Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT963350 Brucella melitensis isolate 1 chromosome 1 1 crisprs WYL,csa3,DEDDh 0 1 3 0
NZ_LT963351 Brucella melitensis isolate 1 chromosome 2 0 crisprs DEDDh,csa3,cas3 0 0 0 0

Results visualization

1. NZ_LT963350
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT963350_1 1346882-1346964 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT963350_1 1.1|1346910|27|NZ_LT963350|CRISPRCasFinder 1346910-1346936 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1346910|27|NZ_LT963350|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1040430 : 1048769 10 Brucella_phage(33.33%) NA NA
DBSCAN-SWA_2 1119476 : 1131388 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 1356084 : 1403198 42 Mesorhizobium_phage(12.5%) tail,integrase,portal,protease attL 1346889:1346903|attR 1360326:1360340
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage