Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053795 Vibrio cholerae strain W10G chromosome 2, complete sequence 0 crisprs csa3,cas3 0 0 1 0
NZ_CP053794 Vibrio cholerae strain W10G chromosome 1, complete sequence 1 crisprs cas3,DEDDh,DinG,csx1,csa3 0 1 4 0

Results visualization

1. NZ_CP053795
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 455127 : 467254 13 Vibrio_phage(77.78%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053794
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053794_1 2649224-2649467 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053794_1 1.1|2649273|37|NZ_CP053794|PILER-CR 2649273-2649309 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP053794_1 1.1|2649273|37|NZ_CP053794|PILER-CR 2649273-2649309 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2649273|37|NZ_CP053794|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2649273|37|NZ_CP053794|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 651941 : 658558 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1542710 : 1569436 20 Vibrio_phage(71.43%) transposase NA
DBSCAN-SWA_3 1809074 : 1858357 59 Vibrio_phage(52.78%) integrase,plate,portal,tail,tRNA,capsid,terminase attL 1841658:1841674|attR 1858107:1858123
DBSCAN-SWA_4 2348422 : 2355615 9 Anguillid_herpesvirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage