Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046110 Enterococcus faecalis strain 133170041-3 plasmid pTEF2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 1 crisprs NA 0 4 0 0
NZ_CP046108 Enterococcus faecalis strain 133170041-3 chromosome, complete genome 3 crisprs csa3,cas3,DEDDh,DinG,cas14j,csn2,cas2,cas1,cas9 0 17 6 0

Results visualization

1. NZ_CP046108
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046108_1 1030698-1030811 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046108_2 1234036-1234336 Orphan II-A,II-B
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046108_3 2514314-2515141 TypeII II-A,II-B
12 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP041739 Enterococcus faecalis EnGen0107 strain B594 plasmid p1, complete sequence 39957-39986 0 1.0
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 37120-37149 0 1.0
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 53177-53206 0 1.0
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP041739 Enterococcus faecalis EnGen0107 strain B594 plasmid p1, complete sequence 39957-39985 0 1.0
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 37120-37148 0 1.0
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 53178-53206 0 1.0
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 26991-27020 0 1.0
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 GQ478085 Enterococcus phage phiFL2B, complete genome 14692-14721 0 1.0
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_013643 Enterococcus phage phiFL2A, complete genome 14103-14132 0 1.0
NZ_CP046108_3 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514746-2514775 30 GQ452243 Enterococcus phage phiEf11, complete genome 12574-12603 0 1.0
NZ_CP046108_3 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514746-2514775 30 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 11483-11512 0 1.0
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP022484 Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence 35711-35740 1 0.967
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 48629-48658 1 0.967
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP042217 Enterococcus faecalis strain L8 plasmid pL8, complete sequence 41683-41712 1 0.967
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_MK140641 Enterococcus faecalis strain E035 plasmid pE035, complete sequence 53005-53034 1 0.967
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP022484 Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence 35711-35739 1 0.966
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 48630-48658 1 0.966
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP042217 Enterococcus faecalis strain L8 plasmid pL8, complete sequence 41684-41712 1 0.966
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_MK140641 Enterococcus faecalis strain E035 plasmid pE035, complete sequence 53006-53034 1 0.966
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MK721187 Enterococcus phage vB_EfaS_Ef6.1, complete genome 27427-27456 1 0.967
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 GQ478087 Enterococcus phage phiFL3B, complete genome 15516-15545 1 0.967
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_013648 Enterococcus phage phiFL3A, complete genome 15210-15239 1 0.967
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 GQ452243 Enterococcus phage phiEf11, complete genome 39497-39526 1 0.967
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_028671 Enterococcus phage vB_EfaS_IME197, complete genome 39141-39170 1 0.967
NZ_CP046108_3 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514746-2514775 30 KJ608188 Enterococcus phage EFC-1, complete genome 28943-28972 1 0.967
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MT119359 Enterococcus phage heks, complete genome 31812-31841 2 0.933
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MK125140 Enterococcus phage Nonaheksakonda, complete genome 28370-28399 2 0.933
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 NC_042023 Enterococcus phage phiSHEF5, complete genome 14060-14089 2 0.933
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 GQ478082 Enterococcus phage phiFL1B, complete genome 14692-14721 2 0.933
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 GQ478083 Enterococcus phage phiFL1C, complete genome 14426-14455 2 0.933
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_013646 Enterococcus phage phiFL1A, complete genome 14445-14474 2 0.933
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP015884 Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence 44693-44722 3 0.9
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP015884 Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence 44693-44721 3 0.897
NZ_CP046108_2 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder 1234271-1234299 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 726854-726882 5 0.828
NZ_CP046108_2 2.8|1234270|30|NZ_CP046108|CRT 1234270-1234299 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 726854-726883 5 0.833
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MH375074 Enterococcus phage LY0323, complete genome 11789-11818 5 0.833
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 MK982307 Enterococcus phage MSF2, complete genome 33836-33865 5 0.833
NZ_CP046108_3 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT 2514482-2514511 30 KX284704 Enterococcus phage SANTOR1, complete genome 25134-25163 5 0.833
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP023544 Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence 42911-42939 6 0.793
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP017872 Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence 31018-31046 6 0.793
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NC_022355 Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence 42878-42906 6 0.793
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP045793 Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence 32830-32858 6 0.793
NZ_CP046108_2 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder 1234139-1234167 29 NZ_CP023546 Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence 33401-33429 6 0.793
NZ_CP046108_2 2.8|1234270|30|NZ_CP046108|CRT 1234270-1234299 30 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 41998-42027 6 0.8
NZ_CP046108_2 2.8|1234270|30|NZ_CP046108|CRT 1234270-1234299 30 MT708547 Klebsiella phage Muenster, complete genome 164106-164135 6 0.8
NZ_CP046108_2 2.8|1234270|30|NZ_CP046108|CRT 1234270-1234299 30 AB897757 Klebsiella phage K64-1 DNA, complete genome 42006-42035 6 0.8
NZ_CP046108_3 3.1|2514350|30|NZ_CP046108|CRISPRCasFinder,CRT 2514350-2514379 30 MK867354 Synechococcus phage S-SCSM1, complete genome 151260-151289 6 0.8
NZ_CP046108_3 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT 2514680-2514709 30 NZ_KJ776578 Clostridium botulinum strain CDC3875 plasmid pCDC3875, complete sequence 26197-26226 6 0.8
NZ_CP046108_3 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT 2514680-2514709 30 NZ_KJ776580 Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence 31008-31037 6 0.8
NZ_CP046108_2 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT 1234072-1234101 30 NC_019534 Bacteroides fragilis plasmid pBFUK1, complete sequence 7141-7170 7 0.767
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP023544 Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence 42911-42940 7 0.767
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP017872 Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence 31018-31047 7 0.767
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NC_022355 Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence 42878-42907 7 0.767
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP045793 Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence 32829-32858 7 0.767
NZ_CP046108_2 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT 1234138-1234167 30 NZ_CP023546 Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence 33400-33429 7 0.767
NZ_CP046108_2 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder 1234073-1234101 29 NC_019534 Bacteroides fragilis plasmid pBFUK1, complete sequence 7142-7170 7 0.759
NZ_CP046108_2 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder 1234073-1234101 29 NZ_CP034946 Enterococcus faecium strain NM213 plasmid unnamed3, complete sequence 4704-4732 7 0.759
NZ_CP046108_2 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder 1234073-1234101 29 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 95957-95985 7 0.759
NZ_CP046108_2 2.6|1234205|29|NZ_CP046108|CRISPRCasFinder 1234205-1234233 29 NC_009453 Arthrobacter sp. Rue61a plasmid pAL1, complete sequence 17952-17980 7 0.759
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 MH179477 Aeromonas phage 60AhydR15PP, complete genome 151274-151303 7 0.767
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_014635 Aeromonas phage phiAS4, complete genome 51356-51385 7 0.767
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NC_020879 Aeromonas phage Aes012, complete genome 116920-116949 7 0.767
NZ_CP046108_3 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT 2514548-2514577 30 NZ_CP025802 Yersinia ruckeri strain SC09 plasmid pLT, complete sequence 26191-26220 7 0.767
NZ_CP046108_3 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT 2514680-2514709 30 NZ_CP014218 Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence 9126-9155 7 0.767
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 GQ478087 Enterococcus phage phiFL3B, complete genome 31016-31045 7 0.767
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_013648 Enterococcus phage phiFL3A, complete genome 30317-30346 7 0.767
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_AP017969 Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-1, complete sequence 56397-56426 7 0.767
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 MH319764 Marine virus AG-345-P14 Ga0172274_11 genomic sequence 36540-36569 7 0.767
NZ_CP046108_3 3.12|2515076|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515076-2515105 30 MN694628 Marine virus AFVG_250M527, complete genome 27249-27278 7 0.767
NZ_CP046108_3 3.12|2515076|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515076-2515105 30 MN856107 Bacteriophage sp. isolate 216, complete genome 5132-5161 7 0.767
NZ_CP046108_2 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT 1234072-1234101 30 NZ_CP034946 Enterococcus faecium strain NM213 plasmid unnamed3, complete sequence 4703-4732 8 0.733
NZ_CP046108_2 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT 1234072-1234101 30 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 95957-95986 8 0.733
NZ_CP046108_2 2.3|1234204|30|NZ_CP046108|PILER-CR,CRT 1234204-1234233 30 NC_009453 Arthrobacter sp. Rue61a plasmid pAL1, complete sequence 17952-17981 8 0.733
NZ_CP046108_2 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder 1234271-1234299 29 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 41999-42027 8 0.724
NZ_CP046108_2 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder 1234271-1234299 29 MT708547 Klebsiella phage Muenster, complete genome 164107-164135 8 0.724
NZ_CP046108_2 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder 1234271-1234299 29 AB897757 Klebsiella phage K64-1 DNA, complete genome 42007-42035 8 0.724
NZ_CP046108_3 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT 2514416-2514445 30 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 690478-690507 8 0.733
NZ_CP046108_3 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT 2514416-2514445 30 NZ_CP045361 Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence 103642-103671 8 0.733
NZ_CP046108_3 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT 2514416-2514445 30 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 226475-226504 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP009119 Borreliella valaisiana Tom4006 plasmid lp54, complete sequence 48414-48443 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP028862 Borreliella garinii strain 20047 plasmid lp54, complete sequence 48678-48707 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 48096-48125 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP009214 Borreliella afzelii Tom3107 plasmid lp54, complete sequence 49892-49921 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_017804 Borreliella garinii BgVir plasmid lp54, complete sequence 49679-49708 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP009059 Borreliella afzelii K78 plasmid lp54, complete sequence 8378-8407 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP018745 Borreliella garinii strain CIP 103362 isolate 20047 plasmid p_lp54_linear 8781-8810 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_015919 Borreliella bissettii DN127 plasmid lp54, complete sequence 5660-5689 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 5776-5805 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 CP009912 Borreliella chilensis strain VA1 plasmid lp54, complete sequence 7485-7514 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 5632-5661 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 5632-5661 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP015809 Borrelia mayonii strain MN14-1539 plasmid lp54 6195-6224 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 5588-5617 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 5626-5655 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NZ_CP015795 Borrelia mayonii strain MN14-1420 plasmid lp54, complete sequence 6195-6224 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_013128 Borrelia burgdorferi 297 plasmid 297_lp54, complete sequence 3341-3370 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 5617-5646 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_006129 Borreliella bavariensis PBi plasmid lp54, complete sequence 5944-5973 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_017241 Borreliella afzelii PKo plasmid lp54, complete sequence 8242-8271 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 5632-5661 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 LN681539 Clostridium phage phiCD505, complete genome 16679-16708 8 0.733
NZ_CP046108_3 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2515010-2515039 30 NC_048642 Clostridium phage CDKM9, complete genome 16617-16646 8 0.733
NZ_CP046108_3 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT 2514416-2514445 30 NZ_CP042333 Bosea sp. F3-2 plasmid pB32-2, complete sequence 30149-30178 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KY463452 Escherichia coli strain WCHEC050622 plasmid pMCR_WCHEC1622, complete sequence 22118-22147 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KP324830 Escherichia coli isolate FP671 plasmid pHNFP671, complete sequence 40200-40229 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP035638 Enterobacter cloacae strain EN3600 plasmid unnamed6, complete sequence 49341-49370 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 MN542377 Klebsiella pneumoniae subsp. pneumoniae strain 494 plasmid pKPC2_sg1, complete sequence 66385-66414 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 MN542378 Klebsiella pneumoniae subsp. pneumoniae strain 607 plasmid pKPC2_sg2, complete sequence 66385-66414 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 LC549805 Escherichia coli VNCEc117 plasmid pVNCEc117 DNA, complete sequence 44992-45021 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP033354 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-2, complete sequence 3011-3040 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP032987 Escherichia coli strain BE2-5 plasmid pMCR_BE2-5, complete sequence 41525-41554 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP025711 Escherichia coli strain YDC107 plasmid pYDC107_41, complete sequence 2179-2208 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP035195 Klebsiella pneumoniae strain LH102-A plasmid pLH102-A, complete sequence 20709-20738 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP045957 Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010527 plasmid pAUSMDU00010527, complete sequence 2179-2208 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MF978389 Escherichia coli strain GDT6F36 plasmid pHNGDF36-1, complete sequence 8704-8733 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MF990207 Escherichia coli strain GDP6F1 plasmid pHNGDF1-1, complete sequence 3788-3817 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MF678351 Escherichia coli strain WCHEC025943 plasmid pMCR3_WCHEC1943, complete sequence 31703-31732 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MF136778 Escherichia coli strain HKSHmcr1_P2_EC plasmid pHKSHmcr1_P2_p1, complete sequence 16403-16432 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KX580713 Escherichia coli strain ZJ623 plasmid unnamed, complete sequence 5629-5658 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KY352406 Salmonella enterica subsp. enterica serovar Typhimurium strain YL14P053 plasmid pMCR16_P053, complete sequence 31390-31419 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NC_022650 Escherichia coli JJ1886 plasmid pJJ1886_4, complete sequence 17317-17346 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KX377410 Klebsiella pneumoniae strain WCHKP1511 plasmid pMCR_1511, complete sequence 35827-35856 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 67651-67680 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP042602 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-3_MCR3, complete sequence 3548-3577 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP030221 Salmonella enterica strain SA20021456 plasmid pSA20021456.2, complete sequence 16247-16276 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP024128 Escherichia coli strain 14EC001 plasmid p14EC001a, complete sequence 45705-45734 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP044383 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence 47828-47857 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP051225 Escherichia coli strain SCZE5 plasmid pSCZE3 4106-4135 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NC_023907 Escherichia coli strain HS102707 plasmid pHS102707, complete sequence 7091-7120 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_AP021897 Escherichia coli strain 2018-02-2CC plasmid p2018_02_02CC, complete sequence 19697-19726 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MH043623 Escherichia coli strain GDZJ002 plasmid pGDZJ002-1, complete sequence 29280-29309 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MH043626 Escherichia coli strain GDZJ004 plasmid pGDZJ004, complete sequence 29086-29115 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MG552133 Escherichia coli strain ECSC102 plasmid pECSC102, complete sequence 27121-27150 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MF489760 Escherichia coli strain WCHEC-LL123 plasmid pMCR3_WCHEC-LL123, complete sequence 29088-29117 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_MH043625 Escherichia coli strain GDZJ003 plasmid pGDZJ003-1-MCR-3, complete sequence 29097-29126 9 0.7
NZ_CP046108_3 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR 2514812-2514841 30 NZ_CP027203 Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence 16830-16859 9 0.7

1. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP041739 (Enterococcus faecalis EnGen0107 strain B594 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttctcc	Protospacer
******************************

2. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttctcc	Protospacer
******************************

3. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttctcc	Protospacer
******************************

4. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP041739 (Enterococcus faecalis EnGen0107 strain B594 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttctcc	Protospacer
*****************************

5. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttctcc	Protospacer
*****************************

6. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttctcc	Protospacer
*****************************

7. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 0, identity: 1.0

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
gaaacttgatgtgctacacctttagcccca	Protospacer
******************************

8. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to GQ478085 (Enterococcus phage phiFL2B, complete genome) position: , mismatch: 0, identity: 1.0

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagcgttgtgtaatgtgtccatttcttt	Protospacer
******************************

9. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_013643 (Enterococcus phage phiFL2A, complete genome) position: , mismatch: 0, identity: 1.0

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagcgttgtgtaatgtgtccatttcttt	Protospacer
******************************

10. spacer 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to GQ452243 (Enterococcus phage phiEf11, complete genome) position: , mismatch: 0, identity: 1.0

caacaatttccaccatacgttttttctcgc	CRISPR spacer
caacaatttccaccatacgttttttctcgc	Protospacer
******************************

11. spacer 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 0, identity: 1.0

caacaatttccaccatacgttttttctcgc	CRISPR spacer
caacaatttccaccatacgttttttctcgc	Protospacer
******************************

12. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP022484 (Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence) position: , mismatch: 1, identity: 0.967

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttcttc	Protospacer
****************************.*

13. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.967

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttcttc	Protospacer
****************************.*

14. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 1, identity: 0.967

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttcttc	Protospacer
****************************.*

15. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 1, identity: 0.967

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgtcaaaacagcagctacatttcttc	Protospacer
****************************.*

16. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP022484 (Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence) position: , mismatch: 1, identity: 0.966

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttcttc	Protospacer
***************************.*

17. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.966

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttcttc	Protospacer
***************************.*

18. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 1, identity: 0.966

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttcttc	Protospacer
***************************.*

19. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 1, identity: 0.966

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgtcaaaacagcagctacatttcttc	Protospacer
***************************.*

20. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MK721187 (Enterococcus phage vB_EfaS_Ef6.1, complete genome) position: , mismatch: 1, identity: 0.967

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
gaaacttgatatgctacacctttagcccca	Protospacer
**********.*******************

21. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to GQ478087 (Enterococcus phage phiFL3B, complete genome) position: , mismatch: 1, identity: 0.967

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtccatttcttt	Protospacer
*****.************************

22. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_013648 (Enterococcus phage phiFL3A, complete genome) position: , mismatch: 1, identity: 0.967

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtccatttcttt	Protospacer
*****.************************

23. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to GQ452243 (Enterococcus phage phiEf11, complete genome) position: , mismatch: 1, identity: 0.967

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtccatttcttt	Protospacer
*****.************************

24. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 1, identity: 0.967

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtccatttcttt	Protospacer
*****.************************

25. spacer 3.7|2514746|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to KJ608188 (Enterococcus phage EFC-1, complete genome) position: , mismatch: 1, identity: 0.967

caacaatttccaccatacgttttttctcgc	CRISPR spacer
ctacaatttccaccatacgttttttctcgc	Protospacer
* ****************************

26. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MT119359 (Enterococcus phage heks, complete genome) position: , mismatch: 2, identity: 0.933

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
gaaatttgatatgctacacctttagcccca	Protospacer
****.*****.*******************

27. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MK125140 (Enterococcus phage Nonaheksakonda, complete genome) position: , mismatch: 2, identity: 0.933

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
gaaatttgatatgctacacctttagcccca	Protospacer
****.*****.*******************

28. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_042023 (Enterococcus phage phiSHEF5, complete genome) position: , mismatch: 2, identity: 0.933

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
gaaatttgatgtgctacacctttaacccca	Protospacer
****.*******************.*****

29. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to GQ478082 (Enterococcus phage phiFL1B, complete genome) position: , mismatch: 2, identity: 0.933

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtctatttcttt	Protospacer
*****.***************.********

30. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to GQ478083 (Enterococcus phage phiFL1C, complete genome) position: , mismatch: 2, identity: 0.933

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtctatttcttt	Protospacer
*****.***************.********

31. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_013646 (Enterococcus phage phiFL1A, complete genome) position: , mismatch: 2, identity: 0.933

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
gaaagtgttgtgtaatgtgtctatttcttt	Protospacer
*****.***************.********

32. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP015884 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence) position: , mismatch: 3, identity: 0.9

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
ctaatgttaaaacagcagctacctttcttc	Protospacer
*******.************** *****.*

33. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP015884 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence) position: , mismatch: 3, identity: 0.897

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
taatgttaaaacagcagctacctttcttc	Protospacer
******.************** *****.*

34. spacer 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 5, identity: 0.828

caagaaattgcattaagttcaaaaaattt	CRISPR spacer
aatgtaattgcattaagagcaaaaaattt	Protospacer
 * * ************  **********

35. spacer 2.8|1234270|30|NZ_CP046108|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 5, identity: 0.833

tcaagaaattgcattaagttcaaaaaattt	CRISPR spacer
taatgtaattgcattaagagcaaaaaattt	Protospacer
* * * ************  **********

36. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MH375074 (Enterococcus phage LY0323, complete genome) position: , mismatch: 5, identity: 0.833

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
tccattttatgtgctacacctttagcccca	Protospacer
   *.** **********************

37. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 5, identity: 0.833

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
tccattttatgtgctacacctttagcccca	Protospacer
   *.** **********************

38. spacer 3.3|2514482|30|NZ_CP046108|CRISPRCasFinder,CRT matches to KX284704 (Enterococcus phage SANTOR1, complete genome) position: , mismatch: 5, identity: 0.833

gaaacttgatgtgctacacctttagcccca	CRISPR spacer
tccattttatgtgctacacctttagcccca	Protospacer
   *.** **********************

39. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 6, identity: 0.793

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
aagcatcaaaacagcagctacacttttcc	Protospacer
 *...*****************.**.***

40. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 6, identity: 0.793

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
aagcatcaaaacagcagctacacttttcc	Protospacer
 *...*****************.**.***

41. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 6, identity: 0.793

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
aagcatcaaaacagcagctacacttttcc	Protospacer
 *...*****************.**.***

42. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 6, identity: 0.793

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
aagcatcaaaacagcagctacacttttcc	Protospacer
 *...*****************.**.***

43. spacer 2.5|1234139|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 6, identity: 0.793

taatgtcaaaacagcagctacatttctcc	CRISPR spacer
aagcatcaaaacagcagctacacttttcc	Protospacer
 *...*****************.**.***

44. spacer 2.8|1234270|30|NZ_CP046108|CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 6, identity: 0.8

tcaagaa--attgcattaagttcaaaaaattt	CRISPR spacer
--aacgattatggcattacgttcaaaaaattt	Protospacer
  ** .*  ** ****** *************

45. spacer 2.8|1234270|30|NZ_CP046108|CRT matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 6, identity: 0.8

tcaagaa--attgcattaagttcaaaaaattt	CRISPR spacer
--aacgattatggcattacgttcaaaaaattt	Protospacer
  ** .*  ** ****** *************

46. spacer 2.8|1234270|30|NZ_CP046108|CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 6, identity: 0.8

tcaagaa--attgcattaagttcaaaaaattt	CRISPR spacer
--aacgattatggcattacgttcaaaaaattt	Protospacer
  ** .*  ** ****** *************

47. spacer 3.1|2514350|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MK867354 (Synechococcus phage S-SCSM1, complete genome) position: , mismatch: 6, identity: 0.8

atatgtaaatcataatgagcatttacattg	CRISPR spacer
atatggaaatcataatgaggattttccatc	Protospacer
***** ************* **** *  * 

48. spacer 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_KJ776578 (Clostridium botulinum strain CDC3875 plasmid pCDC3875, complete sequence) position: , mismatch: 6, identity: 0.8

atttcaccttctgttttagaagctgcttta--	CRISPR spacer
atttcaccttgtgttttagaaa--acttcatt	Protospacer
********** **********.  .***.*  

49. spacer 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_KJ776580 (Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence) position: , mismatch: 6, identity: 0.8

atttcaccttctgttttagaagctgcttta--	CRISPR spacer
atttcaccttgtgttttagaaa--acttcatt	Protospacer
********** **********.  .***.*  

50. spacer 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT matches to NC_019534 (Bacteroides fragilis plasmid pBFUK1, complete sequence) position: , mismatch: 7, identity: 0.767

cacttcccaaatagaaaggacgatgaaaca	CRISPR spacer
ccacgccaaaaaagaaaggacgatgaaacg	Protospacer
*  . ** *** *****************.

51. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
aaagcatcaaaacagcagctacacttttcc	Protospacer
  *...*****************.**.***

52. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
aaagcatcaaaacagcagctacacttttcc	Protospacer
  *...*****************.**.***

53. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
aaagcatcaaaacagcagctacacttttcc	Protospacer
  *...*****************.**.***

54. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
aaagcatcaaaacagcagctacacttttcc	Protospacer
  *...*****************.**.***

55. spacer 2.2|1234138|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767

ctaatgtcaaaacagcagctacatttctcc	CRISPR spacer
aaagcatcaaaacagcagctacacttttcc	Protospacer
  *...*****************.**.***

56. spacer 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder matches to NC_019534 (Bacteroides fragilis plasmid pBFUK1, complete sequence) position: , mismatch: 7, identity: 0.759

acttcccaaatagaaaggacgatgaaaca	CRISPR spacer
cacgccaaaaaagaaaggacgatgaaacg	Protospacer
  . ** *** *****************.

57. spacer 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder matches to NZ_CP034946 (Enterococcus faecium strain NM213 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

acttcccaaatagaaaggacgatgaaaca	CRISPR spacer
tgtaaaaaaatagaaaggacgataaaaca	Protospacer
  *    ****************.*****

58. spacer 2.4|1234073|29|NZ_CP046108|CRISPRCasFinder matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 7, identity: 0.759

acttcccaaatagaaaggacgatgaaaca	CRISPR spacer
aaaacacaaatagaaaggccgatgaaagc	Protospacer
*   * ************ ********  

59. spacer 2.6|1234205|29|NZ_CP046108|CRISPRCasFinder matches to NC_009453 (Arthrobacter sp. Rue61a plasmid pAL1, complete sequence) position: , mismatch: 7, identity: 0.759

gggttgactaaagagccgtcaaaagtttt	CRISPR spacer
cggttgacttcagagccgtcaaaaaatgc	Protospacer
 ********  *************. * .

60. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 7, identity: 0.767

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
tggagcgttgtgaaatttgtccatttcata	Protospacer
 ..********* *** ********** * 

61. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 7, identity: 0.767

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
tggagcgttgtgaaatttgtccatttcata	Protospacer
 ..********* *** ********** * 

62. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NC_020879 (Aeromonas phage Aes012, complete genome) position: , mismatch: 7, identity: 0.767

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
tggagcgttgtgaaatttgtccatttcata	Protospacer
 ..********* *** ********** * 

63. spacer 3.4|2514548|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_CP025802 (Yersinia ruckeri strain SC09 plasmid pLT, complete sequence) position: , mismatch: 7, identity: 0.767

gaaagcgttgtgtaatgtgtccatttcttt	CRISPR spacer
tagctctttgcgtaacgtgtccatttcttt	Protospacer
 *.  * ***.****.**************

64. spacer 3.6|2514680|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_CP014218 (Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence) position: , mismatch: 7, identity: 0.767

atttcaccttctgttttagaagctgcttta	CRISPR spacer
cttgatacttctcttttataagctgcttta	Protospacer
 **    ***** ***** ***********

65. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to GQ478087 (Enterococcus phage phiFL3B, complete genome) position: , mismatch: 7, identity: 0.767

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
agaaatctatactaatatttttaagacaat	Protospacer
***** ******* **********..  .*

66. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_013648 (Enterococcus phage phiFL3A, complete genome) position: , mismatch: 7, identity: 0.767

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
agaaatctatactaatatttttaagacaat	Protospacer
***** ******* **********..  .*

67. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017969 (Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-1, complete sequence) position: , mismatch: 7, identity: 0.767

agaaaactatactcatatttttaa-aggtgt	CRISPR spacer
tgataactataatcatatttttaataaata-	Protospacer
 ** ******* ************ *..*. 

68. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to MH319764 (Marine virus AG-345-P14 Ga0172274_11 genomic sequence) position: , mismatch: 7, identity: 0.767

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
ataaaaatatactcatatttataaaaaagg	Protospacer
* **** ************* ****.. * 

69. spacer 3.12|2515076|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to MN694628 (Marine virus AFVG_250M527, complete genome) position: , mismatch: 7, identity: 0.767

gataacttagaaaagatgcaggatgttttt	CRISPR spacer
aacaacttagaaaagatgaagaatgttcag	Protospacer
.*.*************** **.*****.  

70. spacer 3.12|2515076|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to MN856107 (Bacteriophage sp. isolate 216, complete genome) position: , mismatch: 7, identity: 0.767

gataacttagaaaagatgcaggatgttttt----	CRISPR spacer
gatatcttagaaaagatgca----gttatccaga	Protospacer
**** ***************    *** *.    

71. spacer 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT matches to NZ_CP034946 (Enterococcus faecium strain NM213 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

cacttcccaaatagaaaggacgatgaaaca	CRISPR spacer
atgtaaaaaaatagaaaggacgataaaaca	Protospacer
   *    ****************.*****

72. spacer 2.1|1234072|30|NZ_CP046108|PILER-CR,CRT matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 8, identity: 0.733

cacttcccaaatagaaaggacgatgaaaca	CRISPR spacer
taaaacacaaatagaaaggccgatgaaagc	Protospacer
.*   * ************ ********  

73. spacer 2.3|1234204|30|NZ_CP046108|PILER-CR,CRT matches to NC_009453 (Arthrobacter sp. Rue61a plasmid pAL1, complete sequence) position: , mismatch: 8, identity: 0.733

tgggttgactaaagagccgtcaaaagtttt	CRISPR spacer
acggttgacttcagagccgtcaaaaaatgc	Protospacer
  ********  *************. * .

74. spacer 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.724

caagaaattgcattaagttcaaaaaattt	CRISPR spacer
acgattatggcattacgttcaaaaaattt	Protospacer
  ..  ** ****** *************

75. spacer 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 8, identity: 0.724

caagaaattgcattaagttcaaaaaattt	CRISPR spacer
acgattatggcattacgttcaaaaaattt	Protospacer
  ..  ** ****** *************

76. spacer 2.7|1234271|29|NZ_CP046108|CRISPRCasFinder matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.724

caagaaattgcattaagttcaaaaaattt	CRISPR spacer
acgattatggcattacgttcaaaaaattt	Protospacer
  ..  ** ****** *************

77. spacer 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.733

caagcgatggagcaggttggtctgctatga	CRISPR spacer
ggagcgatggagcacgatggtctgcaccgc	Protospacer
 .************ * ********  .* 

78. spacer 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 8, identity: 0.733

caagcgatggagcaggttggtctgctatga	CRISPR spacer
taagcgatggcgcaggttggtcaggccgca	Protospacer
.********* *********** * .   *

79. spacer 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 8, identity: 0.733

caagcgatggagcaggttggtctgctatga	CRISPR spacer
taagcgatggcgcaggttggtcaggccgca	Protospacer
.********* *********** * .   *

80. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009119 (Borreliella valaisiana Tom4006 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

81. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028862 (Borreliella garinii strain 20047 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

82. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

83. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009214 (Borreliella afzelii Tom3107 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

84. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_017804 (Borreliella garinii BgVir plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

85. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009059 (Borreliella afzelii K78 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

86. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018745 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid p_lp54_linear) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

87. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

88. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

89. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to CP009912 (Borreliella chilensis strain VA1 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

90. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

91. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

92. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015809 (Borrelia mayonii strain MN14-1539 plasmid lp54) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

93. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

94. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

95. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015795 (Borrelia mayonii strain MN14-1420 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

96. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_013128 (Borrelia burgdorferi 297 plasmid 297_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

97. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

98. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_006129 (Borreliella bavariensis PBi plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

99. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_017241 (Borreliella afzelii PKo plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

100. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
caaaaattatactcatattttaaaatccat	Protospacer
 .****.************** ***  ..*

101. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
ttaagattatactcatatttttaaatcttc	Protospacer
  **.*.******************  * .

102. spacer 3.11|2515010|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 8, identity: 0.733

agaaaactatactcatatttttaaaggtgt	CRISPR spacer
ttaagattatactcatatttttaaatcttc	Protospacer
  **.*.******************  * .

103. spacer 3.2|2514416|30|NZ_CP046108|CRISPRCasFinder,CRT matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 9, identity: 0.7

caagcgatggagcaggttggtctgctatga	CRISPR spacer
ggggcgttggagcaggttgggctgctggcc	Protospacer
 ..*** ************* *****.   

104. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY463452 (Escherichia coli strain WCHEC050622 plasmid pMCR_WCHEC1622, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

105. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP324830 (Escherichia coli isolate FP671 plasmid pHNFP671, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

106. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035638 (Enterobacter cloacae strain EN3600 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

107. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to MN542377 (Klebsiella pneumoniae subsp. pneumoniae strain 494 plasmid pKPC2_sg1, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

108. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to MN542378 (Klebsiella pneumoniae subsp. pneumoniae strain 607 plasmid pKPC2_sg2, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

109. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to LC549805 (Escherichia coli VNCEc117 plasmid pVNCEc117 DNA, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

110. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033354 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-2, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

111. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032987 (Escherichia coli strain BE2-5 plasmid pMCR_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

112. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025711 (Escherichia coli strain YDC107 plasmid pYDC107_41, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

113. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035195 (Klebsiella pneumoniae strain LH102-A plasmid pLH102-A, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

114. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045957 (Salmonella enterica subsp. enterica serovar Enteritidis strain AUSMDU00010527 plasmid pAUSMDU00010527, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

115. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF978389 (Escherichia coli strain GDT6F36 plasmid pHNGDF36-1, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

116. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF990207 (Escherichia coli strain GDP6F1 plasmid pHNGDF1-1, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

117. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF678351 (Escherichia coli strain WCHEC025943 plasmid pMCR3_WCHEC1943, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

118. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF136778 (Escherichia coli strain HKSHmcr1_P2_EC plasmid pHKSHmcr1_P2_p1, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

119. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX580713 (Escherichia coli strain ZJ623 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

120. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY352406 (Salmonella enterica subsp. enterica serovar Typhimurium strain YL14P053 plasmid pMCR16_P053, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

121. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_022650 (Escherichia coli JJ1886 plasmid pJJ1886_4, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

122. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX377410 (Klebsiella pneumoniae strain WCHKP1511 plasmid pMCR_1511, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

123. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

124. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042602 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-3_MCR3, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

125. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030221 (Salmonella enterica strain SA20021456 plasmid pSA20021456.2, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

126. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024128 (Escherichia coli strain 14EC001 plasmid p14EC001a, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

127. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044383 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-3_MCR3, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

128. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051225 (Escherichia coli strain SCZE5 plasmid pSCZE3) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

129. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NC_023907 (Escherichia coli strain HS102707 plasmid pHS102707, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

130. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP021897 (Escherichia coli strain 2018-02-2CC plasmid p2018_02_02CC, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

131. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043623 (Escherichia coli strain GDZJ002 plasmid pGDZJ002-1, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

132. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043626 (Escherichia coli strain GDZJ004 plasmid pGDZJ004, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

133. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG552133 (Escherichia coli strain ECSC102 plasmid pECSC102, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

134. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF489760 (Escherichia coli strain WCHEC-LL123 plasmid pMCR3_WCHEC-LL123, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

135. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH043625 (Escherichia coli strain GDZJ003 plasmid pGDZJ003-1-MCR-3, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

136. spacer 3.8|2514812|30|NZ_CP046108|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027203 (Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence) position: , mismatch: 9, identity: 0.7

gcatatcaagcgcactacttaaatgaaaac	CRISPR spacer
ttttatccagcgcactacttaaatattggc	Protospacer
 . **** ****************.  ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 723377 : 733116 11 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_2 1226491 : 1292097 69 Enterococcus_phage(34.38%) tail,transposase,portal,capsid,integrase,holin,terminase,head,tRNA attL 1252242:1252257|attR 1258627:1258642
DBSCAN-SWA_3 1878463 : 1896234 18 Enterococcus_phage(46.15%) tail,holin NA
DBSCAN-SWA_4 2253315 : 2261233 11 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_5 2558241 : 2625825 60 Staphylococcus_phage(27.27%) tRNA,transposase NA
DBSCAN-SWA_6 2875894 : 2893416 19 Streptococcus_phage(100.0%) integrase attL 2875444:2875458|attR 2878047:2878061
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP046109
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046109_1 426-557 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 548-578 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 461-491 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33655-33685 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 449-479 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5472-5502 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43942-43972 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83451-83481 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4997-5027 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 773-803 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7642-7672 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66170-66200 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12175-12205 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60905-60935 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92753-92783 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43888-43918 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4943-4973 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5073-5103 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 602-632 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 515-545 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33709-33739 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 503-533 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 503-533 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5526-5556 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83505-83535 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9536-9566 0 1.0
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 827-857 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43945-43971 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 5000-5026 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 549-575 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 462-488 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33656-33682 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 450-476 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5473-5499 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83452-83478 0 1.0
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 774-800 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7645-7671 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66173-66199 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12178-12204 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60908-60934 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92756-92782 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43891-43917 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4946-4972 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5074-5100 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 603-629 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 516-542 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33710-33736 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 504-530 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 504-530 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5527-5553 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83506-83532 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9537-9563 0 1.0
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 828-854 0 1.0
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7696-7726 1 0.968
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12229-12259 1 0.968
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60959-60989 1 0.968
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92807-92837 1 0.968
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 748-778 1 0.968
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7699-7725 1 0.963
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66227-66253 1 0.963
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12232-12258 1 0.963
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60962-60988 1 0.963
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92810-92836 1 0.963
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 450-476 1 0.963
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 749-775 1 0.963
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66224-66254 2 0.935
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 449-479 2 0.935
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5019-5049 2 0.935
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 694-724 2 0.935
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9482-9512 2 0.935
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5020-5046 2 0.926
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 695-721 2 0.926
NZ_CP046109_1 1.3|456|27|NZ_CP046109|PILER-CR 456-482 27 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9483-9509 2 0.926
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 MT711976 Streptomyces phage Coruscant, complete genome 87403-87429 5 0.815
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 31964-31990 5 0.815
NZ_CP046109_1 1.4|510|27|NZ_CP046109|PILER-CR 510-536 27 JQ660954 Clostridium phage PhiS63, complete genome 22891-22917 6 0.778
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 31963-31993 7 0.774
NZ_CP046109_1 1.1|449|31|NZ_CP046109|CRISPRCasFinder 449-479 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 586541-586571 8 0.742
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 MT711976 Streptomyces phage Coruscant, complete genome 87400-87430 8 0.742
NZ_CP046109_1 1.2|503|31|NZ_CP046109|CRISPRCasFinder 503-533 31 JQ660954 Clostridium phage PhiS63, complete genome 22890-22920 10 0.677

1. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

2. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

3. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

4. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

5. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

6. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

7. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

8. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

9. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

10. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

11. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

12. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

13. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

14. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

15. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

16. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

17. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

18. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

19. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

20. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

21. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

22. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

23. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

24. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

25. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

26. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

27. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

28. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

29. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

30. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

31. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

32. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

33. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

34. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

35. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

36. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

37. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

38. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

39. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

40. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

41. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

42. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

43. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

44. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

45. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

46. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

47. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

48. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

49. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

50. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

51. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

52. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

53. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

54. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

55. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

56. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

57. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.968

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccaggacttt	Protospacer
************************* *****

58. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

59. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcagcgt	Protospacer
**********************.****

60. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

61. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

62. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

63. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcagcgt	Protospacer
**********************.****

64. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.963

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccaggac	Protospacer
************************ **

65. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcagcgttta	Protospacer
***********************.****** 

66. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcagcgttta	Protospacer
***********************.****** 

67. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

68. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

69. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

70. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

71. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

72. spacer 1.3|456|27|NZ_CP046109|PILER-CR matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

73. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to MT711976 (Streptomyces phage Coruscant, complete genome) position: , mismatch: 5, identity: 0.815

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaagccaataaaaccactct	Protospacer
********** ******* **** * .

74. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 5, identity: 0.815

tccagaagaatccaataataccagtac	CRISPR spacer
ttttgaagaatcctttaataccagtac	Protospacer
*.. *********  ************

75. spacer 1.4|510|27|NZ_CP046109|PILER-CR matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 6, identity: 0.778

tccagaagaatccaataataccagtac	CRISPR spacer
aaacgaagaaaccaataatatcagtac	Protospacer
    ****** *********.******

76. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 7, identity: 0.774

gtccagaagaatccaataataccagtacttt	CRISPR spacer
attttgaagaatcctttaataccagtactta	Protospacer
.*.. *********  ************** 

77. spacer 1.1|449|31|NZ_CP046109|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.742

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
ccaccattaaaaatgataaaaacggcgtttt	Protospacer
*. * . **** ********* ********.

78. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to MT711976 (Streptomyces phage Coruscant, complete genome) position: , mismatch: 8, identity: 0.742

gtccagaagaatccaataataccagtacttt	CRISPR spacer
atccagaagaagccaataaaaccactctgtg	Protospacer
.********** ******* **** * . * 

79. spacer 1.2|503|31|NZ_CP046109|CRISPRCasFinder matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 10, identity: 0.677

gtccagaagaatccaataataccagtacttt	CRISPR spacer
aaaacgaagaaaccaataatatcagtacaag	Protospacer
.    ****** *********.******   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage