028121 (Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

869. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025708 (Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

870. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014668 (Escherichia coli strain ECONIH2 plasmid pECO-bc6, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

871. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041001 (Escherichia coli strain FDAARGOS_772 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

872. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021871 (Escherichia coli strain H105 plasmid pH105, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

873. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015914 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

874. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028576 (Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

875. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032258 (Escherichia coli strain AR_0067 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

876. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034167 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

877. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030786 (Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

878. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN823989 (Klebsiella pneumoniae strain 283149 plasmid p283149-FII, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

879. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP025574 (Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

880. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

881. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

882. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017657 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

883. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023533 (Escherichia coli strain FDAARGOS_403 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

884. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022087 (Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

885. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014110 (Escherichia coli strain FDAARGOS_144 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

886. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024291 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

887. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

888. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023164 (Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

889. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019055 (Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

890. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023821 (Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

891. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054321 (Escherichia coli strain SCU-390 plasmid pSCU-390-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

892. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027106 (Escherichia coli strain RM14721 plasmid pRM14721, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

893. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP022357 (Escherichia coli E119 plasmid pE119_6kIMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

894. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP022359 (Escherichia coli E294 plasmid pE294_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

895. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028321 (Escherichia coli O18:H1 strain CFSAN067215 plasmid p0.1229_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

896. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520279 (Escherichia coli H0063 plasmid pH0063 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

897. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520280 (Escherichia coli H0106 plasmid pH0106 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

898. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520281 (Escherichia coli H0130 plasmid pH0130 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

899. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520282 (Escherichia coli I0082 plasmid pI0082 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

900. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520283 (Escherichia coli I0128 plasmid pI0128 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

901. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520284 (Escherichia coli HP003 plasmid pHP003 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

902. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520285 (Escherichia coli HP030 plasmid pHP030 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

903. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520286 (Escherichia coli HP050 plasmid pHP050 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

904. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520287 (Escherichia coli HP129 plasmid pHP129 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

905. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520288 (Escherichia coli HP223 plasmid pHP223 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

906. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520289 (Escherichia coli HP243 plasmid pHP243 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

907. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

908. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013951 (Klebsiella pneumoniae plasmid pKF3-140, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

909. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520268 (Escherichia coli C0044 plasmid pC0044 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

910. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520269 (Escherichia coli A0084 plasmid pA0084 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

911. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520270 (Escherichia coli A0086 plasmid pA0086 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

912. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520271 (Escherichia coli A0140 plasmid pA0140 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

913. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520272 (Escherichia coli A0145 plasmid pA0145 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

914. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520273 (Escherichia coli A0150 plasmid pA0150 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

915. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520274 (Escherichia coli C0079 plasmid pC0079 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

916. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520274 (Escherichia coli C0079 plasmid pC0079 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

917. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520274 (Escherichia coli C0079 plasmid pC0079 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

918. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520274 (Escherichia coli C0079 plasmid pC0079 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

919. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520274 (Escherichia coli C0079 plasmid pC0079 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

920. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520275 (Escherichia coli C0122 plasmid pC0122 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

921. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520276 (Escherichia coli F0090 plasmid pF0090 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

922. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520277 (Escherichia coli G0138 plasmid pG0138 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

923. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC520278 (Escherichia coli H0005 plasmid pH0005 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

924. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054355 (Escherichia coli strain SCU-172 plasmid pSCU-172-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

925. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013942 (Escherichia coli O55:H7 str. CB9615 plasmid pO55, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

926. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045999 (Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

927. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022743 (Escherichia coli plasmid pHUSEC2011-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

928. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027581 (Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

929. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027674 (Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

930. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027676 (Escherichia coli strain 88-3510 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

931. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010201 (Escherichia coli strain M10 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

932. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027392 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

933. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033847 (Escherichia coli strain FDAARGOS_497 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

934. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031323 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

935. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014804 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

936. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022651 (Escherichia coli strain 09-02E plasmid p1-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

937. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054414 (Escherichia coli strain SCU-204 plasmid pSCU-204-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

938. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019009 (Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

939. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295824 (Escherichia coli O25b:H4-ST131 strain 26 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

940. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295827 (Escherichia coli O25b:H4-ST131 strain U17 plasmid pU17, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

941. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295828 (Escherichia coli O25b:H4-ST131 strain U23 plasmid pU23, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

942. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295829 (Escherichia coli O25b:H4-ST131 strain 13.1 plasmid p131, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

943. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295830 (Escherichia coli O25b:H4-ST131 strain 425 plasmid p425, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

944. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295834 (Escherichia coli O25b:H4-ST131 strain 56 plasmid p56, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

945. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026930 (Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

946. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

947. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985219 (Escherichia coli strain 497 plasmid RCS21_p, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

948. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985226 (Escherichia coli strain 525 plasmid RCS27_p, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

949. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985309 (Escherichia coli strain CIP106223 plasmid RCS93_pI, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

950. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295817 (Escherichia coli O25b:H4-ST131 strain B9 plasmid pB9, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

951. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK295819 (Escherichia coli O25b:H4-ST131 strain U10 plasmid pU10, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

952. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023471 (Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

953. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

954. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK134376 (Escherichia coli strain 47EC plasmid p47EC, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

955. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN124286 (Escherichia coli strain RKI3099 plasmid pRKI3099b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

956. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039405 (Escherichia coli strain 377323_2f plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

957. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH523448 (Klebsiella pneumoniae strain KL8 plasmid pKL8-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

958. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

959. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG886288 (Escherichia coli strain MO plasmid pMO, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

960. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029422 (Escherichia coli strain 3385 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

961. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LC492469 (Escherichia coli strain M216 plasmid pM216_mF, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

962. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044190 (Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

963. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023827 (Escherichia coli strain 4/4 plasmid p4_4.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

964. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054318 (Escherichia coli strain SCU-479 plasmid pSCU-479-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtctttgtac	Protospacer
********************************

965. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 0, identity: 1.0

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	Protospacer
******************************************************

966. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

967. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

968. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

969. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgcagcca	Protospacer
*************************** ****

970. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019762 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

971. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018797 (Escherichia coli strain E2855 plasmid pE2855-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

972. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027673 (Escherichia coli strain 2014C-3003 plasmid unnamed1) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

973. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

974. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

975. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031903 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccg	Protospacer
*******************************.

976. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038793 (Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

977. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038793 (Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

978. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

979. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN612051 (Escherichia coli strain BM21 plasmid pIP72, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

980. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP053754 (Shigella sonnei strain 506 plasmid pMHMC-003, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

981. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_012487 (Escherichia coli plasmid pO26-Vir, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

982. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985300 (Escherichia coli strain ECOR 24 genome assembly, plasmid: RCS90_pI) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

983. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035469 (Escherichia coli strain U12A plasmid pU12A_B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

984. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051713 (Escherichia coli strain SCU-123 plasmid pSCU-123-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

985. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023387 (Escherichia coli strain 1190 plasmid p86, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

986. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

987. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025145 (Escherichia coli plasmid pL2-87, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

988. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025145 (Escherichia coli plasmid pL2-87, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

989. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

990. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

991. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

992. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035721 (Escherichia coli strain U15A plasmid pU15A_A, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

993. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032260 (Escherichia coli strain AR_0067 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

994. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

995. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054354 (Escherichia coli strain SCU-172 plasmid pSCU-172-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

996. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

997. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK396099 (Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

998. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK455767 (Escherichia coli strain Ec-2Lar plasmid pB-Ec2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

999. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgccgccc	Protospacer
******************************* 

1000. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1001. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1002. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG569891 (Shigella sonnei strain DE105 plasmid pDE105, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1003. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1004. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1005. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1006. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1007. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT779550 (Escherichia coli strain 369 plasmid p369, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1008. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM377238 (Escherichia coli strain HV114 plasmid pHV114, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1009. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM377239 (Escherichia coli strain HV292 plasmid pHV292, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1010. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP198616 (Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1011. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM377240 (Escherichia coli strain HV295 plasmid pHV295, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1012. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1013. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP789019 (Escherichia coli strain WCHEC13-8 plasmid pCMY42, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1014. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1015. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042631 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1016. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046284 (Salmonella enterica strain FDAARGOS_687 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1017. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024918 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1018. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1019. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1020. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017613 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1021. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017613 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1022. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022996 (Escherichia coli plasmid pO26-CRL-125, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1023. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022996 (Escherichia coli plasmid pO26-CRL-125, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1024. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032445 (Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1025. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT754167 (Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1026. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022992 (Escherichia coli plasmid pO111-CRL-115, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1027. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022267 (Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1028. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013193 (Escherichia coli strain FORC_031 plasmid pFORC31.3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1029. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1030. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1031. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014622 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1032. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049350 (Escherichia coli strain 3R plasmid p3R-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1033. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039299 (Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1034. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042951 (Escherichia coli strain D8-1 plasmid pD8-1_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1035. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992187 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1036. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053786 (Escherichia coli isolate 2-101 plasmid p2-101, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1037. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1038. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043738 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1039. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020511 (Escherichia coli strain 165 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1040. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1041. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS999562 (Escherichia coli isolate EC-TO143 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1042. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053788 (Escherichia coli isolate J31 plasmid pJ31, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1043. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KF290378 (Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1044. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021845 (Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1045. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020494 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1046. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012627 (Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1047. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_009788 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1048. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN007140 (Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1049. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_EU418926 (Escherichia coli strain JIE139 plasmid pJIE139, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1050. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044402 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1051. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048295 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1052. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1053. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026726 (Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1054. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019252 (Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1055. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006641 (Escherichia coli PCN061 plasmid PCN061p5, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1056. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1057. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1058. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1059. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028315 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1060. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041621 (Shigella flexneri strain C32 plasmid pC32_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1061. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015996 (Escherichia coli strain S51 plasmid pS51_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1062. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045189 (Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1063. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1064. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1065. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026855 (Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1066. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019248 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1067. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014096 (Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1068. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023329 (Escherichia coli strain B3804 plasmid pIFM3804, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1069. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014966 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1070. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022064 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1071. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021841 (Escherichia coli strain EC974 plasmid pEC974-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1072. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027374 (Escherichia coli strain 05-3629 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1073. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009052 (Escherichia coli NCCP15648 plasmid p15648-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1074. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016572 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1075. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041959 (Escherichia coli strain EC2 plasmid pEC2_4, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1076. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041413 (Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1077. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015161 (Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1078. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP053576 (Salmonella enterica strain 2012K-0845 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1079. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038347 (Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1080. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_014477 (Escherichia coli plasmid pCT, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1081. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040923 (Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1082. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1083. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044183 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1084. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1085. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032264 (Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1086. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1087. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181557 (Escherichia coli plasmid p14019095, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1088. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181558 (Escherichia coli plasmid p15076331, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1089. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181559 (Escherichia coli plasmid p199, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1090. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181560 (Escherichia coli plasmid p14006165, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1091. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181561 (Escherichia coli plasmid p14011252, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1092. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181562 (Escherichia coli plasmid p15090172, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1093. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181563 (Escherichia coli plasmid p15095941, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1094. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181564 (Escherichia coli plasmid p15124679, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1095. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181565 (Escherichia coli plasmid pESBL20140131, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1096. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181566 (Escherichia coli plasmid p15078279, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1097. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK181568 (Escherichia coli plasmid pESBL20150178, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1098. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1099. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1100. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1101. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030000 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1102. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MF152729 (Escherichia coli plasmid pCTXM1-MU2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1103. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN334219 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1104. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN334219 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1105. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN334220 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1106. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN334220 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1107. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_024979 (Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1108. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016387 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1109. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1110. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_024976 (Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1111. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_024978 (Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1112. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC019731 (Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1113. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985283 (Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1114. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040548 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1115. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP017892 (Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1116. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP017893 (Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1117. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP030839 (Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1118. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029110 (Escherichia coli strain AR436 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1119. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030232 (Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1120. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034255 (Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1121. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018803 (Escherichia coli strain E2863 plasmid pE2863-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1122. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018803 (Escherichia coli strain E2863 plasmid pE2863-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1123. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KY463221 (Escherichia coli plasmid pCMY-42, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1124. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053867 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1125. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053868 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1126. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040264 (Escherichia coli strain 631 plasmid pEc631_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1127. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040264 (Escherichia coli strain 631 plasmid pEc631_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1128. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021533 (Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1129. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024854 (Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1130. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027600 (Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1131. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027600 (Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1132. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgcagcca	Protospacer
*************************** ****

1133. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045519 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_CMY, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1134. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045467 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1135. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025180 (Escherichia coli plasmid pC23-89, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1136. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_005014 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1137. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023290 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dT, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1138. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019205 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1139. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985236 (Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1140. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985231 (Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1141. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985238 (Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1142. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985320 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1143. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985320 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1144. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051702 (Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1145. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023275 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1146. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023276 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dAT, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1147. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039490 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1148. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031615 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1149. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019190 (Escherichia coli strain M217 plasmid pM217_I1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1150. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033160 (Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1151. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048373 (Escherichia coli strain 164 plasmid pC-F-163_B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1152. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051720 (Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1153. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023376 (Escherichia coli strain 1283 plasmid p92, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1154. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024822 (Escherichia coli strain CREC-591 plasmid pCREC-591_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1155. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024976 (Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1156. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1157. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024481 (Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1158. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036181 (Escherichia coli strain WCHEC025970 plasmid p2_025970, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1159. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932026 (Escherichia coli plasmid pEC14II_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1160. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932027 (Escherichia coli plasmid pEC14II_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1161. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932029 (Escherichia coli plasmid pEC15I_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1162. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932030 (Escherichia coli plasmid pEC15I_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1163. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932032 (Escherichia coli plasmid pEC16I_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1164. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU932033 (Escherichia coli plasmid pEC16I_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1165. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MG516908 (Escherichia coli plasmid pEc42, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1166. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025176 (Escherichia coli plasmid pH2291-112, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1167. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1168. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025138 (Escherichia coli plasmid pH2332-107, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1169. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025138 (Escherichia coli plasmid pH2332-107, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1170. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025140 (Escherichia coli plasmid pH1519-88, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1171. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025142 (Escherichia coli plasmid pC60-108, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1172. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025143 (Escherichia coli plasmid pC59-112, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1173. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_025144 (Escherichia coli plasmid pC49-108, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1174. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016533 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1175. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024146 (Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1176. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027535 (Escherichia coli strain AR_0081 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1177. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009566 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1178. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013024 (Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1179. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013024 (Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1180. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029119 (Escherichia coli strain AR435 plasmid unnamed6) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1181. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030921 (Escherichia coli strain KL53 plasmid pKL53-M, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1182. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054459 (Escherichia coli strain SCU-103 plasmid pSCU-103-2) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1183. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019131 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1184. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019099 (Salmonella enterica plasmid pNF1358, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1185. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_032099 (Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1186. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_032100 (Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1187. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030025 (Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1188. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_006856 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1189. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016516 (Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1190. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016520 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1191. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1192. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048312 (Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1193. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049178 (Shigella sonnei strain 1205.3131 plasmid p1205-3131, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1194. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051282 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1195. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014972 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1196. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042247 (Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1197. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1198. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012936 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1199. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1200. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019061 (Escherichia coli plasmid pPWD4_103, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1201. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019097 (Escherichia coli plasmid Plm, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1202. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023365 (Escherichia coli strain 144 plasmid p92, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1203. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023370 (Escherichia coli strain 1428 plasmid p96, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1204. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023385 (Escherichia coli strain 1223 plasmid p87, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1205. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgcagcca	Protospacer
*************************** ****

1206. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012923 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1207. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011419 (Escherichia coli SE11 plasmid pSE11-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1208. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023957 (Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1209. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012929 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1210. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040542 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1211. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_002122 (Shigella sonnei plasmid P9 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1212. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039475 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1213. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023382 (Escherichia coli strain 127 plasmid p95, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1214. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcctccctcctgcagcca	Protospacer
*************************** ****

1215. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419430 (Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1216. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419431 (Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1217. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419432 (Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1218. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419433 (Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1219. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419434 (Escherichia coli strain 2016-40-21249 plasmid p21249, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1220. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419435 (Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1221. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419436 (Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1222. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419437 (Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1223. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN419438 (Escherichia coli strain 2016-40-24003 plasmid p24003, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1224. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025279 (Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1225. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1226. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053560 (Escherichia coli strain EC1 plasmid pEC1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1227. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053677 (Escherichia coli strain EC38 plasmid pEC38, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1228. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011081 (Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 plasmid pSL476_91, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1229. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019207 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1230. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021882 (Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1231. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023362 (Escherichia coli strain 1943 plasmid p85, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1232. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023356 (Escherichia coli strain 746 plasmid p95, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1233. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039604 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1234. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041679 (Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1235. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT868530 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1236. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043035 (Escherichia coli strain XDL plasmid pXDL-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1237. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025709 (Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1238. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1239. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015916 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1240. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049876 (Salmonella enterica subsp. enterica serovar Adjame strain 388789 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1241. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC480203 (Escherichia coli B64 plasmid pB64 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1242. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024253 (Escherichia coli O182:H21 strain D181 plasmid unnamed4) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1243. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043947 (Escherichia coli strain AR202.2 plasmid pMPTEM-30, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1244. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019173 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1245. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029837 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093A, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1246. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024292 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1247. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033633 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1248. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047610 (Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1249. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019111 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1250. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016522 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1251. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029742 (Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1252. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN335638 (Escherichia coli strain SFE199 plasmid pSFE199, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1253. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN335638 (Escherichia coli strain SFE199 plasmid pSFE199, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1254. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1255. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027135 (Escherichia coli strain AR_0369 plasmid unnamed3) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1256. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026778 (Shigella dysenteriae strain 69-3818 plasmid unnamed1) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1257. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1258. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029975 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1259. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC485173 (Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1260. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015838 (Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1261. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_016904 (Escherichia coli KO11FL plasmid pEKO1101, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1262. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017665 (Escherichia coli W plasmid pRK1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1263. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049611 (Escherichia coli strain 06-3538 plasmid p06-3538-2) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1264. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP049613 (Escherichia coli O157:H7 strain K1516 plasmid pK1516-1) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1265. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025339 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1266. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016865 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1267. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053678 (Escherichia coli strain EC28 plasmid pEC28, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1268. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018104 (Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1269. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032888 (Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1270. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043228 (Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1271. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_024955 (Escherichia coli strain AHC4 plasmid pHNAH4-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1272. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019220 (Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1273. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043943 (Escherichia coli strain AR216.2b plasmid pMPTEM-30, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1274. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027415 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1275. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033883 (Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1276. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023915 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1277. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH884650 (Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
taatggcgcagcagtcctccctcctgccgcca	Protospacer
*.******************************

1278. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
taatggcgcagcagtcctccctcctgccgcca	Protospacer
*.******************************

1279. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042936 (Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1280. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_021155 (Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1281. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP052260 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1282. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054413 (Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1283. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985248 (Escherichia coli strain 720 plasmid RCS48_pI, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1284. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036203 (Escherichia coli strain L725 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1285. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026941 (Escherichia coli strain CFS3313 plasmid pCFS3313-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1286. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041441 (Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1287. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985270 (Escherichia coli strain 716 plasmid RCS56_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1288. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985273 (Escherichia coli strain 03-235 plasmid RCS72_pI, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1289. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985280 (Escherichia coli strain 13947 plasmid RCS75_pI, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1290. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985286 (Escherichia coli strain 13948 plasmid RCS76_pI, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1291. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985288 (Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1292. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985281 (Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1293. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985256 (Escherichia coli strain 580 plasmid RCS49_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1294. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1295. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985278 (Escherichia coli strain 499 plasmid RCS68_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1296. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985235 (Escherichia coli strain 654 plasmid RCS34_p, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1297. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031656 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1298. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH674341 (Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1299. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK758104 (Escherichia coli strain 0126:B16 plasmid R16, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1300. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN540570 (Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1301. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN241905 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1302. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1303. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1304. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045951 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_02, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1305. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1306. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN124285 (Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1307. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053081 (Escherichia coli strain HB37 plasmid pHB37-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1308. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH847038 (Escherichia coli strain 04-021 plasmid p04-021, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1309. spacer 2.7|886939|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG948334 (Escherichia coli strain 2305 plasmid p2305, complete sequence) position: , mismatch: 1, identity: 0.969

tgatggcgcagcagtcctccctcctgccgcca	CRISPR spacer
tgatggcgcagcagtcttccctcctgccgcca	Protospacer
****************.***************

1310. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1311. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1312. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP015086 (Escherichia coli O25b:H4 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1313. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP030765 (Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1314. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU987452 (Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1315. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1316. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY288024 (Klebsiella pneumoniae strain ST709 plasmid pCC1410-2, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1317. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1318. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1319. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP018456 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1320. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP018457 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1321. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to AP018458 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1322. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NC_022651 (Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1323. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1324. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KT988018 (Escherichia coli strain V282 plasmid pEcoV282, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1325. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 1, identity: 0.969

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctctcctt	Protospacer
*****.**************************

1326. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051656 (Escherichia coli strain RM11911 plasmid pRM11911) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1327. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015086 (Escherichia coli O25b:H4 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1328. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030765 (Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1329. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025882 (Escherichia coli strain 503440 plasmid p503440_52, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1330. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025895 (Escherichia coli strain 503025 plasmid p503025_52, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1331. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025867 (Escherichia coli strain 504211 plasmid p504211_50, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1332. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1333. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1334. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1335. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MF679146 (Escherichia coli plasmid pBJ114-141, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1336. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MF679147 (Escherichia coli plasmid pBJ114T-190, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1337. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051632 (Escherichia coli O121 strain FDA858783-1-52 plasmid pFNW19M81, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1338. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU664810 (Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1339. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY007017 (Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1340. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1341. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025981 (Escherichia marmotae strain HT073016 plasmid pEM76, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1342. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048377 (Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1343. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015077 (Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1344. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025861 (Escherichia coli strain 504239 plasmid p504239_155, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1345. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025861 (Escherichia coli strain 504239 plasmid p504239_155, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1346. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1347. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045864 (Escherichia coli O157:H7 strain ATCC 43890 plasmid p1CFSAN076619, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1348. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP119165 (Escherichia coli strain QT598 plasmid pEC598, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1349. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP398867 (Escherichia coli strain DB04277 plasmid pDB4277, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1350. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP789020 (Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1351. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018626 (Escherichia coli strain FORC_044 plasmid pFORC44_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1352. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043016 (Escherichia coli strain 388808_gen plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1353. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043023 (Escherichia coli strain 399730_gen plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1354. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043012 (Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1355. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010147 (Escherichia coli strain D5 plasmid B, complete genome) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1356. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010187 (Escherichia coli strain M6 plasmid A, complete genome) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1357. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032806 (Escherichia coli strain ERL05-0623 plasmid pERL05-0623-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1358. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1359. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010232 (Escherichia coli strain S30 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1360. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017611 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1361. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042337 (Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1362. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015816 (Escherichia coli O157:H7 strain JEONG-1266 plasmid p0157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1363. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1364. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028608 (Escherichia coli strain 143 plasmid pTA143, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1365. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040398 (Escherichia coli strain BA22372 plasmid pCTX-M-15_22372, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1366. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011752 (Escherichia coli 55989 plasmid 55989p, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1367. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041624 (Escherichia coli O157:H7 strain ATCC 43888 plasmid pO157_like, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1368. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010158 (Escherichia coli strain D10 plasmid A, complete genome) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1369. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1370. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032798 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1371. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028113 (Escherichia coli O103 str. RM8385 plasmid pRM8385-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1372. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1373. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025871 (Escherichia coli strain 503829 plasmid p503829_52, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1374. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025905 (Escherichia coli strain 300709 plasmid p300709_60, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1375. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034401 (Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1376. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1377. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1378. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP054336 (Escherichia coli strain SCU-120 plasmid pSCU-120-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1379. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028651 (Escherichia coli strain 124 plasmid pTA124, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1380. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028653 (Escherichia coli strain 123 plasmid pTA123, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1381. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028679 (Escherichia coli strain 114 plasmid pTA114, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1382. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028701 (Escherichia coli strain 105 plasmid pTA105, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1383. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010207 (Escherichia coli strain M11 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1384. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028587 (Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1385. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042600 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1386. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041032 (Escherichia coli strain PT109 plasmid pLB_CTX-M-15_PT109, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1387. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048331 (Escherichia coli strain 10 plasmid p010_A, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1388. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034956 (Escherichia coli strain SCEC020026 plasmid pCTXM15_020026, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1389. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1390. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038182 (Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1391. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031911 (Escherichia coli O121:H19 strain FWSEC0006 plasmid unnamed15, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1392. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031923 (Escherichia coli O26:H11 strain FWSEC0001 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1393. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028634 (Escherichia coli strain 135 plasmid pTA135, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1394. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028637 (Escherichia coli strain 134 plasmid pTA134, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1395. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040573 (Escherichia coli O157:H7 strain ECP17-46 plasmid pCFSAN059540, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1396. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1397. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP042952 (Escherichia coli strain D8-1 plasmid pD8-1_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1398. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010305 (Escherichia coli O157:H7 str. SS52 plasmid p0157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1399. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032804 (Escherichia coli strain ERL05-1306 plasmid pERL05-1306, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1400. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1401. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1402. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053732 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1403. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028640 (Escherichia coli strain 133 plasmid pTA133, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1404. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LN850163 (Escherichia coli plasmid pI1-34TF, strain I1-34) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1405. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010197 (Escherichia coli strain M9 plasmid A, complete genome) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1406. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032802 (Escherichia coli strain ERL06-2442 plasmid pERL06-2442, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1407. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022688 (Escherichia coli strain CDC#03-98 plasmid p0157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1408. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtatttgtac	Protospacer
************************ *******

1409. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020546 (Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1410. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1411. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010316 (Escherichia coli strain 789 plasmid pAPEC-O78-ColV) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1412. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029575 (Escherichia coli strain DA33133 plasmid pDA33133-157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1413. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1414. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1415. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS998786 (Escherichia coli isolate EC-TO75 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1416. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1417. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053722 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1418. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1419. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028595 (Escherichia coli strain 150 plasmid pTA150, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1420. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028616 (Escherichia coli strain 141 plasmid pTA141, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1421. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1422. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_013010 (Escherichia coli O157:H7 str. TW14359 plasmid pO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1423. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032796 (Escherichia coli strain ERL06-2503 plasmid pERL06-2503, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1424. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019282 (Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1425. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012626 (Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1426. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034739 (Escherichia coli strain L65 plasmid pL65-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1427. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT077881 (Escherichia coli plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1428. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT077882 (Escherichia coli plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1429. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN007143 (Escherichia coli strain 100 plasmid p100_NDM5, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1430. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1431. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1432. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054364 (Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1433. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1434. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010372 (Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1435. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032790 (Escherichia coli strain NZRM4169 plasmid pNZRM4169, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1436. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024244 (Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1437. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1438. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1439. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020519 (Escherichia coli strain 222 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1440. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005931 (Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1441. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035367 (Escherichia coli O157:H7 strain C1-057 plasmid pC1-057, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1442. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1443. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049079 (Escherichia coli strain p11A plasmid p11A_p2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1444. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT077880 (Escherichia coli plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1445. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN158990 (Escherichia coli strain TREC4 plasmid pTREC4, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1446. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1447. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051693 (Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1448. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015847 (Escherichia coli O157:H7 strain FRIK2069 plasmid p0157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1449. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027220 (Escherichia coli strain 2015C-3163 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1450. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026854 (Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1451. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019247 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1452. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1453. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029243 (Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1454. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1455. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020496 (Escherichia coli strain 103 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1456. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019000 (Escherichia coli plasmid pHUSEC41-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1457. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024718 (Escherichia coli strain LS4 plasmid p1LS4, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1458. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027578 (Escherichia coli strain 2013C-4225 plasmid unnamed) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1459. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1460. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009053 (Escherichia coli NCCP15648 plasmid p15648-3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1461. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037942 (Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1462. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038410 (Escherichia coli O157:H7 strain 86-24 plasmid p86-24-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1463. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038422 (Escherichia coli O157:H7 strain 7636 plasmid p7636-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1464. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_009602 (Escherichia coli plasmid pSFO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1465. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_009602 (Escherichia coli plasmid pSFO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1466. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044146 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1467. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CM019851 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1468. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024721 (Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1469. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027350 (Escherichia coli strain 2014C-3655 plasmid unnamed) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1470. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027350 (Escherichia coli strain 2014C-3655 plasmid unnamed) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1471. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041427 (Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1472. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1473. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027130 (Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1474. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049355 (Escherichia coli strain T28R plasmid pT28R-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1475. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035753 (Escherichia coli E110019 plasmid pE110019_65, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1476. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047380 (Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1477. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038356 (Escherichia coli O157:H7 str. F8092B plasmid pF8092B-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1478. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038371 (Escherichia coli O157:H7 strain F6321 plasmid pF6321-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1479. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038404 (Escherichia coli O157:H7 strain BB24-1 plasmid pBB24-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1480. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038406 (Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1481. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038418 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1482. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038420 (Escherichia coli O157:H7 strain 2-6-2 plasmid pEX262-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1483. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038429 (Escherichia coli O157:H7 strain 611 plasmid p611-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1484. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038335 (Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1485. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038348 (Escherichia coli O157:H7 strain G5295 plasmid pG5295-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1486. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038359 (Escherichia coli O157:H7 strain F7508 plasmid pF7508-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1487. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038373 (Escherichia coli O157:H7 strain F6294 plasmid pF6294-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1488. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038375 (Escherichia coli O157:H7 strain F3113 plasmid pF3113-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1489. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038382 (Escherichia coli O157:H7 strain E32511 plasmid pE32511-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1490. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033091 (Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1491. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LT906556 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1492. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1493. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044139 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1494. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044144 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1495. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024055 (Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1496. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024617 (Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1497. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1498. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032877 (Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1499. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1500. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037944 (Escherichia coli strain CFSAN027343 plasmid pCFSAN027343, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1501. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053236 (Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1502. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012803 (Escherichia coli O157:H7 strain WS4202 isolate laboratory strain plasmid pO157-WS4202, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1503. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028606 (Escherichia coli strain 144 plasmid pTA144, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1504. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1505. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1506. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1507. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1508. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027547 (Escherichia coli strain 2013C-4187 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1509. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027119 (Escherichia coli strain 26561 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1510. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041421 (Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1511. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049937 (Escherichia coli strain JL05 plasmid pARG01, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1512. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038332 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1513. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038345 (Escherichia coli O157:H7 strain Gim1-1 plasmid pGM11-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1514. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038293 (Escherichia coli O157:H7 strain TB21-1 plasmid pTB21-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1515. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038308 (Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1516. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038312 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1517. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038327 (Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1518. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038343 (Escherichia coli O157:H7 strain H2495 plasmid pH2495-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1519. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038354 (Escherichia coli O157:H7 strain F8797 plasmid pF8797-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1520. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038368 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1521. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038379 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1522. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038401 (Escherichia coli O157:H7 strain DEC4E plasmid pDEC4E-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1523. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038415 (Escherichia coli O157:H7 strain 17B6-2 plasmid p17B6-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1524. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038426 (Escherichia coli O157:H7 strain 2571 plasmid p2571-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1525. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038286 (Escherichia coli O157:H7 strain YB14-1 plasmid pYB14-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1526. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038314 (Escherichia coli O157:H7 strain OK1 plasmid pOK1-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1527. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018240 (Escherichia coli strain 272 plasmid pO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1528. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1529. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040306 (Escherichia coli strain HB6 plasmid pO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1530. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040310 (Escherichia coli strain 21B8 plasmid pO157, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1531. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1532. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011916 (Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1533. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1534. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018994 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1535. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037912 (Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1536. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038291 (Escherichia coli O157:H7 strain TX 265-1 plasmid pTX265-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1537. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038304 (Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1538. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038320 (Escherichia coli O157:H7 strain NE122 plasmid pNE122-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1539. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038323 (Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1540. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038338 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1541. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038338 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1542. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038341 (Escherichia coli O157:H7 strain H6437 plasmid pH6437-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1543. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038350 (Escherichia coli O157:H7 strain F8952 plasmid pF8952-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1544. spacer 3.4|896328|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038352 (Escherichia coli O157:H7 strain F8798 plasmid pF8798-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgtggcgctgatgcgtctgggcgtctttgtac	CRISPR spacer
tgtggcgctgatgcgtctgggcgtttttgtac	Protospacer
************************.*******

1545. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 2, identity: 0.938

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaacgttgaagagtgcgaccgtctgtcttt	Protospacer
************************** **.**

1546. spacer 4.1|1530350|38|NZ_LR740758|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

1547. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037905 (Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
gcacgcagtgcctgataatcaatcttgctcac	Protospacer
**.********************.*******.

1548. spacer 2.8|886999|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 4, identity: 0.875

ctgaacgttgaagagtgcgaccgtctctcctt	CRISPR spacer
ctgaatgttgaagagtgcgaccgtctgttttt	Protospacer
*****.******************** *..**

1549. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataatcaatcttgctcac	Protospacer
 *.********************.*******.

1550. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to JQ011316 (Escherichia phage TL-2011a, partial genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaattttgctcac	Protospacer
 *.**************.*************.

1551. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019709 (Enterobacteria phage mEpX1, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaattttgctcac	Protospacer
 *.**************.*************.

1552. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1553. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1554. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1555. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011802 (Salmonella enterica bacteriophage SE1, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1556. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1557. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051272 (Salmonella phage SW-70, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1558. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051278 (Salmonella phage ST-87, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1559. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1560. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1561. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1562. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1563. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1564. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051285 (Salmonella phage ST-32, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1565. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1566. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1567. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1568. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1569. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1570. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1571. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1572. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1573. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1574. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1575. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1576. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1577. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1578. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1579. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1580. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1581. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1582. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1583. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_014900 (Salmonella phage ST160, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1584. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1585. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1586. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1587. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP051279 (Salmonella phage ST-35, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1588. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1589. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1590. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 4, identity: 0.875

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcat	Protospacer
 *.**************.*****.********

1591. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1592. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1593. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1594. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1595. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1596. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1597. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1598. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1599. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1600. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1601. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1602. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1603. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1604. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1605. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1606. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1607. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1608. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1609. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1610. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1611. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1612. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1613. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1614. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1615. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1616. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1617. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1618. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1619. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1620. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1621. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY565557 (Escherichia coli strain Mcp0221 plasmid pMcp0221, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tctcgcagtgcctgatagtcaatcttgctcac	Protospacer
 * **************.*****.*******.

1622. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP792123 (Escherichia coli strain MG1655 YFP plasmid ESBL242, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1623. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011917 (Escherichia coli LF82 plasmid plLF82, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1624. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LT906557 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctggtaattaattttgctcac	Protospacer
 *.***********.****.***********.

1625. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK125034 (Escherichia coli O25b:H4-ST131 plasmid p7.2.1, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1626. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MK125035 (Escherichia coli O25b:H4-ST131 plasmid pB20 clone ST131-Rx_O25b:fimH30, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1627. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027358 (Escherichia coli strain 2013C-4991 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1628. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1629. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027369 (Escherichia coli strain 2014C-3307 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1630. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_023916 (Escherichia coli H89 plasmid pECOH89, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1631. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1632. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1633. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG825385 (Escherichia coli strain 1107 plasmid p1107-111K, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1634. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY792081 (Escherichia coli strain EC-MCR1.8 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tctcgcagtgcctgatagtcaatcttgctcac	Protospacer
 * **************.*****.*******.

1635. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY853650 (Escherichia coli strain 347-43491A plasmid p977565, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tctcgcagtgcctgatagtcaatcttgctcac	Protospacer
 * **************.*****.*******.

1636. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG792102 (Escherichia phage P13803, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1637. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC487997 (Stx2-converting phage Stx2a F578 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1638. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1639. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012539 (Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1640. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG803184 (Escherichia phage P13353 complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1641. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU298437 (Escherichia phage phiON-2011, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1642. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG803185 (Escherichia phage P13357 complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1643. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HE664024 (Escherichia phage P13374 complete proviral genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1644. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG792104 (Escherichia phage P13771, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1645. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1646. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1647. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049924 (Stx2-converting phage Stx2a_F451 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1648. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG792105 (Escherichia phage P14437, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1649. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG792103 (Escherichia phage P8983, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1650. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP682381 (Escherichia phage PA28, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1651. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KM389362 (UNVERIFIED: Escherichia phage Phi05_1387 B clone contig00003 genomic sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1652. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MG986485 (Escherichia phage SH2026Stx1, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1653. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019714 (Enterobacteria phage HK446, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1654. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1655. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1656. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to FM180578 (Enterobacteria phage 2851, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1657. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU238070 (Stx converting phage vB_EcoS_ST2-8624, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1658. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH370387 (Salmonella phage S149, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1659. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012533 (Stx2-converting phage Stx2a_F723 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1660. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MG407615 (Salmonella phage Bp96115, partial genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1661. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to FJ188381 (Stx2-converting phage 1717, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1662. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT225101 (Escherichia phage Lys19259Vzw, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1663. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to LC487996 (Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1664. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU977419 (Stx1 converting phage AU5Stx1, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1665. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AF069529 (Bacteriophage HK97, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1666. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_002167 (Enterobacteria phage HK97, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1667. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1668. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1669. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_008464 (Stx2-converting phage 86, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1670. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011356 (Enterobacteria phage YYZ-2008, complete prophage genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1671. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_002730 (Enterobacteria phage HK620, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1672. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT833387 (Escherichia phage HF4s, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1673. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to JQ086374 (Enterobacteria phage HK544, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1674. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049944 (Stx2-converting phage Stx2a_WGPS8 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1675. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HM208303 (Stx2 converting phage vB_EcoP_24B, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1676. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012536 (Stx2-converting phage Stx2a_1447 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1677. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to FJ184280 (Enterobacteria phage YYZ-2008, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1678. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG803182 (Escherichia phage P13363 complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1679. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MH717096 (Escherichia phage N7, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1680. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_028660 (Escherichia phage phi191, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1681. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019769 (Enterobacteria phage HK542, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1682. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to GQ422451 (Enterobacteria phage Phi75, partial genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1683. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049923 (Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1684. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatattgctcac	Protospacer
 *.**************.***** *******.

1685. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU977420 (Stx1 converting phage AU6Stx1, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1686. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012538 (Stx2-converting phage Stx2a_WGPS4 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1687. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to GQ422450 (Enterobacteria phage UAB_Phi20, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1688. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP053388 (Escherichia phage CMS-2020a, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1689. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to HG803183 (Escherichia phage P13368 complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1690. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AB255436 (Stx2-converting phage 86 DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1691. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_005841 (Enterobacteria phage ST104 DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1692. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AF335538 (Bacteriophage HK620, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1693. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049925 (Stx converting phage vB_EcoS_P27, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1694. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_011357 (Stx2-converting phage 1717, complete prophage genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1695. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_018846 (Escherichia phage P13374, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1696. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049941 (Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1697. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1698. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaatcttgctcac	Protospacer
 *.**************.*****.*******.

1699. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1700. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1701. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_028685 (Shigella phage Ss-VASD, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctggtaattaattttgctcac	Protospacer
 *.***********.****.***********.

1702. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012530 (Stx2-converting phage Stx2a_F349 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1703. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1704. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AJ304858 (Bacteriophage CP-1639 and chromosomal integration site) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1705. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1706. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1707. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_049917 (Escherichia phage Lys12581Vzw, complete genome) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctggtaattaattttgctcac	Protospacer
 *.***********.****.***********.

1708. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to AP000400 (Enterobacteria phage VT1-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 5, identity: 0.844

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgataattaatttcgctcac	Protospacer
 *.****************.*****.*****.

1709. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 6, identity: 0.812

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
attcgcagtgcctggtaattaattttgctcac	Protospacer
.. ***********.****.***********.

1710. spacer 2.4|886759|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021332 (Maritalea myrionectae strain HL2708#5 plasmid pHL2708Y3, complete sequence) position: , mismatch: 7, identity: 0.781

gccagcataaaaccgcctttgatattttattg	CRISPR spacer
atcagcataaaaccgccattgaaattgtgtcg	Protospacer
..*************** **** *** *.*.*

1711. spacer 2.6|886879|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.781

agcacggctgcggggaatggctcaat-ctctgc	CRISPR spacer
cgctcggctgcggggaatggcgcatcgcgctg-	Protospacer
 ** ***************** ** . * *** 

1712. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcgcaatgggctggccgacgaacgcgg	CRISPR spacer
ggcatcggcactgcgctggccgacgaacgcgc	Protospacer
**  *  *** ** ***************** 

1713. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcgcaatgggctggccgacgaacgcgg	CRISPR spacer
ggcatcggcactgcgctggccgacgaacgcgc	Protospacer
**  *  *** ** ***************** 

1714. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1715. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcgcaatgggctggccgacgaacgcgg-	CRISPR spacer
tattttcgcaatgggctggccgtcg-acgcgcc	Protospacer
 . ** **************** ** *****  

1716. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1717. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1718. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1719. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1720. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gggttgcg-caatgggctggccgacgaacgcgg	CRISPR spacer
-gccagcgccaatgggctggccgccgaaagcga	Protospacer
 * . *** ************** **** ***.

1721. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 7, identity: 0.781

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaattttcatact	Protospacer
 *.**************.********  *  *

1722. spacer 3.5|896388|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 7, identity: 0.781

gcgcgcagtgcctgataatcaattttgctcat	CRISPR spacer
tcacgcagtgcctgatagtcaattttcatact	Protospacer
 *.**************.********  *  *

1723. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.864

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaagaaatgcagaaaccgt-	CRISPR spacer
tcaatgccggatgcggcgtgaacgccttatccggcctacaaaag-catgcagattcaata	Protospacer
.**.****************************************  *******  * .* 

1724. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NC_047804 (Ralstonia phage RS-PII-1, complete genome) position: , mismatch: 8, identity: 0.75

gggttgcgcaatgggctggccgacgaacgcgg	CRISPR spacer
cagttgcgcaatgggcgagccgacgtagttgg	Protospacer
 .************** .******* *  .**

1725. spacer 3.6|896448|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_AP017915 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 8, identity: 0.75

gaatattttggaaaaatagctatcaatccggg	CRISPR spacer
caatattttgaaaaaatatctatcaacttatg	Protospacer
 *********.******* *******.... *

1726. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 8, identity: 0.852

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
gccgttgccaaatgtaggccggataaggcgtttacgccgcatccggcatttgct	Protospacer
*********.**********************.*************** ... .

1727. spacer 2.2|886639|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 9, identity: 0.719

acgttcgcaccggtcagggtactgcgcagcgt	CRISPR spacer
tccgtcgcacaggtcggggtactgcgcggtca	Protospacer
 *  ****** ****.***********.*.  

1728. spacer 3.6|896448|32|NZ_LR740758|CRISPRCasFinder,CRT matches to NZ_LN908215 (Clostridium beijerinckii isolate C. beijerinckii DSM 6423 plasmid III) position: , mismatch: 9, identity: 0.719

gaatattttggaaaaatagctatcaatccggg	CRISPR spacer
atatatttttgaaaaattgctatcaattttta	Protospacer
. ******* ******* *********..  .

1729. spacer 5.2|4369207|56|NZ_LR740758|PILER-CR matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.839

tacag-tgcccgatgcgacgctgccgcgtcttatcgggcctacaaa-agttctgaacc	CRISPR spacer
-acggatgcccgatgcgacgctggcgcgtcttatcgggcctacaaacggccccgaat-	Protospacer
 **.* ***************** ********************** .*..*.***. 

1730. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 9, identity: 0.833

--gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
caaccg--ggctaatgtatgccggataaggcgtttacgccgcatccggcaacctga	Protospacer
  .***  * * ****** ***************.****************** * 

1731. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 10, identity: 0.688

gggttgcgcaatgggctggccgacgaacgcgg	CRISPR spacer
tcgcaaggcaatgcgctggccgatgaacgcct	Protospacer
  *. . ****** *********.******  

1732. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.815

gccgttgc-cgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
-cgggagcacgaatgtaggccggataaagcgtttacgccgcatccggcagtcatg	Protospacer
 * *  ** ******************.*****.***************..**  

1733. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 10, identity: 0.815

--gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
gagtcgc--ccgtatgtaggccggataaggcgtccacgccgcatccggcgttcggc	Protospacer
  *.**.  *** ********************.***************. .*.**

1734. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
tcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgagtcgcccgt	Protospacer
 *  ***************** ***********************.   .*.

1735. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
tcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa-ccgttacc	Protospacer
 *  *************************************.*. .*. *.* 

1736. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc--	CRISPR spacer
tcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacag--ccgttgcca	Protospacer
 *  *************************************..  .*. ***  

1737. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.814

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaagaaatgcagaaaccgt-	CRISPR spacer
ccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca-agaatctgta	Protospacer
*** ***********************************.** *. ... **** *.** 

1738. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.814

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaagaaatgcagaaaccgt-	CRISPR spacer
ccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca-agaatctgta	Protospacer
*** ***********************************.** *. ... **** *.** 

1739. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.814

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaagaaatgcagaaaccgt-	CRISPR spacer
ccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca-agaatctgta	Protospacer
*** ***********************************.** *. ... **** *.** 

1740. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.814

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaagaaatgcagaaaccgt-	CRISPR spacer
ccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca-agaatctgta	Protospacer
*** ***********************************.** *. ... **** *.** 

1741. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1742. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1743. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1744. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1745. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1746. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1747. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1748. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1749. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1750. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1751. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1752. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1753. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1754. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1755. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1756. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1757. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1758. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1759. spacer 2.1|886579|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 11, identity: 0.656

tgacgccatatgcagatcattgaggcgaaacc	CRISPR spacer
gagtcagggatgcagatcttcgaggcgaaacc	Protospacer
 ...   . ********* *.***********

1760. spacer 3.1|896147|33|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667

tggattccaaaccgcccaccaacaaaaacaggt	CRISPR spacer
caccccccacaccccccaccaacaaaaacaacc	Protospacer
..  ..*** *** ****************. .

1761. spacer 3.3|896268|32|NZ_LR740758|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 11, identity: 0.656

gggttgcgcaatgggctggccgacgaacgcgg	CRISPR spacer
ctcttgggccatgggctggccgacgacaatcc	Protospacer
   *** ** ****************  ..  

1762. spacer 5.2|4369207|56|NZ_LR740758|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.804

tacagtgcccgatgcgacgctgccgcgtcttatcgggcctacaaaagttctgaacc----	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaaa----tcaatcgctt	Protospacer
.**..****.************************.***********    * **.*    

1763. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 11, identity: 0.796

gccgttgccgaa----tgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
----ttttcatgattttgtaggccggataaggcgttcacgccgcatccggcaagaagc	Protospacer
    ** .*. .    *************************************  ***

1764. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 11, identity: 0.796

gccgttgccgaa----tgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
----ttttcatgattttgtaggccggataaggcgttcacgccgcatccggcaagaagc	Protospacer
    ** .*. .    *************************************  ***

1765. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

1766. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

1767. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

1768. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

1769. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ttgaagcctgatgcgacgctgacgcgtcttatcaggcctacnagacccgagc	Protospacer
 .   **************** ******************* ** .* * **

1770. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

1771. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

1772. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

1773. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

1774. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

1775. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

1776. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

1777. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

1778. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

1779. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc---	CRISPR spacer
cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa---actgcact	Protospacer
    ***************** ************ ******.*.   * ***   

1780. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc---	CRISPR spacer
cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa---actgcact	Protospacer
    ***************** ************ ******.*.   * ***   

1781. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.759

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
gtaaccgcacatcgtaggccggataaggcgtttacgccgcatccggcaaccgcg	Protospacer
*. ...**  * .*******************.******************.  

1782. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

1783. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

1784. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

1785. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

1786. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

1787. spacer 1.1|707567|59|NZ_LR740758|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 14, identity: 0.763

ccagtgccggatgcggcgtgaacgccttatccggcctacaaaag-----aaatgcagaaa	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaaataatttcaaca-	Protospacer
 .. ***************.************************     ** * **. * 

1788. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 14, identity: 0.741

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
attatttgcttttgtaggccggataaggcgtttacgccgcatccggcaacataa	Protospacer
....**  *   ********************.*****************  . 

1789. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 14, identity: 0.741

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
ctacacgtcacacgtaggtcggataaggcgttcacgccgcatccggcaaacact	Protospacer
 .   .*.*. *.*****.****************************** ** .

1790. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 14, identity: 0.731

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ccgatgcctgatgcgacgctgacgcgtcttatcatgcctacggacctgaacc	Protospacer
 *  ***************** ************ *******.......  *

1791. spacer 7.1|4925084|52|NZ_LR740758|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 14, identity: 0.731

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaatctgcaccc	Protospacer
 .  ***************** ************ ******.* .*  .. *

1792. spacer 5.1|4369108|63|NZ_LR740758|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.762

ttggtgcacgatgcctgatgcgacgctggcgcgtcttatcaggcctacattggtgccgga	CRISPR spacer
tcggtgcacgatgcctgatgcgacgctgccgcgtcttatcaggcctaca--------aaa	Protospacer
*.************************** ********************        ..*

1793. spacer 6.1|4696245|54|NZ_LR740758|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.722

gccgttgccgaatgtaggccggataaggcgttcacgccgcatccggcaaccagc	CRISPR spacer
atgatttatccatgtaggccggataaggcgtttacgccgcatccggcaattgtg	Protospacer
.. .**  .  *********************.****************...  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 881144 : 891444 6 Vibrio_phage(33.33%) protease NA
DBSCAN-SWA_2 1140091 : 1242854 84 Escherichia_phage(29.41%) integrase,protease,transposase,tail,portal,terminase,tRNA,capsid,head,holin attL 1157476:1157535|attR 1209125:1209141
DBSCAN-SWA_3 1854459 : 1917083 76 Escherichia_phage(34.62%) lysis,integrase,protease,tail,portal,terminase,capsid,head,holin attL 1859183:1859198|attR 1924449:1924464
DBSCAN-SWA_4 2023917 : 2081736 59 Enterobacteria_phage(60.0%) lysis,transposase,tail,portal,terminase,capsid,head NA
DBSCAN-SWA_5 2114732 : 2122467 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_6 2217814 : 2227259 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_7 2435710 : 2502515 74 Enterobacteria_phage(81.25%) lysis,integrase,transposase,portal,terminase,tRNA,head,holin attL 2465831:2465847|attR 2502589:2502605
DBSCAN-SWA_8 2629559 : 2674949 55 Escherichia_phage(57.69%) tail,terminase,holin,integrase attL 2650330:2650347|attR 2681028:2681045
DBSCAN-SWA_9 2757970 : 2881697 138 Salmonella_phage(40.86%) plate,lysis,integrase,protease,transposase,tail,portal,terminase,tRNA,capsid,head,holin attL 2807089:2807134|attR 2841774:2841819
DBSCAN-SWA_10 2957216 : 2964356 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_11 4607399 : 4651643 58 Enterobacteria_phage(57.41%) lysis,integrase,protease,tail,portal,terminase,tRNA,holin attL 4632708:4632723|attR 4658817:4658832
DBSCAN-SWA_12 4937411 : 4948848 12 Enterobacteria_phage(88.89%) integrase attL 4926012:4926026|attR 4960112:4960126
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LR740759
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15600 : 88450 54 Stx2-converting_phage(26.32%) bacteriocin,transposase,protease NA
DBSCAN-SWA_2 103824 : 152933 38 Macacine_betaherpesvirus(33.33%) integrase,transposase,protease attL 87025:87039|attR 158408:158422
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LR740759.1|WP_000813630.1|142844_143063_+|type-II-toxin-antitoxin-system-antitoxin-CcdA 142844_143063_+ 72 aa aa NA NA NA 103824-152933 yes
3. NZ_LR740760
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage