Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 2 crisprs DEDDh 0 8 0 0
NZ_CP054619 Azospirillum oryzae strain KACC 14407 chromosome, complete genome 5 crisprs WYL,csa3,DEDDh,cas3,cas5,cas8c,cas7b 0 2 1 0
NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 0 crisprs csa3,DEDDh,cas3 0 0 84 0
NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 0 crisprs csa3,DinG 0 0 1 0
NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 3 crisprs RT 0 4 11 0
NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 1 crisprs c2c9_V-U4 1 2 28 0
NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 0 crisprs c2c9_V-U4,DEDDh 0 0 0 0

Results visualization

1. NZ_CP054619
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054619_1 1273713-1274603 TypeI I-C
13 spacers
cas7b,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054619_3 1276511-1276724 TypeI NA
3 spacers
cas7b,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054619_2 1275914-1276460 TypeI NA:I-C
8 spacers
cas7b,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054619_4 1277222-1277573 TypeI NA
5 spacers
cas7b,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054619_5 2269490-2269587 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 EU399241 Halomonas phage phiHAP-1, complete genome 35466-35497 6 0.812
NZ_CP054619_2 2.9|1276197|31|NZ_CP054619|PILER-CR 1276197-1276227 31 MN855970 Bacteriophage sp. isolate 515, complete genome 4380-4410 7 0.774
NZ_CP054619_2 2.9|1276197|31|NZ_CP054619|PILER-CR 1276197-1276227 31 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 49457-49487 7 0.774
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 NC_013284 Cronobacter turicensis z3032 plasmid pCTU2, complete sequence 18614-18645 8 0.75
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 31554-31585 8 0.75
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 NC_009779 Cronobacter sakazakii ATCC BAA-894 plasmid pESA2, complete sequence 27480-27511 8 0.75
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 185050-185081 8 0.75
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 NZ_CP026388 Leclercia sp. LSNIH3 plasmid pLEC-2975, complete sequence 26097-26128 9 0.719
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 MN823994 Leclercia adecarboxylata strain 150707804 plasmid p707804-2FII, complete sequence 14254-14285 9 0.719
NZ_CP054619_2 2.10|1276263|32|NZ_CP054619|PILER-CR 1276263-1276294 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 190715-190746 9 0.719

1. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to EU399241 (Halomonas phage phiHAP-1, complete genome) position: , mismatch: 6, identity: 0.812

ttgaacgggtcgagaagctt---gaagacctgtgc	CRISPR spacer
tagaacggatcgagaagcttgaggaagagctg---	Protospacer
* ******.***********   ***** ***   

2. spacer 2.9|1276197|31|NZ_CP054619|PILER-CR matches to MN855970 (Bacteriophage sp. isolate 515, complete genome) position: , mismatch: 7, identity: 0.774

acgacctgaagcacaaggccgacgagacctg	CRISPR spacer
tcgacctgaagaagaaggccgacgacctcag	Protospacer
 ********** * ***********  .* *

3. spacer 2.9|1276197|31|NZ_CP054619|PILER-CR matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 7, identity: 0.774

acgacctgaagcacaaggccga---cgagacctg	CRISPR spacer
acgaccagaagaacaaggccgacttcaaggc---	Protospacer
****** **** **********   *.**.*   

4. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to NC_013284 (Cronobacter turicensis z3032 plasmid pCTU2, complete sequence) position: , mismatch: 8, identity: 0.75

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
ttgaacgggtcgagaagcctgaaagcaattaa	Protospacer
******************.****..*   *. 

5. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
ttgaacgggtcgagaagcctgaaagcaattaa	Protospacer
******************.****..*   *. 

6. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to NC_009779 (Cronobacter sakazakii ATCC BAA-894 plasmid pESA2, complete sequence) position: , mismatch: 8, identity: 0.75

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
ttgaacgggtcgagaagcctgaaagcaattaa	Protospacer
******************.****..*   *. 

7. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 8, identity: 0.75

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
tcgagcgggtcgagaagctcgaagaggagatc	Protospacer
*.**.**************.*****   *  *

8. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to NZ_CP026388 (Leclercia sp. LSNIH3 plasmid pLEC-2975, complete sequence) position: , mismatch: 9, identity: 0.719

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
ttgaacgggtcgagaagcctgaaagtaattaa	Protospacer
******************.****...   *. 

9. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to MN823994 (Leclercia adecarboxylata strain 150707804 plasmid p707804-2FII, complete sequence) position: , mismatch: 9, identity: 0.719

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
ttgaacgggtcgagaagcctgaaagtaattaa	Protospacer
******************.****...   *. 

10. spacer 2.10|1276263|32|NZ_CP054619|PILER-CR matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.719

ttgaacgggtcgagaagcttgaagacctgtgc	CRISPR spacer
cggaactgctcgagaagcttgaagagtgcggc	Protospacer
. **** * **************** .   **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 665845 : 675599 10 Choristoneura_biennis_entomopoxvirus(16.67%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054618
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 300721 : 360633 54 Anomala_cuprea_entomopoxvirus(18.18%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP054621
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6839 2 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_2 26418 : 27863 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_3 30994 : 32563 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_4 39969 : 42420 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 67535 : 73517 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_6 77279 : 82421 7 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_7 85922 : 92929 5 Hokovirus(50.0%) NA NA
DBSCAN-SWA_8 99320 : 101825 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_9 113471 : 118243 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_10 126368 : 127406 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_11 150610 : 153895 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_12 161477 : 162530 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_13 165668 : 169076 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_14 172198 : 173974 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_15 177815 : 185649 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_16 189111 : 193529 2 Feldmannia_irregularis_virus(50.0%) NA NA
DBSCAN-SWA_17 197510 : 200865 3 Hokovirus(33.33%) NA NA
DBSCAN-SWA_18 224975 : 227834 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_19 232662 : 233712 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_20 241536 : 249818 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_21 257231 : 259194 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_22 265061 : 265580 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_23 279182 : 282305 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_24 287014 : 287965 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_25 294490 : 296404 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_26 307145 : 316137 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_27 320026 : 331247 9 Hepacivirus(25.0%) protease NA
DBSCAN-SWA_28 335161 : 338432 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_29 353077 : 354760 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_30 366073 : 367786 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_31 390067 : 391654 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_32 401523 : 403071 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 408248 : 413546 3 Ralstonia_phage(50.0%) integrase,transposase attL 405311:405326|attR 429635:429650
DBSCAN-SWA_34 433878 : 438116 5 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_35 448788 : 451417 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_36 461922 : 466221 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_37 474233 : 475685 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_38 490468 : 492124 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 507514 : 509060 3 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_40 518363 : 519044 1 Bacillus_phage(100.0%) integrase attL 514957:514971|attR 520070:520084
DBSCAN-SWA_41 523116 : 524892 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_42 529864 : 547379 10 Acidithiobacillus_phage(33.33%) transposase NA
DBSCAN-SWA_43 566905 : 568414 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 575467 : 576418 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_45 580845 : 582302 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_46 590748 : 593604 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_47 598954 : 607101 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_48 611297 : 614217 3 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_49 626260 : 631656 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_50 640098 : 645426 4 Pike_perch_iridovirus(50.0%) NA NA
DBSCAN-SWA_51 650433 : 653412 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_52 657915 : 662712 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_53 666454 : 667240 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_54 672588 : 677667 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_55 688285 : 694618 5 Organic_Lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_56 715342 : 718009 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_57 729791 : 738095 7 Ostreococcus_tauri_virus(66.67%) NA NA
DBSCAN-SWA_58 746560 : 753783 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_59 759870 : 761885 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_60 766020 : 766911 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_61 770170 : 777882 6 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_62 784585 : 785677 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_63 789083 : 794315 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_64 804921 : 811530 6 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_65 817888 : 820302 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_66 835536 : 894219 50 uncultured_Mediterranean_phage(29.41%) tRNA,transposase,integrase,protease attL 841282:841301|attR 899046:899065
DBSCAN-SWA_67 906413 : 913635 4 Mycobacterium_virus(33.33%) NA NA
DBSCAN-SWA_68 951116 : 952031 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_69 955103 : 956204 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_70 959624 : 962116 4 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_71 965995 : 967090 1 Planktothrix_phage(100.0%) holin NA
DBSCAN-SWA_72 974278 : 977089 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_73 981008 : 982523 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_74 992305 : 992806 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_75 998508 : 999663 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_76 1015158 : 1015995 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_77 1020421 : 1026138 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_78 1043980 : 1045429 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 1048800 : 1054407 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_80 1065400 : 1068759 4 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_81 1082243 : 1086482 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_82 1092337 : 1095590 4 Rhodobacter_phage(33.33%) NA NA
DBSCAN-SWA_83 1103010 : 1105230 1 Feldmannia_species_virus(100.0%) NA NA
DBSCAN-SWA_84 1110256 : 1115976 6 Staphylococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP054616
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 565215 : 574440 7 Tetraselmis_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP054622
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054622_1 66496-66575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054622_2 136640-136765 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054622_3 167731-167972 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054622_1 1.1|66519|34|NZ_CP054622|CRISPRCasFinder 66519-66552 34 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 66519-66552 0 1.0
NZ_CP054622_1 1.1|66519|34|NZ_CP054622|CRISPRCasFinder 66519-66552 34 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 45596-45629 0 1.0
NZ_CP054622_2 2.1|136685|36|NZ_CP054622|CRISPRCasFinder 136685-136720 36 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 136685-136720 0 1.0
NZ_CP054622_2 2.1|136685|36|NZ_CP054622|CRISPRCasFinder 136685-136720 36 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 117501-117536 0 1.0
NZ_CP054622_3 3.2|167887|39|NZ_CP054622|CRISPRCasFinder 167887-167925 39 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 167887-167925 0 1.0
NZ_CP054622_3 3.2|167887|39|NZ_CP054622|CRISPRCasFinder 167887-167925 39 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 148703-148741 0 1.0
NZ_CP054622_3 3.1|167778|62|NZ_CP054622|CRISPRCasFinder 167778-167839 62 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 167778-167839 2 0.968
NZ_CP054622_3 3.1|167778|62|NZ_CP054622|CRISPRCasFinder 167778-167839 62 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 148594-148655 2 0.968

1. spacer 1.1|66519|34|NZ_CP054622|CRISPRCasFinder matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 0, identity: 1.0

aacgggtggacaagggcggtgcgcccgctcctct	CRISPR spacer
aacgggtggacaagggcggtgcgcccgctcctct	Protospacer
**********************************

2. spacer 1.1|66519|34|NZ_CP054622|CRISPRCasFinder matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 0, identity: 1.0

aacgggtggacaagggcggtgcgcccgctcctct	CRISPR spacer
aacgggtggacaagggcggtgcgcccgctcctct	Protospacer
**********************************

3. spacer 2.1|136685|36|NZ_CP054622|CRISPRCasFinder matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 0, identity: 1.0

ggggtccggctcggacaccgatgacagcgccgacga	CRISPR spacer
ggggtccggctcggacaccgatgacagcgccgacga	Protospacer
************************************

4. spacer 2.1|136685|36|NZ_CP054622|CRISPRCasFinder matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 0, identity: 1.0

ggggtccggctcggacaccgatgacagcgccgacga	CRISPR spacer
ggggtccggctcggacaccgatgacagcgccgacga	Protospacer
************************************

5. spacer 3.2|167887|39|NZ_CP054622|CRISPRCasFinder matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 0, identity: 1.0

gcccttgaatgtgctcgggggtagtgatagcgtggcttt	CRISPR spacer
gcccttgaatgtgctcgggggtagtgatagcgtggcttt	Protospacer
***************************************

6. spacer 3.2|167887|39|NZ_CP054622|CRISPRCasFinder matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 0, identity: 1.0

gcccttgaatgtgctcgggggtagtgatagcgtggcttt	CRISPR spacer
gcccttgaatgtgctcgggggtagtgatagcgtggcttt	Protospacer
***************************************

7. spacer 3.1|167778|62|NZ_CP054622|CRISPRCasFinder matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 2, identity: 0.968

atggtcgttcttgtgcagatgaccggaagaacaaccatacttcagatacattggtggttt	CRISPR spacer
atggtcgttcttgtgcagatgaccggaagaacaaccatacttcagatacattggtggttt	Protospacer
************************************************************

8. spacer 3.1|167778|62|NZ_CP054622|CRISPRCasFinder matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 2, identity: 0.968

atggtcgttcttgtgcagatgaccggaagaacaaccatacttcagatacattggtggttt	CRISPR spacer
atggtcgttcttgtgcagatgaccggaagaacaaccatacttcagatacattggtggttt	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 66448 49 Enterobacteria_phage(14.29%) transposase,integrase attL 27712:27729|attR 45866:45883
DBSCAN-SWA_2 70317 : 81193 13 Agrobacterium_phage(20.0%) NA NA
DBSCAN-SWA_3 99468 : 103197 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_4 128389 : 132183 6 Pseudoalteromonas_phage(33.33%) NA NA
DBSCAN-SWA_5 135650 : 137795 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_6 141349 : 142708 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_7 159944 : 204190 46 Wolbachia_phage(16.67%) transposase,integrase attL 150834:150851|attR 182850:182867
DBSCAN-SWA_8 214030 : 268274 52 Stx2-converting_phage(14.29%) transposase,integrase attL 232016:232033|attR 260211:260228
DBSCAN-SWA_9 277920 : 281838 4 uncultured_virus(50.0%) transposase NA
DBSCAN-SWA_10 286202 : 288602 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_11 298099 : 299964 2 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP054615
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054615_1 97027-97206 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP054615_1 1.1|97063|42|NZ_CP054615|PILER-CR 97063-97104 42 NZ_CP054615.1 97990-98031 1 0.976

1. spacer 1.1|97063|42|NZ_CP054615|PILER-CR matches to position: 97990-98031, mismatch: 1, identity: 0.976

tcggccggcacgaccctgctcgccaatctgctcgagacggtc	CRISPR spacer
tcggccggcacgaccctgctcgccaacctgctcgagacggtc	Protospacer
**************************.***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054615_1 1.1|97063|42|NZ_CP054615|PILER-CR 97063-97104 42 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 97051-97092 0 1.0
NZ_CP054615_1 1.2|97141|58|NZ_CP054615|PILER-CR 97141-97198 58 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 97113-97170 0 1.0
NZ_CP054615_1 1.1|97063|42|NZ_CP054615|PILER-CR 97063-97104 42 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 97990-98031 1 0.976
NZ_CP054615_1 1.2|97141|58|NZ_CP054615|PILER-CR 97141-97198 58 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 98052-98109 1 0.983

1. spacer 1.1|97063|42|NZ_CP054615|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcggccggcacgaccctgctcgccaatctgctcgagacggtc	CRISPR spacer
tcggccggcacgaccctgctcgccaatctgctcgagacggtc	Protospacer
******************************************

2. spacer 1.2|97141|58|NZ_CP054615|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggtgttcctcggcacggccggttcgacggtcgcggtgtcgggcatcgacatcctg	CRISPR spacer
gctggtgttcctcggcacggccggttcgacggtcgcggtgtcgggcatcgacatcctg	Protospacer
**********************************************************

3. spacer 1.1|97063|42|NZ_CP054615|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

tcggccggcacgaccctgctcgccaatctgctcgagacggtc	CRISPR spacer
tcggccggcacgaccctgctcgccaacctgctcgagacggtc	Protospacer
**************************.***************

4. spacer 1.2|97141|58|NZ_CP054615|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.983

gctggtgttcctcggcacggccggttcgacggtcgcggtgtcgggcatcgacatcctg	CRISPR spacer
actggtgttcctcggcacggccggttcgacggtcgcggtgtcgggcatcgacatcctg	Protospacer
.*********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 30222 23 Tupanvirus(13.33%) NA NA
DBSCAN-SWA_2 34642 : 36856 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 52609 : 56095 3 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_4 61257 : 61935 1 Aurantimonas_phage(100.0%) NA NA
DBSCAN-SWA_5 68811 : 82275 11 Tetraselmis_viridis_virus(12.5%) NA NA
DBSCAN-SWA_6 85327 : 86230 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 91241 : 93395 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_8 102709 : 104806 2 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_9 116926 : 119083 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_10 123927 : 124878 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_11 128557 : 131352 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_12 139161 : 141284 2 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_13 145950 : 148260 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_14 173840 : 174623 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_15 179348 : 180269 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_16 187862 : 190464 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_17 194230 : 195359 2 Arthrobacter_phage(50.0%) tail NA
DBSCAN-SWA_18 210336 : 223001 11 Bathycoccus_sp._RCC1105_virus(14.29%) NA NA
DBSCAN-SWA_19 226131 : 227313 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_20 235758 : 237465 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 248211 : 250452 2 Thermus_phage(50.0%) transposase NA
DBSCAN-SWA_22 260578 : 262942 1 Tokyovirus(100.0%) NA NA
DBSCAN-SWA_23 268012 : 268954 1 Thermus_phage(100.0%) NA NA
DBSCAN-SWA_24 275790 : 276855 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_25 281777 : 284033 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_26 290233 : 290824 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_27 295539 : 297779 2 Stenotrophomonas_phage(50.0%) NA NA
DBSCAN-SWA_28 308666 : 313060 3 Hokovirus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CP054620
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054620_1 39405-39493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054620_2 248665-248862 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054620_1 1.1|39428|43|NZ_CP054620|CRISPRCasFinder 39428-39470 43 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 39428-39470 0 1.0
NZ_CP054620_2 2.1|248683|26|NZ_CP054620|CRT 248683-248708 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248683-248708 0 1.0
NZ_CP054620_2 2.2|248727|27|NZ_CP054620|CRT 248727-248753 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248727-248753 0 1.0
NZ_CP054620_2 2.3|248772|26|NZ_CP054620|CRT 248772-248797 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248772-248797 0 1.0
NZ_CP054620_2 2.4|248816|29|NZ_CP054620|CRT 248816-248844 29 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248816-248844 0 1.0
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248683-248709 0 1.0
NZ_CP054620_2 2.6|248727|28|NZ_CP054620|PILER-CR 248727-248754 28 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248727-248754 0 1.0
NZ_CP054620_2 2.7|248772|27|NZ_CP054620|PILER-CR 248772-248798 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 248772-248798 0 1.0
NZ_CP054620_2 2.1|248683|26|NZ_CP054620|CRT 248683-248708 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 3536-3561 4 0.846
NZ_CP054620_2 2.1|248683|26|NZ_CP054620|CRT 248683-248708 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 693311-693336 4 0.846
NZ_CP054620_2 2.7|248772|27|NZ_CP054620|PILER-CR 248772-248798 27 MN657113 Psychrobacter sp. strain ANT_P52 plasmid pA52P5, complete sequence 7837-7863 4 0.852
NZ_CP054620_2 2.1|248683|26|NZ_CP054620|CRT 248683-248708 26 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 72316-72341 5 0.808
NZ_CP054620_2 2.4|248816|29|NZ_CP054620|CRT 248816-248844 29 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 382278-382306 5 0.828
NZ_CP054620_2 2.4|248816|29|NZ_CP054620|CRT 248816-248844 29 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 436866-436894 5 0.828
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 3535-3561 5 0.815
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 693310-693336 5 0.815
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NZ_CP014767 Pontibacter akesuensis strain AKS 1T plasmid Paks1, complete sequence 112629-112655 5 0.815
NZ_CP054620_2 2.1|248683|26|NZ_CP054620|CRT 248683-248708 26 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1511821-1511846 6 0.769
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 72316-72342 6 0.778
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 757493-757519 6 0.778
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 KY622015 Shewanella phage SppYZU01, complete genome 36250-36276 6 0.778
NZ_CP054620_2 2.5|248683|27|NZ_CP054620|PILER-CR 248683-248709 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1511820-1511846 7 0.741

1. spacer 1.1|39428|43|NZ_CP054620|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

acccgacgcctggccgcccttgtggccagcttcggctgcgcgc	CRISPR spacer
acccgacgcctggccgcccttgtggccagcttcggctgcgcgc	Protospacer
*******************************************

2. spacer 2.1|248683|26|NZ_CP054620|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacggcgatatgggccgcccggat	CRISPR spacer
ccgacggcgatatgggccgcccggat	Protospacer
**************************

3. spacer 2.2|248727|27|NZ_CP054620|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

cccggccgaaccgactcggcaagactc	CRISPR spacer
cccggccgaaccgactcggcaagactc	Protospacer
***************************

4. spacer 2.3|248772|26|NZ_CP054620|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gggcagttcagcggcggttctggggt	CRISPR spacer
gggcagttcagcggcggttctggggt	Protospacer
**************************

5. spacer 2.4|248816|29|NZ_CP054620|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

accggccccgaatcgactcgaccggccgt	CRISPR spacer
accggccccgaatcgactcgaccggccgt	Protospacer
*****************************

6. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacggcgatatgggccgcccggatt	CRISPR spacer
ccgacggcgatatgggccgcccggatt	Protospacer
***************************

7. spacer 2.6|248727|28|NZ_CP054620|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

cccggccgaaccgactcggcaagactcc	CRISPR spacer
cccggccgaaccgactcggcaagactcc	Protospacer
****************************

8. spacer 2.7|248772|27|NZ_CP054620|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gggcagttcagcggcggttctggggtt	CRISPR spacer
gggcagttcagcggcggttctggggtt	Protospacer
***************************

9. spacer 2.1|248683|26|NZ_CP054620|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

ccgacggcgatatgggccgcccggat	CRISPR spacer
gccagggcgatctgggccgcccggat	Protospacer
 * * ****** **************

10. spacer 2.1|248683|26|NZ_CP054620|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

ccgacggcgatatgggccgcccggat	CRISPR spacer
gccagggcgatctgggccgcccggat	Protospacer
 * * ****** **************

11. spacer 2.7|248772|27|NZ_CP054620|PILER-CR matches to MN657113 (Psychrobacter sp. strain ANT_P52 plasmid pA52P5, complete sequence) position: , mismatch: 4, identity: 0.852

gggcagttcagcggcggttctggggtt	CRISPR spacer
gtgtagttcagcgggggttttggggtt	Protospacer
* *.********** ****.*******

12. spacer 2.1|248683|26|NZ_CP054620|CRT matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 5, identity: 0.808

ccgacggcgatatgggccgcccggat	CRISPR spacer
cgagaggcgatatgggccgcgcggat	Protospacer
* .. *************** *****

13. spacer 2.4|248816|29|NZ_CP054620|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

accggccccgaatcgactcgaccggccgt	CRISPR spacer
gagggcccggaatcgactcgaccggccat	Protospacer
.  ***** ******************.*

14. spacer 2.4|248816|29|NZ_CP054620|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.828

accggccccgaatcgactcgaccggccgt	CRISPR spacer
gagggtccggaatcgactcgaccggccgt	Protospacer
.  **.** ********************

15. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

ccgacggcgatatgggccgcccggatt	CRISPR spacer
gccagggcgatctgggccgcccggatc	Protospacer
 * * ****** **************.

16. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

ccgacggcgatatgggccgcccggatt	CRISPR spacer
gccagggcgatctgggccgcccggatc	Protospacer
 * * ****** **************.

17. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NZ_CP014767 (Pontibacter akesuensis strain AKS 1T plasmid Paks1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgacggcgatatgggccgcccggatt	CRISPR spacer
tcatcggtgatgtgggccgcccggatt	Protospacer
.*. ***.***.***************

18. spacer 2.1|248683|26|NZ_CP054620|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.769

ccgacggcgatatgggccgcccggat	CRISPR spacer
ccgacggcgatatgcgccgccacatg	Protospacer
************** ******  .  

19. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.778

ccgacggcgatatgggccgcccggatt	CRISPR spacer
cgagaggcgatatgggccgcgcggatc	Protospacer
* .. *************** *****.

20. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.778

ccgacggcgatatgggccgcccggatt	CRISPR spacer
agcgcggcgagatggcccgcccggatt	Protospacer
   .****** **** ***********

21. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to KY622015 (Shewanella phage SppYZU01, complete genome) position: , mismatch: 6, identity: 0.778

ccgacggcgatatgggccgcccggatt	CRISPR spacer
atcagcgcgctatgggccgcccggatt	Protospacer
 . *  *** *****************

22. spacer 2.5|248683|27|NZ_CP054620|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.741

ccgacggcgatatgggccgcccggatt	CRISPR spacer
ccgacggcgatatgcgccgccacatga	Protospacer
************** ******  .   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage