Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054556 Escherichia coli strain LWY24 chromosome, complete genome 2 crisprs cas3,c2c9_V-U4,DEDDh,DinG,csa3,PD-DExK 0 4 381 0

Results visualization

1. NZ_CP054556
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054556_1 1709305-1709418 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054556_2 2221813-2221945 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054556_1 1.2|1709375|25|NZ_CP054556|PILER-CR 1709375-1709399 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP054556_1 1.2|1709375|25|NZ_CP054556|PILER-CR 1709375-1709399 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 1 0.958
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 1 0.958
NZ_CP054556_1 1.2|1709375|25|NZ_CP054556|PILER-CR 1709375-1709399 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP054556_2 2.1|2221830|42|NZ_CP054556|PILER-CR 2221830-2221871 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 2 0.917
NZ_CP054556_2 2.2|2221889|40|NZ_CP054556|PILER-CR 2221889-2221928 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37675-37698 3 0.875
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37958-37981 3 0.875
NZ_CP054556_1 1.1|1709328|24|NZ_CP054556|PILER-CR 1709328-1709351 24 MT661596 Proteus phage 10, complete genome 116931-116954 3 0.875
NZ_CP054556_1 1.2|1709375|25|NZ_CP054556|PILER-CR 1709375-1709399 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84

1. spacer 1.2|1709375|25|NZ_CP054556|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

2. spacer 1.2|1709375|25|NZ_CP054556|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

3. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.958

cgtctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
**.*********************

4. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.958

cgtctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
**.*********************

5. spacer 1.2|1709375|25|NZ_CP054556|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

6. spacer 2.1|2221830|42|NZ_CP054556|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

7. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 2, identity: 0.917

cgtctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.*.*********************

8. spacer 2.2|2221889|40|NZ_CP054556|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

9. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.875

cgtctttacctgatttgggtaaac	CRISPR spacer
tgtgtttacctgattcgggtaaac	Protospacer
.** ***********.********

10. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.875

cgtctttacctgatttgggtaaac	CRISPR spacer
tgtgtttacctgattcgggtaaac	Protospacer
.** ***********.********

11. spacer 1.1|1709328|24|NZ_CP054556|PILER-CR matches to MT661596 (Proteus phage 10, complete genome) position: , mismatch: 3, identity: 0.875

cgtctttacctgatttgggtaaac	CRISPR spacer
tgtctgtacctgaattgggtaaac	Protospacer
.**** ******* **********

12. spacer 1.2|1709375|25|NZ_CP054556|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 50530 56 Escherichia_phage(60.0%) head,capsid,plate,terminase,holin,lysis,tail,portal,tRNA NA
DBSCAN-SWA_2 59282 : 70064 8 Rhodobacter_phage(20.0%) tRNA NA
DBSCAN-SWA_3 85835 : 87743 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_4 100355 : 102410 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 106644 : 107304 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_6 118298 : 130612 13 Morganella_phage(20.0%) NA NA
DBSCAN-SWA_7 134916 : 137016 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_8 152040 : 152829 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_9 159651 : 161019 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_10 164410 : 165244 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_11 169379 : 169913 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_12 179221 : 180142 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_13 184804 : 185050 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_14 200896 : 201838 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_15 215011 : 216193 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_16 219465 : 221108 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_17 233431 : 233689 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_18 240976 : 244699 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_19 247974 : 249952 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_20 254973 : 256344 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_21 259480 : 263216 5 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_22 269084 : 274228 7 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_23 281201 : 282889 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_24 300976 : 301735 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_25 314185 : 316937 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_26 320073 : 324081 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_27 327182 : 327413 1 Spodoptera_litura_granulovirus(100.0%) NA NA
DBSCAN-SWA_28 338667 : 348855 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_29 358704 : 360719 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_30 372384 : 375342 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_31 383838 : 389130 4 Chrysochromulina_ericina_virus(33.33%) protease NA
DBSCAN-SWA_32 394054 : 394645 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 402460 : 404395 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 413316 : 415335 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_35 428125 : 429391 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_36 443408 : 444491 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_37 458592 : 459108 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_38 465461 : 472731 6 Bacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_39 477685 : 478675 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_40 492212 : 496115 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_41 500054 : 504711 5 Escherichia_phage(25.0%) transposase NA
DBSCAN-SWA_42 514259 : 519345 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_43 522801 : 523815 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_44 530948 : 533051 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_45 536850 : 539971 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_46 545815 : 547360 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_47 555637 : 556738 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_48 562749 : 564508 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_49 567781 : 569687 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_50 574003 : 577810 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_51 583088 : 590024 3 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_52 599476 : 600704 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_53 614679 : 616215 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_54 624087 : 625506 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 633253 : 635383 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_56 644363 : 645254 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 650144 : 665582 15 Escherichia_phage(44.44%) NA NA
DBSCAN-SWA_58 683346 : 684648 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_59 694543 : 696355 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_60 716232 : 717507 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_61 724418 : 725917 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_62 734720 : 743524 9 Streptomyces_phage(20.0%) NA NA
DBSCAN-SWA_63 749028 : 751295 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_64 759585 : 764669 5 environmental_halophage(33.33%) NA NA
DBSCAN-SWA_65 783317 : 806830 23 Tupanvirus(20.0%) tRNA NA
DBSCAN-SWA_66 818119 : 820381 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_67 826507 : 827335 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_68 834811 : 836032 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_69 842796 : 843450 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_70 847840 : 849796 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 854721 : 858806 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_72 867619 : 868474 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_73 871792 : 876369 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 891123 : 972897 102 Salmonella_phage(30.65%) capsid,plate,protease,terminase,holin,integrase,tail,tRNA attL 900272:900287|attR 981148:981163
DBSCAN-SWA_75 980950 : 982426 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_76 986425 : 994766 10 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_77 998659 : 1000710 3 Escherichia_coli_phage(50.0%) NA NA
DBSCAN-SWA_78 1007196 : 1008930 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_79 1013437 : 1019081 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_80 1029168 : 1030683 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_81 1042661 : 1043414 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_82 1055076 : 1055745 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_83 1069775 : 1082142 12 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_84 1085676 : 1086207 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_85 1103575 : 1104803 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_86 1108154 : 1109387 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_87 1126075 : 1126303 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_88 1148559 : 1150361 2 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_89 1160140 : 1162299 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_90 1166996 : 1168163 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_91 1175807 : 1176707 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_92 1184064 : 1191296 7 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_93 1198829 : 1201292 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_94 1207292 : 1214262 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_95 1218506 : 1228982 8 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_96 1233646 : 1234999 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_97 1249173 : 1256037 8 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_98 1265177 : 1268734 4 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_99 1274205 : 1274757 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_100 1287103 : 1289137 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_101 1304854 : 1314296 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_102 1327489 : 1328702 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_103 1332922 : 1334641 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_104 1338228 : 1339059 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_105 1342739 : 1343468 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_106 1346593 : 1355743 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_107 1364309 : 1365512 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_108 1377788 : 1379660 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_109 1382875 : 1387006 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_110 1390897 : 1392490 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_111 1397486 : 1402712 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_112 1409100 : 1421189 12 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_113 1431789 : 1432698 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_114 1439025 : 1440315 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_115 1450507 : 1457082 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_116 1461426 : 1464946 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_117 1498626 : 1500024 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_118 1516101 : 1516857 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_119 1520780 : 1521572 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_120 1524950 : 1536784 10 Hokovirus(40.0%) NA NA
DBSCAN-SWA_121 1543346 : 1544111 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_122 1548254 : 1552068 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_123 1556695 : 1558360 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_124 1562926 : 1563967 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_125 1571920 : 1575453 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_126 1582445 : 1585028 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_127 1592038 : 1594478 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_128 1599296 : 1599943 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_129 1614032 : 1616147 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_130 1619210 : 1621033 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_131 1635366 : 1641408 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_132 1652231 : 1655375 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_133 1658520 : 1660636 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_134 1668329 : 1717907 64 Enterobacteria_phage(49.06%) head,capsid,protease,terminase,holin,lysis,integrase,tail,portal,transposase attL 1667861:1667907|attR 1717921:1717967
DBSCAN-SWA_135 1724986 : 1728117 4 Enterococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_136 1739633 : 1740779 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_137 1746969 : 1748751 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_138 1755186 : 1755873 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_139 1759126 : 1759804 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_140 1766870 : 1770112 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_141 1778348 : 1786806 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_142 1793814 : 1796964 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_143 1805800 : 1809347 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_144 1812670 : 1813366 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_145 1816506 : 1821553 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_146 1845167 : 1848815 4 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_147 1852042 : 1856382 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_148 1864980 : 1874937 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_149 1879598 : 1880714 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_150 1888127 : 1889285 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_151 1896157 : 1896925 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_152 1902221 : 1903331 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 1906408 : 1908369 2 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_154 1913779 : 1918059 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_155 1922600 : 1928288 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_156 1936807 : 1937659 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_157 1943704 : 1947011 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_158 1951994 : 1957932 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_159 1968994 : 1970044 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_160 1988204 : 1993859 7 Vibrio_phage(33.33%) capsid NA
DBSCAN-SWA_161 1999217 : 2004347 4 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_162 2009845 : 2010997 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_163 2016004 : 2019832 5 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_164 2024263 : 2032115 9 Bradyrhizobium_phage(25.0%) NA NA
DBSCAN-SWA_165 2038642 : 2039674 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_166 2052633 : 2056749 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_167 2065577 : 2066336 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_168 2077915 : 2079340 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_169 2083269 : 2083614 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_170 2089525 : 2090323 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_171 2095464 : 2102270 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_172 2112463 : 2113396 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_173 2116658 : 2123126 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_174 2132322 : 2133747 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_175 2142257 : 2142809 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_176 2147054 : 2148098 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_177 2174070 : 2179466 5 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_178 2188284 : 2188983 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_179 2197098 : 2202520 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_180 2211547 : 2214301 5 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_181 2222194 : 2227855 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_182 2233358 : 2234507 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_183 2238912 : 2241729 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_184 2248187 : 2261181 12 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_185 2272855 : 2274969 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_186 2278155 : 2283510 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_187 2290230 : 2291553 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_188 2297140 : 2300016 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_189 2307946 : 2309226 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_190 2312451 : 2317816 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_191 2332786 : 2333743 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_192 2341244 : 2341799 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_193 2348367 : 2349828 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_194 2360093 : 2361770 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_195 2365129 : 2366116 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_196 2370696 : 2377923 4 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_197 2386195 : 2387215 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_198 2392344 : 2401382 6 Klebsiella_phage(33.33%) tRNA NA
DBSCAN-SWA_199 2409722 : 2415819 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_200 2419457 : 2422768 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_201 2427030 : 2433511 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_202 2475557 : 2476721 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_203 2480563 : 2493589 11 Lactococcus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_204 2497504 : 2498050 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_205 2507965 : 2508943 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_206 2513862 : 2514396 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_207 2518597 : 2520581 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_208 2534858 : 2538070 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_209 2557634 : 2559137 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_210 2563977 : 2564766 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_211 2570329 : 2571879 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_212 2578003 : 2584372 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_213 2589617 : 2591765 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_214 2601049 : 2603008 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_215 2607050 : 2608400 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_216 2612217 : 2615831 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_217 2620038 : 2669582 51 Burkholderia_phage(27.27%) holin,plate,tail,tRNA NA
DBSCAN-SWA_218 2682830 : 2686514 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_219 2699937 : 2701527 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_220 2706892 : 2708656 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_221 2723332 : 2731661 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_222 2735656 : 2738709 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_223 2747049 : 2748894 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_224 2755645 : 2756860 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_225 2769025 : 2776272 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_226 2783139 : 2787736 3 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_227 2800947 : 2802279 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_228 2806041 : 2806887 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_229 2818497 : 2820566 2 Feldmannia_irregularis_virus(50.0%) NA NA
DBSCAN-SWA_230 2824015 : 2824636 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_231 2842383 : 2848609 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_232 2858060 : 2860840 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_233 2878478 : 2880949 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_234 2885027 : 2887814 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_235 2901501 : 2902116 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 2910905 : 2914192 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_237 2940650 : 2942480 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_238 2949860 : 2953719 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_239 2956722 : 2958780 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_240 2966900 : 2968556 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_241 2976574 : 2982718 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_242 2986760 : 2992174 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_243 3000503 : 3002150 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_244 3015540 : 3021393 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_245 3024561 : 3025554 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_246 3037504 : 3040866 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_247 3046400 : 3050240 4 Cyanophage(50.0%) NA NA
DBSCAN-SWA_248 3059244 : 3060582 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_249 3070780 : 3078149 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_250 3082757 : 3083906 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_251 3088333 : 3089287 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_252 3096147 : 3104624 9 Aeromonas_phage(25.0%) NA NA
DBSCAN-SWA_253 3115281 : 3116616 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_254 3153402 : 3154794 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_255 3159095 : 3165845 6 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_256 3170864 : 3179770 12 Morganella_phage(50.0%) integrase attL 3169577:3169590|attR 3184322:3184335
DBSCAN-SWA_257 3183112 : 3187675 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_258 3195113 : 3197207 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_259 3200615 : 3210122 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_260 3237930 : 3252453 10 Acinetobacter_phage(33.33%) tRNA NA
DBSCAN-SWA_261 3273866 : 3275408 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_262 3280726 : 3281722 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_263 3285567 : 3287570 3 Macacine_betaherpesvirus(50.0%) transposase NA
DBSCAN-SWA_264 3291224 : 3293558 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_265 3303446 : 3305431 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_266 3352645 : 3354115 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_267 3367104 : 3369240 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_268 3372584 : 3374627 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_269 3388036 : 3393932 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_270 3401825 : 3412227 12 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_271 3417962 : 3419445 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_272 3422987 : 3424798 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_273 3435810 : 3437907 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_274 3448236 : 3450684 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_275 3459436 : 3460663 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_276 3465053 : 3467447 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_277 3473416 : 3474295 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_278 3480858 : 3485368 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_279 3502346 : 3503183 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_280 3522090 : 3531631 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_281 3537202 : 3542776 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_282 3562653 : 3564125 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_283 3574468 : 3578622 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_284 3585126 : 3586011 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_285 3591348 : 3595861 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_286 3605148 : 3606192 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_287 3622690 : 3625215 2 uncultured_archaeal_virus(50.0%) protease NA
DBSCAN-SWA_288 3630005 : 3630503 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_289 3634208 : 3638941 5 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_290 3645689 : 3660483 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_291 3664551 : 3666029 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_292 3672658 : 3675531 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_293 3679611 : 3686250 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_294 3691731 : 3693621 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_295 3699324 : 3707120 10 Diadromus_pulchellus_ascovirus(25.0%) NA NA
DBSCAN-SWA_296 3724740 : 3725886 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_297 3733698 : 3735993 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_298 3761998 : 3762964 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_299 3774625 : 3786915 9 Salmonella_phage(40.0%) integrase,tRNA attL 3778963:3778976|attR 3797312:3797325
DBSCAN-SWA_300 3792996 : 3803084 8 Escherichia_phage(75.0%) transposase NA
DBSCAN-SWA_301 3807691 : 3809248 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_302 3813928 : 3816102 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_303 3819536 : 3824895 4 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_304 3831197 : 3832436 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_305 3837585 : 3839019 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_306 3848160 : 3859123 12 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_307 3862950 : 3863343 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_308 3866653 : 3876004 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_309 3882080 : 3882965 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_310 3905175 : 3906348 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_311 3926111 : 3928289 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_312 3941574 : 3947126 6 Sodalis_phage(33.33%) transposase NA
DBSCAN-SWA_313 3951096 : 3952311 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_314 3958680 : 3968953 6 uncultured_virus(20.0%) NA NA
DBSCAN-SWA_315 3974574 : 3975803 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_316 3996813 : 3997605 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_317 4005795 : 4006980 1 Enterobacteria_phage(100.0%) integrase attL 3996221:3996234|attR 4011494:4011507
DBSCAN-SWA_318 4029737 : 4030892 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_319 4059186 : 4060419 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_320 4068555 : 4073026 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_321 4076831 : 4092222 13 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_322 4116502 : 4117255 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_323 4121541 : 4124036 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_324 4133666 : 4140439 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_325 4145916 : 4166794 14 Bacillus_phage(22.22%) tRNA NA
DBSCAN-SWA_326 4178320 : 4179076 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_327 4183932 : 4184781 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_328 4189382 : 4196429 4 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_329 4200462 : 4203485 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_330 4207267 : 4210466 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_331 4217766 : 4218552 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_332 4233201 : 4235234 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_333 4238346 : 4248369 10 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_334 4267385 : 4268396 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_335 4275810 : 4276776 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_336 4282243 : 4287630 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_337 4300288 : 4305585 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_338 4311390 : 4315441 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_339 4324937 : 4325204 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_340 4330848 : 4331331 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_341 4344963 : 4346034 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_342 4353380 : 4355954 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_343 4361733 : 4363032 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_344 4368325 : 4374407 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_345 4380178 : 4383921 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_346 4387380 : 4387641 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_347 4391759 : 4403066 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_348 4408824 : 4410336 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_349 4425473 : 4431811 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_350 4441715 : 4442147 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_351 4462656 : 4469138 7 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_352 4475385 : 4479387 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_353 4500654 : 4501368 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_354 4518635 : 4519586 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_355 4538140 : 4543075 6 Deep-sea_thermophilic_phage(33.33%) NA NA
DBSCAN-SWA_356 4546553 : 4561923 15 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_357 4589208 : 4589943 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_358 4593761 : 4594682 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_359 4598372 : 4605948 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_360 4614034 : 4670148 71 Salmonella_phage(32.35%) capsid,plate,protease,terminase,lysis,tail,integrase attL 4625873:4625894|attR 4669059:4669080
DBSCAN-SWA_361 4689929 : 4691015 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_362 4699506 : 4700643 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_363 4707190 : 4708708 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_364 4712919 : 4714792 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_365 4728324 : 4731552 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_366 4765976 : 4770980 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_367 4774582 : 4779152 5 Oenococcus_phage(50.0%) transposase NA
DBSCAN-SWA_368 4785044 : 4786121 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_369 4789166 : 4797442 4 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_370 4800579 : 4804760 2 Oenococcus_phage(50.0%) NA NA
DBSCAN-SWA_371 4819683 : 4824526 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_372 4828688 : 4834457 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_373 4843225 : 4843843 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_374 4855539 : 4863189 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_375 4868943 : 4873244 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_376 4887739 : 4888597 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_377 4892666 : 4894658 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_378 4900007 : 4900676 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_379 4904370 : 4905891 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_380 4920815 : 4944517 16 uncultured_Mediterranean_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_381 4950826 : 4955010 9 Escherichia_phage(55.56%) integrase attL 4945025:4945036|attR 4952776:4952787
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage