Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054940 Escherichia coli strain MS6192 chromosome, complete genome 6 crisprs WYL,DinG,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 33 11 0
NZ_CP054944 Escherichia coli strain MS6192 plasmid pMS6192D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP054941 Escherichia coli strain MS6192 plasmid pMS6192A-NDM, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP054940
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_1 44093-44224 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_2 652397-652493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_3 1191676-1191767 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_4 1770859-1770969 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_5 3031057-3031572 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054940_6 3057272-3058520 Unclear I-E
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054940_1 1.2|44167|42|NZ_CP054940|PILER-CR 44167-44208 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP054940_1 1.1|44110|40|NZ_CP054940|PILER-CR 44110-44149 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP054940_3 3.1|1191702|40|NZ_CP054940|CRISPRCasFinder 1191702-1191741 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP054940_5 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT 3031086-3031117 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP054940_6 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT 3057484-3057515 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 632328-632359 5 0.844
NZ_CP054940_6 6.23|3057492|32|NZ_CP054940|PILER-CR 3057492-3057523 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 632328-632359 5 0.844
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 112048-112078 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 138722-138752 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 134876-134906 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 159432-159462 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 139796-139826 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 255946-255976 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 159432-159462 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 132848-132878 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 132849-132879 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 159441-159471 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 159459-159489 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 159431-159461 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 138736-138766 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 138734-138764 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 138733-138763 6 0.806
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP009154 Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence 17332-17362 7 0.774
NZ_CP054940_6 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT 3057301-3057332 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP054940_6 6.6|3057606|32|NZ_CP054940|CRISPRCasFinder,CRT 3057606-3057637 32 NC_024792 Bacillus phage Bobb, complete genome 57906-57937 7 0.781
NZ_CP054940_6 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT 3057972-3058003 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 831891-831922 7 0.781
NZ_CP054940_6 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT 3057972-3058003 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 109991-110022 7 0.781
NZ_CP054940_6 6.25|3057614|32|NZ_CP054940|PILER-CR 3057614-3057645 32 NC_024792 Bacillus phage Bobb, complete genome 57906-57937 7 0.781
NZ_CP054940_6 6.31|3057980|32|NZ_CP054940|PILER-CR 3057980-3058011 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 831891-831922 7 0.781
NZ_CP054940_6 6.31|3057980|32|NZ_CP054940|PILER-CR 3057980-3058011 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 109991-110022 7 0.781
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1470278-1470308 8 0.742
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7608-7638 8 0.742
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7168-7198 8 0.742
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94061-94091 8 0.742
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9778-9808 8 0.742
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 NZ_CP038019 Eikenella exigua strain PXX plasmid unnamed1, complete sequence 39637-39668 8 0.75
NZ_CP054940_6 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT 3057301-3057332 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP054940_6 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT 3057484-3057515 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460575-460606 8 0.75
NZ_CP054940_6 6.6|3057606|32|NZ_CP054940|CRISPRCasFinder,CRT 3057606-3057637 32 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 114699-114730 8 0.75
NZ_CP054940_6 6.7|3057667|32|NZ_CP054940|CRISPRCasFinder,CRT 3057667-3057698 32 CP000876 Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence 90670-90701 8 0.75
NZ_CP054940_6 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT 3057728-3057759 32 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 131301-131332 8 0.75
NZ_CP054940_6 6.10|3057850|32|NZ_CP054940|CRISPRCasFinder,CRT 3057850-3057881 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 5007-5038 8 0.75
NZ_CP054940_6 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT 3057972-3058003 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 159957-159988 8 0.75
NZ_CP054940_6 6.18|3058338|32|NZ_CP054940|CRISPRCasFinder,CRT 3058338-3058369 32 MF773750 Mycobacterium phage OKCentral2016, complete genome 32038-32069 8 0.75
NZ_CP054940_6 6.18|3058338|32|NZ_CP054940|CRISPRCasFinder,CRT 3058338-3058369 32 JX307704 Mycobacterium virus Goose, complete genome 32135-32166 8 0.75
NZ_CP054940_6 6.20|3058460|32|NZ_CP054940|CRISPRCasFinder,CRT 3058460-3058491 32 NZ_CP016283 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence 62256-62287 8 0.75
NZ_CP054940_6 6.23|3057492|32|NZ_CP054940|PILER-CR 3057492-3057523 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460575-460606 8 0.75
NZ_CP054940_6 6.25|3057614|32|NZ_CP054940|PILER-CR 3057614-3057645 32 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 114699-114730 8 0.75
NZ_CP054940_6 6.26|3057675|32|NZ_CP054940|PILER-CR 3057675-3057706 32 CP000876 Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence 90670-90701 8 0.75
NZ_CP054940_6 6.27|3057736|32|NZ_CP054940|PILER-CR 3057736-3057767 32 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 131301-131332 8 0.75
NZ_CP054940_6 6.29|3057858|32|NZ_CP054940|PILER-CR 3057858-3057889 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 5007-5038 8 0.75
NZ_CP054940_6 6.31|3057980|32|NZ_CP054940|PILER-CR 3057980-3058011 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 159957-159988 8 0.75
NZ_CP054940_6 6.37|3058346|32|NZ_CP054940|PILER-CR 3058346-3058377 32 MF773750 Mycobacterium phage OKCentral2016, complete genome 32038-32069 8 0.75
NZ_CP054940_6 6.37|3058346|32|NZ_CP054940|PILER-CR 3058346-3058377 32 JX307704 Mycobacterium virus Goose, complete genome 32135-32166 8 0.75
NZ_CP054940_6 6.39|3058468|32|NZ_CP054940|PILER-CR 3058468-3058499 32 NZ_CP016283 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence 62256-62287 8 0.75
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 739494-739524 9 0.71
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 694600-694630 9 0.71
NZ_CP054940_5 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031208-3031238 31 AP014383 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS *** 34869-34899 9 0.71
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 NC_024216 Bacillus phage CAM003, complete genome 77679-77710 9 0.719
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 KJ489400 Bacillus phage Hoody T, complete genome 77517-77548 9 0.719
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 MF288921 Bacillus phage OTooleKemple52, complete genome 77645-77676 9 0.719
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 MH638310 Bacillus phage Kamfam, complete genome 77630-77661 9 0.719
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 MK215646 Bacillus phage vB_BthM-Goe5, complete genome 76671-76702 9 0.719
NZ_CP054940_5 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031451-3031482 32 MF498901 Bacillus phage Anthony, complete genome 78265-78296 9 0.719
NZ_CP054940_5 5.8|3031512|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR 3031512-3031543 32 NZ_CP032328 Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence 29293-29324 9 0.719
NZ_CP054940_6 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT 3057301-3057332 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP054940_6 6.3|3057423|32|NZ_CP054940|CRISPRCasFinder,CRT 3057423-3057454 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP054940_6 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT 3057484-3057515 32 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 91348-91379 9 0.719
NZ_CP054940_6 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT 3057728-3057759 32 NZ_CP005987 Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence 65430-65461 9 0.719
NZ_CP054940_6 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT 3057728-3057759 32 MN163281 Klebsiella phage KpCHEMY26, complete genome 2153-2184 9 0.719
NZ_CP054940_6 6.9|3057789|32|NZ_CP054940|CRISPRCasFinder,CRT 3057789-3057820 32 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 80627-80658 9 0.719
NZ_CP054940_6 6.11|3057911|32|NZ_CP054940|CRISPRCasFinder,CRT 3057911-3057942 32 MN698241 Pelagibacter phage HTVC027P, complete genome 53788-53819 9 0.719
NZ_CP054940_6 6.14|3058094|32|NZ_CP054940|CRISPRCasFinder,CRT 3058094-3058125 32 CP034667 Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence 11529-11560 9 0.719
NZ_CP054940_6 6.14|3058094|32|NZ_CP054940|CRISPRCasFinder,CRT 3058094-3058125 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1243128-1243159 9 0.719
NZ_CP054940_6 6.23|3057492|32|NZ_CP054940|PILER-CR 3057492-3057523 32 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 91348-91379 9 0.719
NZ_CP054940_6 6.27|3057736|32|NZ_CP054940|PILER-CR 3057736-3057767 32 NZ_CP005987 Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence 65430-65461 9 0.719
NZ_CP054940_6 6.27|3057736|32|NZ_CP054940|PILER-CR 3057736-3057767 32 MN163281 Klebsiella phage KpCHEMY26, complete genome 2153-2184 9 0.719
NZ_CP054940_6 6.28|3057797|32|NZ_CP054940|PILER-CR 3057797-3057828 32 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 80627-80658 9 0.719
NZ_CP054940_6 6.30|3057919|32|NZ_CP054940|PILER-CR 3057919-3057950 32 MN698241 Pelagibacter phage HTVC027P, complete genome 53788-53819 9 0.719
NZ_CP054940_6 6.33|3058102|32|NZ_CP054940|PILER-CR 3058102-3058133 32 CP034667 Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence 11529-11560 9 0.719
NZ_CP054940_6 6.33|3058102|32|NZ_CP054940|PILER-CR 3058102-3058133 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1243128-1243159 9 0.719
NZ_CP054940_6 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT 3057301-3057332 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP054940_6 6.15|3058155|32|NZ_CP054940|CRISPRCasFinder,CRT 3058155-3058186 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 65082-65113 10 0.688
NZ_CP054940_6 6.20|3058460|32|NZ_CP054940|CRISPRCasFinder,CRT 3058460-3058491 32 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 182843-182874 10 0.688
NZ_CP054940_6 6.34|3058163|32|NZ_CP054940|PILER-CR 3058163-3058194 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 65082-65113 10 0.688
NZ_CP054940_6 6.39|3058468|32|NZ_CP054940|PILER-CR 3058468-3058499 32 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 182843-182874 10 0.688

1. spacer 1.2|44167|42|NZ_CP054940|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

gaacttaacaatattgaaagttggatttatctgcgtgtgaca	CRISPR spacer
gaacttaacaatattgaaagttggatttatctgcgtgtgaca	Protospacer
******************************************

2. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

3. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

4. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

5. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

6. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

7. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

8. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

9. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

10. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

11. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

12. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

13. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

14. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

15. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

16. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

17. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

18. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

19. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

20. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

21. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

22. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

23. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

24. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

25. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

26. spacer 1.1|44110|40|NZ_CP054940|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

ccataaagcaatattgaaaatttctttttgctacgccatg	CRISPR spacer
ccataaagcaatattgaaaatttcttttttctacgccatg	Protospacer
***************************** **********

27. spacer 3.1|1191702|40|NZ_CP054940|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

28. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

29. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

30. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

31. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

32. spacer 5.1|3031086|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc	Protospacer
***************** * ************

33. spacer 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844

gcccgcct-cgtcggtgtattccgcgagatcgc	CRISPR spacer
-ccggcctacgtcgacgtattccgcgagatcgt	Protospacer
 ** **** *****..****************.

34. spacer 6.23|3057492|32|NZ_CP054940|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844

gcccgcct-cgtcggtgtattccgcgagatcgc	CRISPR spacer
-ccggcctacgtcgacgtattccgcgagatcgt	Protospacer
 ** **** *****..****************.

35. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
agagcgccggcggctcgccggatttgaccgc	Protospacer
 *****.***********.*******  ** 

36. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

37. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

38. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

39. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

40. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg-	CRISPR spacer
tgagcgacggcggcacgctggatgc-cgcgaa	Protospacer
****** ******* ******** . ****. 

41. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

42. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

43. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

44. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

45. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

46. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

47. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

48. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

49. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg	Protospacer
* *.**. *************** *** ***

50. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

tgagc---gtcggcggctcgctggatttgcgcgg	CRISPR spacer
---gcttggtcggcggctcgctgaatgtgcgggc	Protospacer
   **   ***************.** **** * 

51. spacer 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

52. spacer 6.6|3057606|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NC_024792 (Bacillus phage Bobb, complete genome) position: , mismatch: 7, identity: 0.781

gtcgccgggttgattttccatgatgattttta	CRISPR spacer
ttcgataggtagattttccatgatggtttttg	Protospacer
 *** ..*** **************.*****.

53. spacer 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.781

tgcgttgctatgcagatcgcgcagcgtcccga	CRISPR spacer
ttcgaagacatgcagatcgcgcagcgcaccga	Protospacer
* **  * .*****************. ****

54. spacer 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tgcgt-tgctatgcagatcgcgcagcgtcccga	CRISPR spacer
-gcgcaggctatgcagatagcgcaccgtccaca	Protospacer
 ***.  *********** ***** *****  *

55. spacer 6.25|3057614|32|NZ_CP054940|PILER-CR matches to NC_024792 (Bacillus phage Bobb, complete genome) position: , mismatch: 7, identity: 0.781

gtcgccgggttgattttccatgatgattttta	CRISPR spacer
ttcgataggtagattttccatgatggtttttg	Protospacer
 *** ..*** **************.*****.

56. spacer 6.31|3057980|32|NZ_CP054940|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.781

tgcgttgctatgcagatcgcgcagcgtcccga	CRISPR spacer
ttcgaagacatgcagatcgcgcagcgcaccga	Protospacer
* **  * .*****************. ****

57. spacer 6.31|3057980|32|NZ_CP054940|PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tgcgt-tgctatgcagatcgcgcagcgtcccga	CRISPR spacer
-gcgcaggctatgcagatagcgcaccgtccaca	Protospacer
 ***.  *********** ***** *****  *

58. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
gcctcaccggcggcacgctcgatttgcgcgg	Protospacer
    *..******* **** ***********

59. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag	Protospacer
.*  ********** ********.***  .*

60. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag	Protospacer
.*  ********** ********.***  .*

61. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag	Protospacer
.*  ********** ********.***  .*

62. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag	Protospacer
.*  ********** ********.***  .*

63. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038019 (Eikenella exigua strain PXX plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
gcctcatccaattcctgtgccaactcttggtg	Protospacer
 ****** .*****************   . *

64. spacer 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

65. spacer 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcccgcctcgtcggtgtattccgcgagatcgc	CRISPR spacer
cgtcgcctcgtcggcgtattccgccagcaggc	Protospacer
  .***********.********* **   **

66. spacer 6.6|3057606|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgccgggttgattttccatgatgattttta	CRISPR spacer
gtaaagagtttgattttccatgataattctta	Protospacer
** .  .* ***************.***.***

67. spacer 6.7|3057667|32|NZ_CP054940|CRISPRCasFinder,CRT matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 8, identity: 0.75

atataaatcgcaaagctcggaaaatgttttaa	CRISPR spacer
atataaatcgaaaagcttggaaaggaattgca	Protospacer
********** ******.*****. . **  *

68. spacer 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 8, identity: 0.75

cctctcttattttttcatcgtccatattcatg-	CRISPR spacer
cctctcttagtttttcaacgtcc-cctgcgtag	Protospacer
********* ******* ***** . * *.*. 

69. spacer 6.10|3057850|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 8, identity: 0.75

actgtcatctctctcccactgggagatagaaa	CRISPR spacer
ggtttcatccctttcccactgggagatcgtga	Protospacer
. * *****.**.************** * .*

70. spacer 6.12|3057972|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgttgctatgcagatcgcgcagcgtcccga	CRISPR spacer
gccgctgcgatgcagatcgcgcagcgtggaca	Protospacer
  **.*** ******************    *

71. spacer 6.18|3058338|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

72. spacer 6.18|3058338|32|NZ_CP054940|CRISPRCasFinder,CRT matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

73. spacer 6.20|3058460|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP016283 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgtgtcttcctgcggcgctggctcaccctgg	CRISPR spacer
cagaggcagcctgcggggctggctcactctgg	Protospacer
  * * *  ******* **********.****

74. spacer 6.23|3057492|32|NZ_CP054940|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcccgcctcgtcggtgtattccgcgagatcgc	CRISPR spacer
cgtcgcctcgtcggcgtattccgccagcaggc	Protospacer
  .***********.********* **   **

75. spacer 6.25|3057614|32|NZ_CP054940|PILER-CR matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgccgggttgattttccatgatgattttta	CRISPR spacer
gtaaagagtttgattttccatgataattctta	Protospacer
** .  .* ***************.***.***

76. spacer 6.26|3057675|32|NZ_CP054940|PILER-CR matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 8, identity: 0.75

atataaatcgcaaagctcggaaaatgttttaa	CRISPR spacer
atataaatcgaaaagcttggaaaggaattgca	Protospacer
********** ******.*****. . **  *

77. spacer 6.27|3057736|32|NZ_CP054940|PILER-CR matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 8, identity: 0.75

cctctcttattttttcatcgtccatattcatg-	CRISPR spacer
cctctcttagtttttcaacgtcc-cctgcgtag	Protospacer
********* ******* ***** . * *.*. 

78. spacer 6.29|3057858|32|NZ_CP054940|PILER-CR matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 8, identity: 0.75

actgtcatctctctcccactgggagatagaaa	CRISPR spacer
ggtttcatccctttcccactgggagatcgtga	Protospacer
. * *****.**.************** * .*

79. spacer 6.31|3057980|32|NZ_CP054940|PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgttgctatgcagatcgcgcagcgtcccga	CRISPR spacer
gccgctgcgatgcagatcgcgcagcgtggaca	Protospacer
  **.*** ******************    *

80. spacer 6.37|3058346|32|NZ_CP054940|PILER-CR matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

81. spacer 6.37|3058346|32|NZ_CP054940|PILER-CR matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 8, identity: 0.75

cgtccggatcggtttcgagaatctctacgctc	CRISPR spacer
cgccgagatcggcttcgaggatctctacgagg	Protospacer
**.* .******.******.*********   

82. spacer 6.39|3058468|32|NZ_CP054940|PILER-CR matches to NZ_CP016283 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgtgtcttcctgcggcgctggctcaccctgg	CRISPR spacer
cagaggcagcctgcggggctggctcactctgg	Protospacer
  * * *  ******* **********.****

83. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tgggcgacggcggctcgctggatgccgaaga	Protospacer
**.*** **************** .  . *.

84. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
tcggcgtcggcggctcgctcgacttgaagac	Protospacer
* .**************** **.*** . . 

85. spacer 5.3|3031208|31|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

tgagcgtcggcggctcgctggatttgcgcgg	CRISPR spacer
aaagcctcggcggctcgttggatttcatcat	Protospacer
 .*** ***********.*******   *. 

86. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NC_024216 (Bacillus phage CAM003, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aagagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

87. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to KJ489400 (Bacillus phage Hoody T, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

88. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to MF288921 (Bacillus phage OTooleKemple52, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

89. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to MH638310 (Bacillus phage Kamfam, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

90. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to MK215646 (Bacillus phage vB_BthM-Goe5, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

91. spacer 5.7|3031451|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to MF498901 (Bacillus phage Anthony, complete genome) position: , mismatch: 9, identity: 0.719

-----tcctcatgtaattcctgtgccaactcaataag	CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact	Protospacer
     **     ***** *********.*******  

92. spacer 5.8|3031512|32|NZ_CP054940|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 9, identity: 0.719

agatatctgttccggcttccagcgttttgttg	CRISPR spacer
gggcatgtgctccggcttccagcgtttcgggc	Protospacer
.*..** **.*****************.*   

93. spacer 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

94. spacer 6.3|3057423|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcatagccaggctgatccggcgacggcctta	CRISPR spacer
gcagcagaccggctgatccggcgacggccccg	Protospacer
*  ..** * *******************...

95. spacer 6.4|3057484|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719

gcccgcctcgtcggtgtattccgcgagatcgc	CRISPR spacer
taccgcctcgtcgatgtaatccgcgacgtgcg	Protospacer
  ***********.**** ******* .*   

96. spacer 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 9, identity: 0.719

cctctcttattttttcatcgtccatattcatg	CRISPR spacer
ttgcgattattttctcatcgtccttattcacc	Protospacer
.. *  *******.********* ******. 

97. spacer 6.8|3057728|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MN163281 (Klebsiella phage KpCHEMY26, complete genome) position: , mismatch: 9, identity: 0.719

-------cctctcttattttttcatcgtccatattcatg	CRISPR spacer
ggagaaacc-------ttttatcatcgtccagattcatg	Protospacer
       **       **** ********** *******

98. spacer 6.9|3057789|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.719

ggccc---cggaacatctgccgcagtgcgataccc	CRISPR spacer
---ccaggcggaacatctgcggcagggcgatcatg	Protospacer
   **   ************ **** *****  . 

99. spacer 6.11|3057911|32|NZ_CP054940|CRISPRCasFinder,CRT matches to MN698241 (Pelagibacter phage HTVC027P, complete genome) position: , mismatch: 9, identity: 0.719

gaaactctctgagaatccgtcagcaaaaatac	CRISPR spacer
accactctctgataatccatcagcaatagctc	Protospacer
.  ********* *****.******* *.. *

100. spacer 6.14|3058094|32|NZ_CP054940|CRISPRCasFinder,CRT matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 9, identity: 0.719

atttgtcgccgtatgagttttacgcgccgtct	CRISPR spacer
gtaaaaaaccgtctgagtcttacgcgccgtct	Protospacer
.*  .  .**** *****.*************

101. spacer 6.14|3058094|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

atttgtcgccgtatgagttttacgcgccgtct	CRISPR spacer
gatggcgagcgtctgagttttgcgcgccgtct	Protospacer
. * *. . *** ********.**********

102. spacer 6.23|3057492|32|NZ_CP054940|PILER-CR matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719

gcccgcctcgtcggtgtattccgcgagatcgc	CRISPR spacer
taccgcctcgtcgatgtaatccgcgacgtgcg	Protospacer
  ***********.**** ******* .*   

103. spacer 6.27|3057736|32|NZ_CP054940|PILER-CR matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 9, identity: 0.719

cctctcttattttttcatcgtccatattcatg	CRISPR spacer
ttgcgattattttctcatcgtccttattcacc	Protospacer
.. *  *******.********* ******. 

104. spacer 6.27|3057736|32|NZ_CP054940|PILER-CR matches to MN163281 (Klebsiella phage KpCHEMY26, complete genome) position: , mismatch: 9, identity: 0.719

-------cctctcttattttttcatcgtccatattcatg	CRISPR spacer
ggagaaacc-------ttttatcatcgtccagattcatg	Protospacer
       **       **** ********** *******

105. spacer 6.28|3057797|32|NZ_CP054940|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.719

ggccc---cggaacatctgccgcagtgcgataccc	CRISPR spacer
---ccaggcggaacatctgcggcagggcgatcatg	Protospacer
   **   ************ **** *****  . 

106. spacer 6.30|3057919|32|NZ_CP054940|PILER-CR matches to MN698241 (Pelagibacter phage HTVC027P, complete genome) position: , mismatch: 9, identity: 0.719

gaaactctctgagaatccgtcagcaaaaatac	CRISPR spacer
accactctctgataatccatcagcaatagctc	Protospacer
.  ********* *****.******* *.. *

107. spacer 6.33|3058102|32|NZ_CP054940|PILER-CR matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 9, identity: 0.719

atttgtcgccgtatgagttttacgcgccgtct	CRISPR spacer
gtaaaaaaccgtctgagtcttacgcgccgtct	Protospacer
.*  .  .**** *****.*************

108. spacer 6.33|3058102|32|NZ_CP054940|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

atttgtcgccgtatgagttttacgcgccgtct	CRISPR spacer
gatggcgagcgtctgagttttgcgcgccgtct	Protospacer
. * *. . *** ********.**********

109. spacer 6.1|3057301|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******    

110. spacer 6.15|3058155|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgtcccattcgatccgctggttttcgatga	CRISPR spacer
ggcgtcccattcgatcggctcgtagcgatcgc	Protospacer
**************** *** **  . . .* 

111. spacer 6.20|3058460|32|NZ_CP054940|CRISPRCasFinder,CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtgtcttcctgcggcgctggctcaccctgg	CRISPR spacer
ttccgaaatcctgcgccgctggttcaccctga	Protospacer
 . .*   ******* ******.********.

112. spacer 6.34|3058163|32|NZ_CP054940|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgtcccattcgatccgctggttttcgatga	CRISPR spacer
ggcgtcccattcgatcggctcgtagcgatcgc	Protospacer
**************** *** **  . . .* 

113. spacer 6.39|3058468|32|NZ_CP054940|PILER-CR matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtgtcttcctgcggcgctggctcaccctgg	CRISPR spacer
ttccgaaatcctgcgccgctggttcaccctga	Protospacer
 . .*   ******* ******.********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 332386 : 378088 48 Shigella_phage(44.44%) capsid,transposase,integrase,tail attL 354613:354652|attR 381894:381933
DBSCAN-SWA_2 945985 : 1048410 107 Salmonella_phage(64.81%) lysis,head,protease,tail,terminase,capsid,integrase,plate,transposase,portal attL 948713:948728|attR 1020577:1020592
DBSCAN-SWA_3 1512500 : 1530799 21 Escherichia_phage(66.67%) holin,tRNA NA
DBSCAN-SWA_4 1541886 : 1548789 7 Enterobacteria_phage(57.14%) holin,tail NA
DBSCAN-SWA_5 1734542 : 1762600 36 Enterobacteria_phage(44.0%) lysis,tail,terminase,integrase,transposase attL 1750296:1750310|attR 1768961:1768975
DBSCAN-SWA_6 2147102 : 2214647 63 Escherichia_phage(37.5%) head,holin,protease,tail,terminase,capsid,integrase,transposase,portal attL 2152514:2152529|attR 2230676:2230691
DBSCAN-SWA_7 2231113 : 2236853 9 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_8 2366982 : 2376424 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_9 2583189 : 2660635 92 Enterobacteria_phage(55.56%) transposase,lysis,holin,protease,terminase,integrase,coat,portal,tRNA attL 2580394:2580410|attR 2632441:2632457
DBSCAN-SWA_10 3007561 : 3014701 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_11 4801599 : 4844923 48 Enterobacteria_phage(46.81%) lysis,tail,terminase,integrase,transposase,portal attL 4794141:4794156|attR 4819085:4819100
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054941
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17016 : 71403 58 Escherichia_phage(27.27%) protease,transposase NA
DBSCAN-SWA_2 75140 : 130953 52 Escherichia_phage(33.33%) integrase,transposase attL 93205:93219|attR 124754:124768
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage