Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT605586 Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 2 0 crisprs csa3,DEDDh,cas3 0 0 3 0
NZ_LT605585 Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 1 2 crisprs WYL,csa3 1 1 4 1

Results visualization

1. NZ_LT605585
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT605585_1 77357-77443 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT605585_2 1371216-1371345 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 623163-623195 0 1.0
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 726655-726687 0 1.0
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1376564-1376596 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1578720-1578752 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1808290-1808322 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 173187-173219 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 173246-173278 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 218894-218926 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 608614-608646 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 608677-608709 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1100950-1100982 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1280150-1280182 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1317465-1317497 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1434741-1434773 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605586.1 1035952-1035984 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605586.1 805095-805127 1 0.97
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1119960-1119992 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1481354-1481386 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1948907-1948939 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 1713218-1713250 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605585.1 2081709-2081741 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_LT605586.1 452521-452553 2 0.939

1. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 623163-623195, mismatch: 0, identity: 1.0

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgcttcgcacttttgctgg	Protospacer
*********************************

2. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 726655-726687, mismatch: 0, identity: 1.0

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgcttcgcacttttgctgg	Protospacer
*********************************

3. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1376564-1376596, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

4. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1578720-1578752, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atcctacgcaaaaccgcttcgcacttttgctgg	Protospacer
**** ****************************

5. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1808290-1808322, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgctttgcacttttgctgg	Protospacer
*******************.*************

6. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 173187-173219, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

7. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 173246-173278, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

8. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 218894-218926, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atcctacgcaaaaccgcttcgcacttttgctgg	Protospacer
**** ****************************

9. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 608614-608646, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

10. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 608677-608709, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

11. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1100950-1100982, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atcctacgcaaaaccgcttcgcacttttgctgg	Protospacer
**** ****************************

12. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1280150-1280182, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

13. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1317465-1317497, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgctacgcacttttgctgg	Protospacer
****************** **************

14. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1434741-1434773, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atcctacgcaaaaccgcttcgcacttttgctgg	Protospacer
**** ****************************

15. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1035952-1035984, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atcctacgcaaaaccgcttcgcacttttgctgg	Protospacer
**** ****************************

16. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 805095-805127, mismatch: 1, identity: 0.97

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcacttttgctgg	Protospacer
****.****************************

17. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1119960-1119992, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgctccgcacttttgctgg	Protospacer
****.*************.**************

18. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1481354-1481386, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgtttcacacttttgctgg	Protospacer
****************.***.************

19. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1948907-1948939, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaaaccgtttcacacttttgctgg	Protospacer
****************.***.************

20. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 1713218-1713250, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcacacttttgctgg	Protospacer
****.***************.************

21. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 2081709-2081741, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccaacgcaaagccgcttcgcatttttgctgg	Protospacer
************.**********.*********

22. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to position: 452521-452553, mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcatttttgctgg	Protospacer
****.******************.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 MW091529 Bacteriophage sp. 103231, partial genome 17761-17793 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 307699-307731 2 0.939
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1442949-1442981 3 0.909
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 426415-426447 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1735059-1735091 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 203864-203896 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 372268-372300 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 265654-265686 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 359025-359057 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 350343-350375 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021374 Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence 22966-22998 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 219044-219076 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 613253-613285 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 211108-211140 4 0.879
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1638434-1638466 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 27012-27044 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 388725-388757 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 73760-73792 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1066699-1066731 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 248437-248469 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 186856-186888 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 298575-298607 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 553177-553209 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 399760-399792 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 314731-314763 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 15292-15324 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 295112-295144 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 133768-133800 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 553179-553211 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 402545-402577 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 207982-208014 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 167050-167082 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 295444-295476 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 304591-304623 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 1011558-1011590 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 103414-103446 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 165375-165407 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 103089-103121 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 323410-323442 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 97416-97448 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 103083-103115 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 167253-167285 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 489368-489400 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 156455-156487 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 102943-102975 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 102816-102848 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 290325-290357 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 167382-167414 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 175773-175805 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 34445-34477 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 34445-34477 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015744 Shinella sp. HZN7 plasmid pShin-08, complete sequence 121589-121621 5 0.848
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1970559-1970591 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 381096-381128 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 401281-401313 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 309001-309033 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021374 Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence 162169-162201 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1441586-1441618 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 603485-603517 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 344248-344280 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 550485-550517 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 637718-637750 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 344250-344282 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 550487-550519 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 225316-225348 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 638908-638940 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 308131-308163 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 204333-204365 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 426401-426433 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 797362-797394 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 1071544-1071576 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 270396-270428 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 183734-183766 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 79144-79176 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 180196-180228 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 425526-425558 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 175584-175616 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 172044-172076 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 280762-280794 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 417881-417913 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 954023-954055 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 183918-183950 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 79328-79360 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 180380-180412 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 425710-425742 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 646916-646948 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 643376-643408 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 737790-737822 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 89491-89523 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 63690-63722 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 60150-60182 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 168869-168901 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 305988-306020 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 45128-45160 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 96918-96950 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 44980-45012 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 96791-96823 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 345294-345326 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 635362-635394 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 753392-753424 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 149420-149452 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 401120-401152 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 182797-182829 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 290770-290802 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 706081-706113 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 824065-824097 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 458219-458251 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 151144-151176 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 281155-281187 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 972759-972791 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1231942-1231974 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1045031-1045063 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1070511-1070543 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 462444-462476 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 249339-249371 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 459752-459784 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 53366-53398 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1142077-1142109 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 543160-543192 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 612880-612912 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 517729-517761 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048426 Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence 69439-69471 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 138852-138884 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 47897-47929 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 139880-139912 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2199417-2199449 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 396296-396328 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 655479-655511 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 468568-468600 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 494048-494080 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 177820-177852 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 388307-388339 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 175128-175160 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 292056-292088 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 251389-251421 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1204781-1204813 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 64482-64514 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 89962-89994 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 461228-461260 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 249350-249382 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 458536-458568 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 320929-320961 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 573983-574015 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 64457-64489 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 89905-89937 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 449553-449585 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 518874-518906 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 515435-515467 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 304050-304082 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 427331-427363 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 126190-126222 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 128345-128377 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 173128-173160 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 181637-181669 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 476537-476569 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 252202-252234 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 64457-64489 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 89905-89937 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 491585-491617 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 116558-116590 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1580283-1580315 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 454036-454068 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 110815-110847 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 360561-360593 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 303194-303226 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 645204-645236 6 0.818
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 342215-342247 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 618576-618608 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 342217-342249 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 223283-223315 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 216700-216732 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 228060-228092 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 970989-971021 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 178964-178996 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 322635-322667 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 247307-247339 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 390339-390371 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 247318-247350 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 236191-236223 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 187241-187273 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1562215-1562247 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 154940-154972 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 80213-80245 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 580152-580184 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 480108-480140 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 44636-44668 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 717143-717175 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP007050 Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence 187529-187561 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 10588-10620 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 155878-155910 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 399779-399811 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 297778-297810 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1430150-1430182 7 0.788
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 217481-217513 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 272736-272768 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 516465-516497 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 375788-375820 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 371114-371146 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 371108-371140 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 440383-440415 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 837587-837619 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 908236-908268 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1052730-1052762 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145754-1145786 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 535457-535489 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 247638-247670 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 476267-476299 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 72181-72213 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 72166-72198 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 179786-179818 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 72166-72198 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 761559-761591 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 430277-430309 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 436321-436353 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1712393-1712425 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 644840-644872 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 662022-662054 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 665423-665455 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 662022-662054 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 644840-644872 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1169383-1169415 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1583741-1583773 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1170382-1170414 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1648674-1648706 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 157482-157514 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 117812-117844 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 109165-109197 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 479301-479333 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 148078-148110 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1025179-1025211 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 310681-310713 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 111294-111326 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1583756-1583788 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 67080-67112 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1542933-1542965 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1148265-1148297 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 423468-423500 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 203289-203321 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 419321-419353 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 937190-937222 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 543045-543077 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 648914-648946 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 675682-675714 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 659262-659294 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 143433-143465 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1488478-1488510 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 580575-580607 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 651407-651439 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1239980-1240012 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1331009-1331041 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1417401-1417433 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 641102-641134 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 769774-769806 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 769418-769450 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 172417-172449 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 136303-136335 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 143098-143130 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1361678-1361710 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 400053-400085 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 1166702-1166734 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 327829-327861 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013597 Rhizobium sp. N741 plasmid pRspN741b, complete sequence 143800-143832 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013501 Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence 144166-144198 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 435250-435282 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013507 Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence 143800-143832 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 435250-435282 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013518 Rhizobium sp. N113 plasmid pRspN113a, complete sequence 144166-144198 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 435250-435282 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 411521-411553 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013491 Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence 144169-144201 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 435250-435282 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013513 Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence 165053-165085 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013496 Rhizobium sp. N621 plasmid pRspN621a, complete sequence 144169-144201 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013591 Rhizobium sp. N871 plasmid pRspN871a, complete sequence 144169-144201 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 376669-376701 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 430652-430684 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013603 Rhizobium sp. N731 plasmid pRspN731b, complete sequence 165053-165085 8 0.758
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 237148-237180 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 35623-35655 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 233818-233850 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 322332-322364 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 802543-802575 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 680344-680376 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 233790-233822 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 322662-322694 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 287473-287505 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 184149-184181 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 55726-55758 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 228160-228192 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1146185-1146217 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 511988-512020 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 110899-110931 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1586525-1586557 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 102057-102089 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 503326-503358 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 349346-349378 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 521799-521831 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 212415-212447 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 219312-219344 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 171580-171612 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 115422-115454 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 205066-205098 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 273269-273301 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1112806-1112838 9 0.727
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 486556-486588 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 802784-802816 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 69670-69702 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 635757-635789 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 241908-241940 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 706476-706508 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1718311-1718343 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 50093-50125 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 105003-105035 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 24362-24394 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 239616-239648 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 146067-146099 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 849408-849440 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 565921-565953 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 389422-389454 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 307415-307447 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1055997-1056029 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 307414-307446 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1056996-1057028 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 288644-288676 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 537972-538004 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 333389-333421 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NC_007762 Rhizobium etli CFN 42 plasmid p42a, complete sequence 44557-44589 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 72-104 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 97276-97308 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 302052-302084 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 90-122 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 687066-687098 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 275278-275310 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 287707-287739 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1988946-1988978 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 212867-212899 10 0.697
NZ_LT605585_1 1.1|77384|33|NZ_LT605585|CRISPRCasFinder 77384-77416 33 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 473178-473210 10 0.697

1. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to MW091529 (Bacteriophage sp. 103231, partial genome) position: , mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgcgcttttgctgg	Protospacer
****.*****************.**********

2. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
atccgacgcaaaaccgcttcgtacttttgctgg	Protospacer
****.****************.***********

3. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 3, identity: 0.909

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* *****************************

4. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

5. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

6. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

7. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccagacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

8. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

9. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

10. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

11. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .* .****************************

12. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacgcaaaaccgcttcgcatttttgctgg	Protospacer
 .* *******************.*********

13. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
accggacgcaaaaccgcttcgcactattgctgg	Protospacer
*.* .******************** *******

14. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 4, identity: 0.879

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttcggacgcaaaaccgctacgcacttttgctgg	Protospacer
 ** .************* **************

15. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaatcgcttcgcacttttgctgg	Protospacer
 .* .********.*******************

16. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

17. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgccgg	Protospacer
 .* .*************************.**

18. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tctggacgcaaaaccgcttcgcacttttgctgg	Protospacer
 .. .****************************

19. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccagacgcaaaaccgcttcgcacttttgctgt	Protospacer
 .* .*************************** 

20. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

21. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

22. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

23. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

24. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

25. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

26. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

27. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

28. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

29. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

30. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

31. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

32. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

33. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

34. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* .************* **************

35. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.848

atcca-acgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-tccatttgtaaaaccgcttcgcacctttgctgg	Protospacer
 ****  .*.***************.********

36. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

37. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcttcgcgcttttgctgg	Protospacer
 .* .*****************.**********

38. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

39. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

40. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

41. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

42. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

43. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

44. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcggacgcaaaaccgcttcgcatttttgctgg	Protospacer
  * .******************.*********

45. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

46. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg	Protospacer
 .* .************* **************

47. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg	Protospacer
 .* ************** *.************

48. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg	Protospacer
 .* ************** *.************

49. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg	Protospacer
 .* ************** *.************

50. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacggaaaaccgcttcgcactttttctgg	Protospacer
 .* **** ******************* ****

51. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacggaaaaccgcttcgcactttttctgg	Protospacer
 .* **** ******************* ****

52. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgaacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* **** ******************* ****

53. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgc-aaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccggacgcaaaaaccgctgcgcacttttgctgg	Protospacer
 .* .**** ********* **************

54. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 5, identity: 0.848

atccaacgc-aaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccggacgcaaaaaccgctgcgcacttttgctgg	Protospacer
 .* .**** ********* **************

55. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 5, identity: 0.848

-atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
aattcca-ggaaaaccgcttcgcacttttcctgg	Protospacer
 **.* * * ******************* ****

56. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 5, identity: 0.848

-atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
aattcca-ggaaaaccgcttcgcacttttcctgg	Protospacer
 **.* * * ******************* ****

57. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 5, identity: 0.848

--atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
aaatccg--gcaaaaccgcttcgcgcttttgccgg	Protospacer
  ****.  ***************.*******.**

58. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgcgtcgtacttttgctgg	Protospacer
 .* .************ ***.***********

59. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
gccttccgcaaaaccgcttcacacttttgctgg	Protospacer
..*.  **************.************

60. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaactgcttcgcacttttgccgg	Protospacer
 .* .*********.***************.**

61. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

62. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccggttcccacttttgctgg	Protospacer
 .* .*********** *** ************

63. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.818

-atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
aattcca-ggaaaaccgctacgcacttttcctgg	Protospacer
 **.* * * ********* ********* ****

64. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .  .************* **************

65. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg	Protospacer
 .* .************* ******.*******

66. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

67. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .  .************* **************

68. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg	Protospacer
 .* .************* ******.*******

69. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

70. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

71. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg	Protospacer
 .  .************* **************

72. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

73. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

74. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg	Protospacer
 .* .************* ***.**********

75. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccgggcgcaaaaccgctgcgcacttttgctgg	Protospacer
 .* ..************ **************

76. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

77. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

78. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

79. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

80. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg	Protospacer
 .* .****** ****** **************

81. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

82. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

83. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg	Protospacer
 .* .****** ****** **************

84. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg	Protospacer
 .* .************* ***.**********

85. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

86. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

87. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

88. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

89. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg	Protospacer
 .* .****** ****** **************

90. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

91. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

92. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg	Protospacer
 .* .****** ****** **************

93. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg	Protospacer
 .* .************* ***.**********

94. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

95. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga	Protospacer
 .* .************* *************.

96. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg	Protospacer
 .* .****** ****** **************

97. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg	Protospacer
 .* .************* ***.**********

98. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

99. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

100. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

101. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

102. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

103. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgggcgcaaaaccgcttcacacttttgctgg	Protospacer
 .* ..**************.************

104. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

105. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

106. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcccacttttgctgg	Protospacer
 .* .************* * ************

107. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

108. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

109. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

110. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

111. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

112. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

113. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgtaaaaccgctgcgcacttttgctgg	Protospacer
 .* .***.********* **************

114. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgctacacacttttgctgg	Protospacer
 .* .************* *.************

115. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg	Protospacer
 .* .******** **** **************

116. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

117. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

118. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

119. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg	Protospacer
 .* .************* * ************

120. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg	Protospacer
 .* .************* ******.*******

121. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

122. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

123. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaactgcgtcgcacttttgctgg	Protospacer
 .* .*********.** ***************

124. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

125. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg	Protospacer
 .* .******** **** **************

126. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

127. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaacgcttcgcactcttgctgg	Protospacer
 .* .******** ***********.*******

128. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

129. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccggttcccacttttgctgg	Protospacer
 .* .*********** *** ************

130. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tcctgacgcaaaaccgcttcacacttttactgg	Protospacer
 .*..***************.*******.****

131. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
caccatcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  *** ************ ***********  *

132. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg	Protospacer
 .* .******** **** **************

133. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

134. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

135. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

136. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

137. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg	Protospacer
 .* .************* ******.*******

138. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg	Protospacer
 .* .************* * ************

139. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

140. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

141. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg	Protospacer
 .* .******** **** **************

142. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

143. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

144. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg	Protospacer
 .* .************* * ************

145. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg	Protospacer
 .* .************* ******.*******

146. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

147. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

148. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

149. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

150. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

151. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

152. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

153. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

154. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

155. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

156. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

157. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg	Protospacer
 .* .************* .*************

158. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacgcaaaaccgctacacacttttgctgg	Protospacer
 .* .************* *.************

159. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

160. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttccccggcaaaagcgctgcgcacttttgctgg	Protospacer
 ***   ****** **** **************

161. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

162. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

163. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg	Protospacer
 .* *** * ********* ********* ****

164. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

165. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

166. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgcggg	Protospacer
 .* .************* *********** **

167. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgc-aaaaccgcttcgcacttttgctgg	CRISPR spacer
-gccggcgcaaaaaccgctgcgcacttttgttgg	Protospacer
  **..*** ********* **********.***

168. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacgcaaaaccgttgcgcacttttgctgg	Protospacer
 .* .***********.* **************

169. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttccccggcaaaagcgcttcgcacttttcctgg	Protospacer
 ***   ****** ************** ****

170. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 6, identity: 0.818

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*** ******************* ****

171. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 6, identity: 0.818

atccaac-gcaaaaccgcttcgcacttttgctgg	CRISPR spacer
-ccggacggaaaaaccgcttcgcactttttctgg	Protospacer
 .* .** * ******************* ****

172. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

173. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

174. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

175. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

176. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgcttcgcacttttcctgg	Protospacer
 .* .*.* ******************* ****

177. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
gccggatgcaaaaccgcgtcgcacttttgccgg	Protospacer
..* .*.********** ************.**

178. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctcg	Protospacer
 .* .*** ******************* ** *

179. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

180. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttccggacgaaaaccgcttcgcacttttcctgg	Protospacer
 ***..   ******************* ****

181. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

182. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

183. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

184. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

185. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

186. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggacggaaaaccgcttcgcacttttcctgc	Protospacer
 .* .*** ******************* *** 

187. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
gccggacacaaaaccgctgcgcacttttgctgc	Protospacer
..* .**.********** ************* 

188. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgggcgcgaaaccgctgcgcacttttgctgg	Protospacer
 .* ..***.******** **************

189. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgggcgcgaaaccgctgcgcacttttgctgg	Protospacer
 .* ..***.******** **************

190. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccgcccgcaaaaccgcttcacatttttgctgg	Protospacer
 .*   **************.**.*********

191. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcggacgcaaaaccggttcccacttttgctgc	Protospacer
  * .*********** *** *********** 

192. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

193. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

194. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctcg	Protospacer
 .* .*** ******************* ** *

195. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg	Protospacer
 * *   * ******************* ****

196. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacg--caaaaccgcttcgcacttttgctgg	CRISPR spacer
--cggacggaaaaaaccgctacgcacttttcctgg	Protospacer
  * .***   ********* ********* ****

197. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctggcaaaaccgctgcgcactcttgctgg	Protospacer
 * *   *********** ******.*******

198. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.788

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttcggatggaaaaccgctgcgcacttttcctgg	Protospacer
 ** .*.* ********* ********* ****

199. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggacttaaaaccgcctcgcactttcgctgg	Protospacer
 .* .** .********.*********.*****

200. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgggcggaaaaccgcttcgcacttttcctga	Protospacer
 .* ..** ******************* ***.

201. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcggtaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  *.*****************.* ****

202. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

203. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

204. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

205. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

206. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  * *****************.* ****

207. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  * *****************.* ****

208. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.* ************ *.*********  *

209. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

210. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.*.************ *.*********  *

211. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttaccgcaaaaccgctacgcacttttgcgcg	Protospacer
  ..* ************ ***********  *

212. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.* ************ *.*********  *

213. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.* ************ *.*********  *

214. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.*.************ *.*********  *

215. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccgggcggaaaaccgcttcgcacttttcctga	Protospacer
 .* ..** ******************* ***.

216. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  *.*.************ *.*********  *

217. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttcttctgg	Protospacer
 *.*.  * *****************.* ****

218. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

219. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

220. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgggagcgcaaaaccgcttcgcacttttcctca	Protospacer
    *.********************** ** .

221. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

222. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

223. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

224. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

225. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

226. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggactgaaaaccgctacgcacttttcctgg	Protospacer
 .* .**  ********* ********* ****

227. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

228. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggactgaaaaccgctacgcacttttcctgg	Protospacer
 .* .**  ********* ********* ****

229. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

230. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

231. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

232. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ..* ************ ***********  *

233. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  * *****************.* ****

234. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgcttcacacttttgcgcg	Protospacer
  ..* **************.*********  *

235. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

236. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

237. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgcttcacacttttgcgcg	Protospacer
  ..* **************.*********  *

238. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

239. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

240. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

241. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

242. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

243. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

244. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

245. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

246. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

247. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

248. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

249. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

250. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

251. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

252. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

253. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcccgg	Protospacer
 * *   * ******************* *.**

254. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

255. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

256. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

257. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

258. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

259. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  * *****************.* ****

260. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

261. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

262. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

263. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

264. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

265. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg	Protospacer
 *.*.  * *****************.* ****

266. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ttttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

267. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

268. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

269. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

270. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

271. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

272. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

273. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

274. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

275. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

276. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

277. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

278. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

279. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

280. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag	Protospacer
 *..* ************ *.********* .*

281. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg	Protospacer
 .* .*.* ********* ********* ****

282. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 8, identity: 0.758

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg	Protospacer
  ** . * *** *************** ****

283. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

284. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..*.************ *.*********  *

285. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

286. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

287. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
 *... ************ *.*********  *

288. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

289. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

290. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

291. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

292. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
tgcgagcgcaaaaccgcttcgcgcctttgcgac	Protospacer
  * *.****************.*.***** . 

293. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

294. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgtgatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  . * ************ *.*********  *

295. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttttcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ..  ************ ***********  *

296. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgcatcacacttttgcgcg	Protospacer
  ..* *********** **.*********  *

297. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

298. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgcaacgcacttttgcgcg	Protospacer
  ..* ***********  ***********  *

299. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

300. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..*.************ *.*********  *

301. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg	Protospacer
  ... ************ ***********  *

302. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

303. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaagccgcttcgcacttttgcgcg	Protospacer
  ... ******.*****************  *

304. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

305. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cggtatcgcaaaaccgctccacacttttgcgcg	Protospacer
   .* ************.*.*********  *

306. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..*.************ *.*********  *

307. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

308. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgtaaccgcaaaaccgctgcacacttttgcgcg	Protospacer
  . * ************ *.*********  *

309. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..* ************ *.*********  *

310. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

311. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
ctttgtcgcaaaaccgctgcacacttttgcgcc	Protospacer
 *... ************ *.*********   

312. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctacacacttttgcgcg	Protospacer
  ... ************ *.*********  *

313. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

314. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

315. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

316. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcgaaaccgctgcgcacttttgcgcg	Protospacer
  ... ***.******** ***********  *

317. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

318. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

319. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

320. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

321. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctacacacttttgcgcg	Protospacer
  ... ************ *.*********  *

322. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

323. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cggtgccgcaaaaccgctgcacacttttgcgcg	Protospacer
   .. ************ *.*********  *

324. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

325. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

326. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgtagtcgcaaaaccgctgcacacttttgcgtg	Protospacer
  . . ************ *.*********  *

327. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

328. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgtagtcgcaaaaccgctgcacacttttgcgtg	Protospacer
  . . ************ *.*********  *

329. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

330. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttctcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ..  ************ *.*********  *

331. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgtagtcgcaaagccgctgcgcacttttgcgcg	Protospacer
  . . ******.***** ***********  *

332. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

333. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

334. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

335. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

336. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

337. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

338. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

339. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

340. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

341. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

342. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

343. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

344. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

345. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

346. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

347. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

348. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

349. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

350. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

351. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

352. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

353. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

354. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 10, identity: 0.697

atccaacgcaaaaccgcttcgcacttttgctgg	CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg	Protospacer
  ... ************ *.*********  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1083888 : 1152754 61 Rhizobium_phage(54.84%) tail,transposase,plate,integrase,tRNA attL 1109023:1109049|attR 1156341:1156367
DBSCAN-SWA_2 1842726 : 1855794 13 uncultured_Mediterranean_phage(81.82%) transposase,tRNA NA
DBSCAN-SWA_3 1994522 : 2001878 6 Brucella_phage(66.67%) integrase,tail attL 1993270:1993285|attR 2004397:2004412
DBSCAN-SWA_4 2077317 : 2124049 40 Mesorhizobium_phage(14.29%) integrase,protease,head,tail attL 2074694:2074708|attR 2084892:2084906
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LT605585.1|WP_002964713.1|1115207_1115444_-|hypothetical-protein 1115207_1115444_- 78 aa aa NA NA NA 1083888-1152754 yes
2. NZ_LT605586
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 439269 : 452462 13 Bacillus_phage(22.22%) NA NA
DBSCAN-SWA_2 652312 : 709288 51 Rhizobium_phage(66.67%) tRNA,head,plate,tail,transposase NA
DBSCAN-SWA_3 1138794 : 1174409 48 Rhizobium_phage(38.71%) terminase,transposase,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage