Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT962931 Brucella melitensis isolate 1 chromosome 2 0 crisprs DEDDh,csa3,cas3 0 0 0 0
NZ_LT962930 Brucella melitensis isolate 1 chromosome 1 1 crisprs WYL,csa3,DEDDh 0 1 3 0

Results visualization

1. NZ_LT962930
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT962930_1 1346925-1347007 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT962930_1 1.1|1346953|27|NZ_LT962930|CRISPRCasFinder 1346953-1346979 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1346953|27|NZ_LT962930|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1040513 : 1050534 15 Brucella_phage(37.5%) integrase,transposase attL 1035499:1035539|attR 1050612:1050652
DBSCAN-SWA_2 1119559 : 1131471 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 1356127 : 1404529 45 Paracoccus_phage(27.27%) portal,integrase,tail,protease attL 1346932:1346946|attR 1360369:1360383
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage