Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR595899 Burkholderia pseudomallei isolate UKMR15 chromosome 2 2 crisprs cas3,DinG,csa3 0 0 3 0
NZ_LR595898 Burkholderia pseudomallei isolate UKMR15 chromosome 1 2 crisprs DinG,RT,csa3,DEDDh,cas3,WYL,PrimPol 2 3 7 0

Results visualization

1. NZ_LR595899
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR595899_1 2602383-2602475 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR595899_2 3005276-3005421 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 527303 : 535644 12 Burkholderia_virus(42.86%) NA NA
DBSCAN-SWA_2 688362 : 760121 54 Vibrio_phage(25.0%) holin,plate NA
DBSCAN-SWA_3 2714810 : 2787986 43 Ralstonia_phage(20.0%) transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LR595898
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR595898_1 320878-321006 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR595898_2 1651171-1651283 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LR595898_1 1.2|320955|27|NZ_LR595898|CRISPRCasFinder 320955-320981 27 NZ_LR595898.1 320981-321007 0 1.0
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 974951-974972 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345702-1345723 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345711-1345732 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345720-1345741 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345729-1345750 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345738-1345759 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345747-1345768 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345756-1345777 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345765-1345786 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345774-1345795 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345783-1345804 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345792-1345813 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1345801-1345822 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 1782170-1782191 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_LR595899.1 2496189-2496210 2 0.909

1. spacer 1.2|320955|27|NZ_LR595898|CRISPRCasFinder matches to position: 320981-321007, mismatch: 0, identity: 1.0

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
tggctgatcgaagtggctgatcgaagt	Protospacer
***************************

2. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 974951-974972, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acggcaagcacggcaagcacga	Protospacer
***.********.*********

3. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345702-1345723, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

4. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345711-1345732, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

5. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345720-1345741, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

6. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345729-1345750, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

7. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345738-1345759, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

8. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345747-1345768, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

9. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345756-1345777, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

10. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345765-1345786, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacacgcacga	Protospacer
****** ******** ******

11. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345774-1345795, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

12. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345783-1345804, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

13. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345792-1345813, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

14. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1345801-1345822, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

15. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 1782170-1782191, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacaagcaccgcaagcacga	Protospacer
*********** .*********

16. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to position: 2496189-2496210, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacgagcacgacgagcacga	Protospacer
*****.********.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 71759-71780 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 72312-72333 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 71683-71704 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 71759-71780 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 71760-71781 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 71757-71778 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 72311-72332 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 71757-71778 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 71683-71704 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 69522-69543 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 72311-72332 2 0.909
NZ_LR595898_2 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder 1651239-1651260 22 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1567061-1567082 2 0.909
NZ_LR595898_1 1.2|320955|27|NZ_LR595898|CRISPRCasFinder 320955-320981 27 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1015989-1016015 4 0.852
NZ_LR595898_1 1.2|320955|27|NZ_LR595898|CRISPRCasFinder 320955-320981 27 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 490950-490976 5 0.815
NZ_LR595898_1 1.2|320955|27|NZ_LR595898|CRISPRCasFinder 320955-320981 27 NC_009508 Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence 79837-79863 5 0.815
NZ_LR595898_1 1.1|320903|27|NZ_LR595898|CRISPRCasFinder 320903-320929 27 NC_010865 Sinorhizobium meliloti plasmid pSmeSM11b, complete sequence 127776-127802 6 0.778
NZ_LR595898_1 1.1|320903|27|NZ_LR595898|CRISPRCasFinder 320903-320929 27 NZ_CP021216 Sinorhizobium meliloti RU11/001 plasmid pSmeRU11d, complete sequence 157384-157410 6 0.778
NZ_LR595898_1 1.1|320903|27|NZ_LR595898|CRISPRCasFinder 320903-320929 27 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 31326-31352 7 0.741

1. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

2. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

3. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

4. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

5. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

6. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

7. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

8. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

9. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

10. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

11. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

12. spacer 2.2|1651239|22|NZ_LR595898|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
ccgccaagcacgacaagcacga	Protospacer
 ** ******************

13. spacer 1.2|320955|27|NZ_LR595898|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.852

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
gggctgatcgaaggggttgatcgaagg	Protospacer
 ************ **.********* 

14. spacer 1.2|320955|27|NZ_LR595898|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
tggctgatcgaagtggatgttcgcggg	Protospacer
**************** ** *** .* 

15. spacer 1.2|320955|27|NZ_LR595898|CRISPRCasFinder matches to NC_009508 (Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence) position: , mismatch: 5, identity: 0.815

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
tggctgatcgaagtggatgttcgcggg	Protospacer
**************** ** *** .* 

16. spacer 1.1|320903|27|NZ_LR595898|CRISPRCasFinder matches to NC_010865 (Sinorhizobium meliloti plasmid pSmeSM11b, complete sequence) position: , mismatch: 6, identity: 0.778

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gtagatgtcgaagcgatcaatcgaagc	Protospacer
  *   .********************

17. spacer 1.1|320903|27|NZ_LR595898|CRISPRCasFinder matches to NZ_CP021216 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11d, complete sequence) position: , mismatch: 6, identity: 0.778

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gtagatgtcgaagcgatcaatcgaagc	Protospacer
  *   .********************

18. spacer 1.1|320903|27|NZ_LR595898|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gcgctgatcgaagcgatcaatcgaatc	Protospacer
  ....******************* *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102806 : 215156 113 Burkholderia_virus(41.94%) holin,transposase,capsid,terminase,head,plate,lysis,tRNA,protease,portal,tail NA
DBSCAN-SWA_2 960615 : 971570 10 Streptococcus_phage(16.67%) protease NA
DBSCAN-SWA_3 2386098 : 2394285 13 Ralstonia_virus(42.86%) NA NA
DBSCAN-SWA_4 2597275 : 2664097 75 uncultured_Caudovirales_phage(27.78%) transposase,capsid,tail,terminase,head,lysis,tRNA,integrase,protease,portal,plate attL 2636975:2636992|attR 2653144:2653161
DBSCAN-SWA_5 2953946 : 2962756 8 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_6 3315010 : 3324254 7 unidentified_phage(16.67%) NA NA
DBSCAN-SWA_7 3670316 : 3716409 35 Burkholderia_phage(28.57%) transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage