Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT962938 Brucella melitensis isolate 1 chromosome 1 1 crisprs csa3,DEDDh 0 1 3 0
NZ_LT962939 Brucella melitensis isolate 1 chromosome 2 0 crisprs DEDDh,csa3,cas3 0 0 0 0

Results visualization

1. NZ_LT962938
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT962938_1 1347030-1347112 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT962938_1 1.1|1347058|27|NZ_LT962938|CRISPRCasFinder 1347058-1347084 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1347058|27|NZ_LT962938|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1040559 : 1048896 10 Brucella_phage(33.33%) NA NA
DBSCAN-SWA_2 1119610 : 1131538 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 1356234 : 1404640 44 Rhodobacter_phage(20.0%) protease,tail,integrase,portal attL 1347037:1347051|attR 1360478:1360492
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage