Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054303 Klebsiella pneumoniae strain MS14393 chromosome, complete genome 3 crisprs WYL,DinG,cas3,csa3,DEDDh 24 39 10 0
NZ_CP054304 Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence 0 crisprs cas3,csa3,RT 0 0 2 0
NZ_CP054305 Klebsiella pneumoniae strain MS14393 plasmid pMS14393B, complete sequence 0 crisprs DEDDh 0 0 2 0

Results visualization

1. NZ_CP054303
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054303_1 714944-715021 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054303_2 946984-950564 Orphan NA
53 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054303_3 5338132-5338217 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 NZ_CP054303.1 951576-951612 0 1.0
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 NZ_CP054303.1 955245-955281 0 1.0
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955539-955569 0 1.0
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 951654-951672 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 951930-951948 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 952164-952182 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 952410-952428 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 952908-952926 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 953088-953106 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 953688-953706 1 0.947
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 955323-955341 1 0.947
NZ_CP054303_2 2.14|947919|55|NZ_CP054303|CRT 947919-947973 55 NZ_CP054303.1 951942-951996 1 0.982
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 951744-951774 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 953490-953520 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 955593-955623 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 952608-952638 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 952644-952674 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 953886-953916 1 0.968
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP054303.1 953268-953292 1 0.96
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 952296-952326 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 953388-953418 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 954174-954204 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955341-955371 1 0.968
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 NZ_CP054303.1 952464-952494 1 0.968
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 NZ_CP054303.1 952944-952974 1 0.968
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 NZ_CP054303.1 953580-953610 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 952278-952308 1 0.968
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 NZ_CP054303.1 951816-951864 1 0.98
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 NZ_CP054303.1 952200-952248 1 0.98
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 953352-953382 1 0.968
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 NZ_CP054303.1 952110-952140 1 0.968
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 NZ_CP054303.1 952554-952584 1 0.968
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 NZ_CP054303.1 953796-953826 1 0.968
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 NZ_CP054303.1 953424-953454 1 0.968
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 NZ_CP054303.1 953724-953754 1 0.968
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 951780-951798 2 0.895
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 952242-952260 2 0.895
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 952278-952296 2 0.895
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 953742-953760 2 0.895
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 953850-953868 2 0.895
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 NZ_CP054303.1 955593-955611 2 0.895
NZ_CP054303_2 2.7|947457|19|NZ_CP054303|CRT 947457-947475 19 NZ_CP054303.1 950547-950565 2 0.895
NZ_CP054303_2 2.7|947457|19|NZ_CP054303|CRT 947457-947475 19 NZ_CP054303.1 952464-952482 2 0.895
NZ_CP054303_2 2.7|947457|19|NZ_CP054303|CRT 947457-947475 19 NZ_CP054303.1 953580-953598 2 0.895
NZ_CP054303_2 2.14|947919|55|NZ_CP054303|CRT 947919-947973 55 NZ_CP054303.1 951666-951720 2 0.964
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 NZ_CP054303.1 951798-951828 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 NZ_CP054303.1 952182-952212 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 NZ_CP054303.1 952782-952812 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 NZ_CP054303.1 952872-952902 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 951504-951534 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 952536-952566 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 953034-953064 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP054303.1 955173-955203 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 NZ_CP054303.1 953508-953538 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 NZ_CP054303.1 955359-955389 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 NZ_CP054303.1 955377-955407 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 NZ_CP054303.1 955557-955587 2 0.935
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 NZ_CP054303.1 951576-951612 2 0.946
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 NZ_CP054303.1 955245-955281 2 0.946
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 951540-951570 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 951708-951738 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 952278-952308 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 953850-953880 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 954210-954240 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_CP054303.1 955209-955239 2 0.935
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP054303.1 953670-953694 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP054303.1 955413-955437 2 0.92
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 951816-951846 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 952200-952230 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 952764-952794 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 953508-953538 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 954084-954114 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955359-955389 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955377-955407 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955431-955461 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_CP054303.1 955557-955587 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 NZ_CP054303.1 952644-952674 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 NZ_CP054303.1 953886-953916 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 NZ_CP054303.1 955323-955353 2 0.935
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 NZ_CP054303.1 952002-952044 2 0.953
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 NZ_CP054303.1 953286-953328 2 0.953
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 NZ_CP054303.1 953634-953664 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 951636-951666 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 951912-951942 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 952644-952674 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 953688-953718 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 953886-953916 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 NZ_CP054303.1 955305-955335 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 951798-951828 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 952182-952212 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 952764-952794 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 952782-952812 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 952872-952902 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 953760-953790 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 953940-953970 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 954084-954114 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP054303.1 954174-954204 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 NZ_CP054303.1 953214-953244 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 NZ_CP054303.1 953316-953346 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 NZ_CP054303.1 951558-951588 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 NZ_CP054303.1 953016-953046 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 NZ_CP054303.1 953526-953556 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 NZ_CP054303.1 955227-955257 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 NZ_CP054303.1 951618-951648 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 NZ_CP054303.1 951894-951924 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 NZ_CP054303.1 955287-955317 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_CP054303.1 952278-952308 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_CP054303.1 952608-952638 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_CP054303.1 952644-952674 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_CP054303.1 953886-953916 2 0.935

1. spacer 2.16|948051|37|NZ_CP054303|CRT matches to position: 951576-951612, mismatch: 0, identity: 1.0

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactctgactccgacagc	Protospacer
*************************************

2. spacer 2.16|948051|37|NZ_CP054303|CRT matches to position: 955245-955281, mismatch: 0, identity: 1.0

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactctgactccgacagc	Protospacer
*************************************

3. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955539-955569, mismatch: 0, identity: 1.0

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
*******************************

4. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 951654-951672, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactctgactccgacagc	Protospacer
******.************

5. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 951930-951948, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactctgactccgacagc	Protospacer
******.************

6. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 952164-952182, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgattccgactccgacagc	Protospacer
***.***************

7. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 952410-952428, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactcggactccgacagc	Protospacer
****** ************

8. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 952908-952926, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactcggactccgacagc	Protospacer
****** ************

9. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 953088-953106, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactctgactccgacagc	Protospacer
******.************

10. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 953688-953706, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgattccgactccgacagc	Protospacer
***.***************

11. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 955323-955341, mismatch: 1, identity: 0.947

tgactccgactccgacagc	CRISPR spacer
tgactctgactccgacagc	Protospacer
******.************

12. spacer 2.14|947919|55|NZ_CP054303|CRT matches to position: 951942-951996, mismatch: 1, identity: 0.982

cgacagtgattcggattccgacagcgattcggactctgacagtgactcggattct	CRISPR spacer
cgacagcgattcggattccgacagcgattcggactctgacagtgactcggattct	Protospacer
******.************************************************

13. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 951744-951774, mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactcggacagcgactcggattct	Protospacer
************ ******************

14. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 953490-953520, mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgactcggactctgacagcgactcggattct	Protospacer
***.***************************

15. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 955593-955623, mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactccgacagcgactcggattct	Protospacer
************.******************

16. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 952608-952638, mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattccgattcc	Protospacer
***************************.***

17. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 952644-952674, mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
************************ ******

18. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 953886-953916, mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
************************ ******

19. spacer 2.22|948411|25|NZ_CP054303|CRT matches to position: 953268-953292, mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgactcggacagcgattcc	Protospacer
*********.***************

20. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 952296-952326, mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** ************************

21. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 953388-953418, mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** ************************

22. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 954174-954204, mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgactcggattct	Protospacer
****** ************************

23. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955341-955371, mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.***************************

24. spacer 2.26|948639|31|NZ_CP054303|CRT matches to position: 952464-952494, mismatch: 1, identity: 0.968

cgactcggattctgactccgactctgattcc	CRISPR spacer
cgactccgattctgactccgactctgattcc	Protospacer
****** ************************

25. spacer 2.26|948639|31|NZ_CP054303|CRT matches to position: 952944-952974, mismatch: 1, identity: 0.968

cgactcggattctgactccgactctgattcc	CRISPR spacer
cgattcggattctgactccgactctgattcc	Protospacer
***.***************************

26. spacer 2.26|948639|31|NZ_CP054303|CRT matches to position: 953580-953610, mismatch: 1, identity: 0.968

cgactcggattctgactccgactctgattcc	CRISPR spacer
cgactccgattctgactccgactctgattcc	Protospacer
****** ************************

27. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 952278-952308, mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactccgactcc	Protospacer
************************ ******

28. spacer 2.45|950025|49|NZ_CP054303|CRT matches to position: 951816-951864, mismatch: 1, identity: 0.98

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgactctgactcc	Protospacer
************.************************************

29. spacer 2.45|950025|49|NZ_CP054303|CRT matches to position: 952200-952248, mismatch: 1, identity: 0.98

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgactctgactcc	Protospacer
************.************************************

30. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 953352-953382, mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgattctgactctgacagcgattcggattct	Protospacer
***.***************************

31. spacer 2.49|950295|31|NZ_CP054303|CRT matches to position: 952110-952140, mismatch: 1, identity: 0.968

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattctgactcg	Protospacer
************.******************

32. spacer 2.49|950295|31|NZ_CP054303|CRT matches to position: 952554-952584, mismatch: 1, identity: 0.968

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattctgactcg	Protospacer
************.******************

33. spacer 2.49|950295|31|NZ_CP054303|CRT matches to position: 953796-953826, mismatch: 1, identity: 0.968

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattctgactcg	Protospacer
************.******************

34. spacer 2.50|950349|31|NZ_CP054303|CRT matches to position: 953424-953454, mismatch: 1, identity: 0.968

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
***************.***************

35. spacer 2.50|950349|31|NZ_CP054303|CRT matches to position: 953724-953754, mismatch: 1, identity: 0.968

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
***************.***************

36. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 951780-951798, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgattctgactccgacagc	Protospacer
***.**.************

37. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 952242-952260, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgactccgacagcgacagc	Protospacer
**********  *******

38. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 952278-952296, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgattccgactctgacagc	Protospacer
***.********.******

39. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 953742-953760, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgactccgattcggacagc	Protospacer
*********.** ******

40. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 953850-953868, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgattcggactccgacagc	Protospacer
***.** ************

41. spacer 2.5|947343|19|NZ_CP054303|CRT matches to position: 955593-955611, mismatch: 2, identity: 0.895

tgactccgactccgacagc	CRISPR spacer
tgattcggactccgacagc	Protospacer
***.** ************

42. spacer 2.7|947457|19|NZ_CP054303|CRT matches to position: 950547-950565, mismatch: 2, identity: 0.895

cgactccgactctgattcc	CRISPR spacer
cgactcggactctgactcc	Protospacer
****** ********.***

43. spacer 2.7|947457|19|NZ_CP054303|CRT matches to position: 952464-952482, mismatch: 2, identity: 0.895

cgactccgactctgattcc	CRISPR spacer
cgactccgattctgactcc	Protospacer
*********.*****.***

44. spacer 2.7|947457|19|NZ_CP054303|CRT matches to position: 953580-953598, mismatch: 2, identity: 0.895

cgactccgactctgattcc	CRISPR spacer
cgactccgattctgactcc	Protospacer
*********.*****.***

45. spacer 2.14|947919|55|NZ_CP054303|CRT matches to position: 951666-951720, mismatch: 2, identity: 0.964

cgacagtgattcggattccgacagcgattcggactctgacagtgactcggattct	CRISPR spacer
cgacagcgattcggattctgacagcgattcggactctgacagtgactcggattct	Protospacer
******.***********.************************************

46. spacer 2.15|947997|31|NZ_CP054303|CRT matches to position: 951798-951828, mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggactct	Protospacer
********** ****************.***

47. spacer 2.15|947997|31|NZ_CP054303|CRT matches to position: 952182-952212, mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggactct	Protospacer
********** ****************.***

48. spacer 2.15|947997|31|NZ_CP054303|CRT matches to position: 952782-952812, mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
*********. ********************

49. spacer 2.15|947997|31|NZ_CP054303|CRT matches to position: 952872-952902, mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatgct	Protospacer
********** ***************** **

50. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 951504-951534, mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgactcggattctgacagcgactcggattct	Protospacer
***.*****.*********************

51. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 952536-952566, mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagtgactcggattct	Protospacer
****** ***********.************

52. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 953034-953064, mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactcggacagcgactcggactct	Protospacer
************ **************.***

53. spacer 2.18|948189|31|NZ_CP054303|CRT matches to position: 955173-955203, mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgactcggattctgacagcgactcggattct	Protospacer
***.*****.*********************

54. spacer 2.19|948243|31|NZ_CP054303|CRT matches to position: 953508-953538, mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
********** ***************** **

55. spacer 2.19|948243|31|NZ_CP054303|CRT matches to position: 955359-955389, mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
********** ***************** **

56. spacer 2.19|948243|31|NZ_CP054303|CRT matches to position: 955377-955407, mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
********** ***************** **

57. spacer 2.19|948243|31|NZ_CP054303|CRT matches to position: 955557-955587, mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
********** ***************** **

58. spacer 2.20|948297|37|NZ_CP054303|CRT matches to position: 951576-951612, mismatch: 2, identity: 0.946

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactctgactccgacagc	Protospacer
***.*****.***************************

59. spacer 2.20|948297|37|NZ_CP054303|CRT matches to position: 955245-955281, mismatch: 2, identity: 0.946

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactctgactccgacagc	Protospacer
***.*****.***************************

60. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 951540-951570, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
************************ **.***

61. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 951708-951738, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgactcggattctgacagcgattccgactcc	Protospacer
***.*****.*********************

62. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 952278-952308, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgactccgactcc	Protospacer
****** **************.*********

63. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 953850-953880, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactccgacagcgattccgattcc	Protospacer
************.**************.***

64. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 954210-954240, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggattctgacagcgactccgactcc	Protospacer
*********.***********.*********

65. spacer 2.21|948357|31|NZ_CP054303|CRT matches to position: 955209-955239, mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
************************ **.***

66. spacer 2.22|948411|25|NZ_CP054303|CRT matches to position: 953670-953694, mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagtgattcc	Protospacer
****** ***********.******

67. spacer 2.22|948411|25|NZ_CP054303|CRT matches to position: 955413-955437, mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagcgactcc	Protospacer
************ ********.***

68. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 951816-951846, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

69. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 952200-952230, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

70. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 952764-952794, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
****** *****.******************

71. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 953508-953538, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
*********.**.******************

72. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 954084-954114, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgattcggattct	Protospacer
****** **************.*********

73. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955359-955389, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
*********.**.******************

74. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955377-955407, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
*********.**.******************

75. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955431-955461, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgattccgacagcgactcggattct	Protospacer
****** **.*********************

76. spacer 2.23|948459|31|NZ_CP054303|CRT matches to position: 955557-955587, mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattct	Protospacer
*********.**.******************

77. spacer 2.24|948513|31|NZ_CP054303|CRT matches to position: 952644-952674, mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
***.** ************************

78. spacer 2.24|948513|31|NZ_CP054303|CRT matches to position: 953886-953916, mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
***.** ************************

79. spacer 2.24|948513|31|NZ_CP054303|CRT matches to position: 955323-955353, mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactctgactccgacagcgattcggactcc	Protospacer
******.*****.******************

80. spacer 2.40|949689|43|NZ_CP054303|CRT matches to position: 952002-952044, mismatch: 2, identity: 0.953

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
cgattccgacagcgactccgactcggacagcgactctgactcc	Protospacer
************************************ **.***

81. spacer 2.40|949689|43|NZ_CP054303|CRT matches to position: 953286-953328, mismatch: 2, identity: 0.953

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
cgattccgacagcgactcggactctgacagcgactcggattcc	Protospacer
****************** ***** ******************

82. spacer 2.41|949755|31|NZ_CP054303|CRT matches to position: 953634-953664, mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagtgattcggattcc	Protospacer
****** **************.*********

83. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 951636-951666, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagtgactctgactcc	Protospacer
******************.***** ******

84. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 951912-951942, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagtgactctgactcc	Protospacer
******************.***** ******

85. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 952644-952674, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
****** **************.*********

86. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 953688-953718, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactccgacagcgactcggattcc	Protospacer
************.**************.***

87. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 953886-953916, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
****** **************.*********

88. spacer 2.44|949971|31|NZ_CP054303|CRT matches to position: 955305-955335, mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagtgactctgactcc	Protospacer
******************.***** ******

89. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 951798-951828, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggactct	Protospacer
****** ********************.***

90. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 952182-952212, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggactct	Protospacer
****** ********************.***

91. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 952764-952794, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
******.**************.*********

92. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 952782-952812, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
****** **.*********************

93. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 952872-952902, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatgct	Protospacer
****** ********************* **

94. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 953760-953790, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactctgacagtgattccgattct	Protospacer
******************.***** ******

95. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 953940-953970, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactccgactctgacagtgattcggattct	Protospacer
******.***********.************

96. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 954084-954114, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactccgactccgacagcgattcggattct	Protospacer
******.*****.******************

97. spacer 2.46|950097|31|NZ_CP054303|CRT matches to position: 954174-954204, mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactccgacagcgactcggattct	Protospacer
************.********.*********

98. spacer 2.48|950241|31|NZ_CP054303|CRT matches to position: 953214-953244, mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagtgactcggattcg	Protospacer
************ *****.************

99. spacer 2.48|950241|31|NZ_CP054303|CRT matches to position: 953316-953346, mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactccgactcg	Protospacer
************************ **.***

100. spacer 2.51|950403|31|NZ_CP054303|CRT matches to position: 951558-951588, mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattccgacagtgattccgattcg	Protospacer
************.**************.***

101. spacer 2.51|950403|31|NZ_CP054303|CRT matches to position: 953016-953046, mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattccgattctgacagtgattcggactcg	Protospacer
****** ***************** ******

102. spacer 2.51|950403|31|NZ_CP054303|CRT matches to position: 953526-953556, mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgattccgattcg	Protospacer
***.***********************.***

103. spacer 2.51|950403|31|NZ_CP054303|CRT matches to position: 955227-955257, mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattccgacagtgattccgattcg	Protospacer
************.**************.***

104. spacer 2.52|950457|31|NZ_CP054303|CRT matches to position: 951618-951648, mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgactcggactctgacagtgattccgactct	Protospacer
***.******************** ******

105. spacer 2.52|950457|31|NZ_CP054303|CRT matches to position: 951894-951924, mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgactcggactctgacagtgattccgactct	Protospacer
***.******************** ******

106. spacer 2.52|950457|31|NZ_CP054303|CRT matches to position: 955287-955317, mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgactcggactctgacagtgattccgactct	Protospacer
***.******************** ******

107. spacer 2.53|950511|31|NZ_CP054303|CRT matches to position: 952278-952308, mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgactccgactcc	Protospacer
****** **************.*********

108. spacer 2.53|950511|31|NZ_CP054303|CRT matches to position: 952608-952638, mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattccgattcc	Protospacer
******.********************.***

109. spacer 2.53|950511|31|NZ_CP054303|CRT matches to position: 952644-952674, mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
******.***************** ******

110. spacer 2.53|950511|31|NZ_CP054303|CRT matches to position: 953886-953916, mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
******.***************** ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155725-155743 0 1.0
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2632-2650 0 1.0
NZ_CP054303_2 2.5|947343|19|NZ_CP054303|CRT 947343-947361 19 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2782-2800 0 1.0
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2446-2482 0 1.0
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1042-1072 0 1.0
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151239-151269 0 1.0
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156205-156235 0 1.0
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1204-1234 0 1.0
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156223-156253 0 1.0
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3118-3148 0 1.0
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2974-3004 0 1.0
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2542-2572 0 1.0
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1006-1036 0 1.0
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1108 1 0.968
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1936 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153439-153469 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154615-154645 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154849-154879 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155599-155629 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155635-155665 1 0.968
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154993-155023 1 0.968
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2506-2536 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 970-1000 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1006-1036 1 0.968
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 1 0.968
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156019-156043 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151612-151636 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154015-154039 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154159-154183 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155533-155557 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156745-156769 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156895-156919 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157165-157189 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3232-3256 1 0.96
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3718-3742 1 0.96
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153277-153307 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153403-153433 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153529-153559 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153757-153787 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155047-155077 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155281-155311 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155671-155701 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156757-156787 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156907-156937 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157213-157243 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1060-1090 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1222-1252 1 0.968
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2392-2422 1 0.968
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154261-154291 1 0.968
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156625-156655 1 0.968
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1132-1162 1 0.968
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3382-3412 1 0.968
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3694-3724 1 0.968
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155257 1 0.98
NZ_CP054303_2 2.33|949179|49|NZ_CP054303|CRT 949179-949227 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1204-1252 1 0.98
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154345-154375 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155443-155473 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156775-156805 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154777-154807 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155173-155203 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155227-155257 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155407-155437 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156625-156655 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3382-3412 1 0.968
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3694-3724 1 0.968
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1042-1090 1 0.98
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 31-61 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1108 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1294-1324 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1936 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2428-2458 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2692-2722 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154435-154465 1 0.968
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1024-1054 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154687-154717 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154705-154735 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154903-154933 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155101-155131 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155335-155365 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151846-151876 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153385-153415 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153475-153505 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153493-153523 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153511-153541 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154669-154699 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154885-154915 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154975-155005 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155083-155113 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155317-155347 1 0.968
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155545-155575 1 0.968
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1312-1342 1 0.968
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1384-1414 1 0.968
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2014-2044 1 0.968
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156697-156727 1 0.968
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 1 0.968
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1132-1162 1 0.968
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2596-2632 2 0.946
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2032-2062 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2374-2404 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2506-2536 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2974-3004 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3628-3658 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155971 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151816 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153403-153433 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155671-155701 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157213-157243 2 0.935
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157585 2 0.935
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2908-2944 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1234-1270 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1360-1396 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1468-1504 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1990-2026 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151858-151894 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153307-153343 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154717-154753 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154915-154951 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155113-155149 2 0.946
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155347-155383 2 0.946
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1696-1726 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2392-2422 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3184 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2260-2290 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153955-153985 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154201 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151816 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153121-153151 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153403-153433 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153895-153925 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154777-154807 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155047-155077 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155173-155203 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155227-155257 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155281-155311 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155407-155437 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155671-155701 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157213-157243 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157249-157279 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157465-157495 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157585 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154345-154375 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155443-155473 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157411-157441 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1060-1090 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1114-1144 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16754-16784 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17750-17780 2 0.935
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19232-19262 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2050-2080 2 0.935
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2878-2908 2 0.935
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2908-2944 2 0.946
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1360-1396 2 0.946
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1990-2026 2 0.946
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154399-154429 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153241-153271 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153721-153751 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156307-156337 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1006-1036 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1132-1162 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1582-1612 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1942-1972 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2242-2272 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1132-1162 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1870-1900 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3184 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3382-3412 2 0.935
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3694-3724 2 0.935
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151396-151420 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151432-151456 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151468-151492 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151504-151528 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151942-151966 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153109-153133 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153463-153487 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153883-153907 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157183-157207 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157273-157297 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151540-151564 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151576-151600 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153265-153289 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153337-153361 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153745-153769 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155857-155881 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156475-156499 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156493-156517 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156511-156535 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156799-156823 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156967-156991 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157633-157657 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1642-1666 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3574-3598 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1822-1846 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2920-2944 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3754-3778 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1984-2008 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3304-3328 2 0.92
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3322-3346 2 0.92
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151408-151438 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153295-153325 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154687-154717 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154705-154735 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154903-154933 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155101-155131 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155335-155365 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156811-156841 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156979-157009 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151372-151402 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151660-151690 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151714-151744 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151972-152002 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153157-153187 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153439-153469 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154615-154645 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154849-154879 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155239 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155599-155629 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155635-155665 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155959-155989 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155977-156007 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156943-156973 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157261 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 952-982 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1696-1726 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 31-61 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1108 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1126 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1114-1144 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1936 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2206-2236 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2296-2326 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2428-2458 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2692-2722 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2860-2890 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2896-2926 2 0.935
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153103-153133 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153973-154003 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157033-157063 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157087-157117 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151257-151287 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153691-153721 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156223-156253 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 2 0.935
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3118-3148 2 0.935
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2314-2344 2 0.935
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153421-153469 2 0.959
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154807 2 0.959
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155203 2 0.959
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155437 2 0.959
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 952-1000 2 0.959
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154777-154807 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155173-155203 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155227-155257 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155407-155437 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151552-151582 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151588-151618 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153955-153985 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154063-154093 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154327-154357 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155509-155539 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156289-156319 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156775-156805 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157609-157639 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2068-2098 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2104-2134 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3490-3520 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2188-2218 2 0.935
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2788-2818 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152995-153025 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154993-155023 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151257-151287 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153313-153343 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156397-156427 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3280-3310 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 2 0.935
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 970-1000 2 0.935
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156925-156973 2 0.959
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1402-1432 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2374-2404 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2560-2590 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3628-3658 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155971 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157033-157063 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157087-157117 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151816 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153403-153433 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155671-155701 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157213-157243 2 0.935
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157585 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151239-151269 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151972-152002 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154789 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155185 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155239 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155419 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156205-156235 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151408-151438 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151444-151474 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151462-151492 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151954-151984 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153619-153649 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153937-153967 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154045-154075 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155905-155935 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2170-2200 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2296-2326 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2860-2890 2 0.935
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2932-2962 2 0.935
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2086-2116 2 0.935
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153085-153115 2 0.935
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154579-154609 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153913-153943 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154363-154393 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154525-154555 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154795-154825 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155011-155041 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155245-155275 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156451-156481 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151317-151347 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151918-151948 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157195-157225 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1060-1090 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2242-2272 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2674-2704 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3136-3166 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1720-1750 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2278-2308 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2356-2386 2 0.935
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3610-3640 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154525-154555 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154795-154825 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155011-155041 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155245-155275 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154453-154483 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157375-157405 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1060-1090 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 2 0.935
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1600-1630 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3382-3412 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3694-3724 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153241-153271 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153721-153751 2 0.935
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 970-1000 2 0.935
NZ_CP054303_2 2.6|947385|49|NZ_CP054303|CRT 947385-947433 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153277-153325 3 0.939
NZ_CP054303_2 2.8|947499|49|NZ_CP054303|CRT 947499-947547 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2392-2440 3 0.939
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2488-2524 3 0.919
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1474-1510 3 0.919
NZ_CP054303_2 2.13|947847|49|NZ_CP054303|CRT 947847-947895 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157189 3 0.939
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1696-1726 3 0.903
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2878-2908 3 0.903
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 3 0.903
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154435-154465 3 0.903
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 43-79 3 0.919
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2704-2740 3 0.919
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156391-156427 3 0.919
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 7-43 3 0.919
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1108 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1126 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1114-1144 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1756-1786 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1888-1918 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1936 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1942-1972 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2068-2098 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3118-3148 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151408-151438 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151480-151510 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151954-151984 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152995-153025 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155563-155593 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156811-156841 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156979-157009 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151239-151269 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151372-151402 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151660-151690 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151714-151744 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151732-151762 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151750-151780 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151768-151798 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153157-153187 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155815-155845 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155959-155989 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156205-156235 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156223-156253 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156541-156571 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156943-156973 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157261 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157285-157315 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157537-157567 3 0.903
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 970-1000 3 0.903
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2032-2062 3 0.903
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153385-153415 3 0.903
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153511-153541 3 0.903
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154975-155005 3 0.903
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153421-153451 3 0.903
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 43-79 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1414-1450 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1918-1954 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2704-2740 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3742-3778 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156619-156655 3 0.919
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 7-43 3 0.919
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154525-154555 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154795-154825 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155011-155041 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155245-155275 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152995-153025 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153655-153685 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153673-153703 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156829-156859 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156997-157027 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1600-1630 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2410-2440 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3262-3292 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3514-3544 3 0.903
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3532-3562 3 0.903
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151996-152020 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153019-153043 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153073-153097 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153571-153595 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153979-154003 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154033-154057 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154567-154591 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155875-155899 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156685-156709 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151852-151876 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151978-152002 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153181-153205 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153373-153397 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153481-153505 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153499-153523 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153589-153613 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154603-154627 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154639-154663 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154657-154681 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154675-154699 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154837-154861 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154873-154897 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154891-154915 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154963-154987 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155035-155059 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155071-155095 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155089-155113 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155269-155293 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155305-155329 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155323-155347 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155551-155575 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155587-155611 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155623-155647 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155659-155683 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155803-155827 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155893-155917 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156529-156553 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157309-157333 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157597-157621 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1372-1396 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2002-2026 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2530-2554 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 55-79 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1300-1324 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1408-1432 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1516-1540 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1876-1900 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1930-1954 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2302-2326 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2380-2404 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2566-2590 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2716-2740 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3088-3112 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3424-3448 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3598-3622 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3634-3658 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21097-21121 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 19-43 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1084-1108 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15484-15508 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15592-15616 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15718-15742 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9655-9679 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9859 3 0.88
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9961-9985 3 0.88
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153211-153241 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153775-153805 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153895-153925 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156049-156079 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151480-151510 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151516-151546 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151552-151582 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151588-151618 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151846-151876 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153385-153415 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153475-153505 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153493-153523 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153511-153541 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153637-153667 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153955-153985 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154063-154093 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154201 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154309-154339 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154327-154357 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154669-154699 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154789 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154885-154915 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154975-155005 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155083-155113 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155185 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155317-155347 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155419 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155545-155575 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155563-155593 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155971 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156031-156061 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156379-156409 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157321-157351 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157477 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2170-2200 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2824-2854 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1042-1072 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1258-1288 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2188-2218 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2332-2362 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2770-2800 3 0.903
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3100-3130 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157171 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153139-153169 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153241-153271 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153721-153751 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154345-154375 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154435-154465 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155443-155473 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155509-155539 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155713-155743 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156289-156319 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156739-156769 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156775-156805 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156889-156919 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157477 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1510-1540 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2770-2800 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1024-1054 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1078-1108 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1114-1144 3 0.903
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1150-1180 3 0.903
NZ_CP054303_2 2.25|948567|49|NZ_CP054303|CRT 948567-948615 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2032-2080 3 0.939
NZ_CP054303_2 2.30|948933|61|NZ_CP054303|CRT 948933-948993 61 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154033-154093 3 0.951
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154309-154357 3 0.939
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154597-154645 3 0.939
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155617-155665 3 0.939
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157279 3 0.939
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157537-157585 3 0.939
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3364-3412 3 0.939
NZ_CP054303_2 2.39|949611|55|NZ_CP054303|CRT 949611-949665 55 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3340-3394 3 0.945
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151552-151594 3 0.93
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154993-155023 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151516-151546 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153157-153187 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153439-153469 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153991-154021 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154201 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154579-154609 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154615-154645 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154849-154879 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155599-155629 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155635-155665 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155833-155863 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156223-156253 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156541-156571 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156697-156727 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156721-156751 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156871-156901 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156943-156973 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1384-1414 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1888-1918 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2014-2044 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3118-3148 3 0.903
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 3 0.903
NZ_CP054303_2 2.43|949899|49|NZ_CP054303|CRT 949899-949947 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154363-154411 3 0.939
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155995-156025 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157171 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157249-157279 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157465-157495 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151552-151582 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151588-151618 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151678-151708 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153241-153271 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153721-153751 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153955-153985 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154063-154093 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154261-154291 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155509-155539 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156289-156319 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157339-157369 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157411-157441 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157477 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157609-157639 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 988-1018 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1042-1072 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1276-1306 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1582-1612 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1798-1828 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1942-1972 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2224-2254 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2788-2818 3 0.903
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1114-1144 3 0.903
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153421-153469 3 0.939
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155029-155077 3 0.939
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155263-155311 3 0.939
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1144 3 0.939
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1348-1378 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1510-1540 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1696-1726 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1978-2008 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2770-2800 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3436-3466 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151299-151329 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154261-154291 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155833-155863 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1078-1108 3 0.903
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1114-1144 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154309-154339 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151624-151654 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151936-151966 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153175-153205 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153193-153223 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153211-153241 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153277-153307 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153295-153325 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153367-153397 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153403-153433 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153421-153451 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153529-153559 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153757-153787 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153895-153925 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154027-154057 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154957-154987 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155047-155077 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155281-155311 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155671-155701 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155815-155845 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155923-155953 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156343-156373 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156757-156787 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156811-156841 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156907-156937 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156925-156955 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156979-157009 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157213-157243 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1222-1252 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1312-1342 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1330-1360 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2374-2404 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2392-2422 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2728-2758 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2878-2908 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3316-3346 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3628-3658 3 0.903
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1060-1090 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1816-1846 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1678-1708 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1870-1900 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151534-151564 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151570-151600 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153175-153205 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155851-155881 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156793-156823 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156961-156991 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151498-151528 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151846-151876 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153013-153043 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153139-153169 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153691-153721 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154309-154339 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154669-154699 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154885-154915 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155083-155113 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155317-155347 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155581-155611 3 0.903
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156523-156553 3 0.903
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153121-153151 3 0.903
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153859-153889 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153259-153289 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153739-153769 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153811-153841 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153859-153889 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154399-154429 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154417-154447 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155191-155221 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155425-155455 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156085-156115 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156187-156217 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156559-156589 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156661-156691 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157627-157657 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1024-1054 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1546-1576 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2410-2440 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2638-2668 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3298-3328 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3532-3562 3 0.903
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1132-1162 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153913-153943 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155509-155539 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156289-156319 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151816 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154399-154429 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154417-154447 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154471-154501 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155191-155221 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155425-155455 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156559-156589 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157069-157099 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157171 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157249-157279 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157393-157423 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157465-157495 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157483-157513 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157585 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3676-3706 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1132-1162 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1546-1576 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3184 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3382-3412 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3532-3562 3 0.903
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3694-3724 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1582-1612 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1942-1972 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2242-2272 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154399-154429 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156307-156337 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157573-157603 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1006-1036 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1132-1162 3 0.903
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19910-19940 3 0.903
NZ_CP054303_2 2.6|947385|49|NZ_CP054303|CRT 947385-947433 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153757-153805 4 0.918
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1096-1132 4 0.892
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1132-1162 4 0.871
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3184 4 0.871
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3472-3502 4 0.871
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 4 0.871
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153211-153241 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1276-1306 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1384-1414 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1582-1612 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1834-1864 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2014-2044 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2188-2218 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3730-3760 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151444-151474 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151516-151546 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151552-151582 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151588-151618 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153193-153223 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153385-153415 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153511-153541 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153637-153667 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154063-154093 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154225-154255 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154327-154357 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154579-154609 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154975-155005 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155833-155863 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155923-155953 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155971 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156697-156727 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156775-156805 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156847-156877 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157015-157045 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157123-157153 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157321-157351 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157477 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157609-157639 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1006-1036 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16796-16826 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17630-17660 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17792-17822 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18878-18908 4 0.871
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19274-19304 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1438-1468 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2932-2962 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1126 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2488-2518 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2860-2890 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156925-156955 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151954-151984 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153349-153379 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153475-153505 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153493-153523 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154687-154717 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154705-154735 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154903-154933 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155101-155131 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155335-155365 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155545-155575 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151660-151690 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151714-151744 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151732-151762 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153367-153397 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154597-154627 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155029-155059 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155239 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155263-155293 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155617-155647 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155653-155683 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155959-155989 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157261 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157537-157567 4 0.871
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1042-1072 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151786-151816 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153121-153151 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153859-153889 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154381-154411 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154417-154447 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155191-155221 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155425-155455 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157171 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157249-157279 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157465-157495 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157483-157513 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157555-157585 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157627-157657 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2806-2836 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3610-3640 4 0.871
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3082-3112 4 0.871
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151870-151894 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153145-153169 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154267-154291 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154729-154753 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154927-154951 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155125-155149 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155359-155383 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155719-155743 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156331-156355 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156367-156391 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157507-157531 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2092-2116 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2662-2686 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2776-2800 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3052-3076 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3178-3202 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3478-3502 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21025-21049 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1156-1180 4 0.84
NZ_CP054303_2 2.22|948411|25|NZ_CP054303|CRT 948411-948435 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9547-9571 4 0.84
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153691-153721 4 0.871
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153793-153823 4 0.871
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156067-156097 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151660-151690 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151714-151744 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154597-154627 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155029-155059 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155263-155293 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155581-155611 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155617-155647 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155653-155683 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155833-155863 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155941-155971 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155959-155989 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157261 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157267-157297 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1078-1108 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1126 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1402-1432 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1906-1936 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1924-1954 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2560-2590 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2974-3004 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3748-3778 4 0.871
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 952-982 4 0.871
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155581-155629 4 0.918
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157495 4 0.918
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3676-3724 4 0.918
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3100-3148 4 0.918
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154327-154375 4 0.918
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151516-151558 4 0.907
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153529-153571 4 0.907
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154027-154069 4 0.907
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156943-156985 4 0.907
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1222-1264 4 0.907
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1294-1336 4 0.907
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153031-153061 4 0.871
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154345-154375 4 0.871
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155443-155473 4 0.871
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1042-1072 4 0.871
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1114-1144 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151372-151402 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151516-151546 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151660-151690 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151714-151744 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151732-151762 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153439-153469 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154201 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154615-154645 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154849-154879 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155599-155629 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155635-155665 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155833-155863 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155959-155989 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156943-156973 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157231-157261 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157537-157567 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1096-1126 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1114-1144 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1924-1954 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3646-3676 4 0.871
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 952-982 4 0.871
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151354-151402 4 0.918
NZ_CP054303_2 2.45|950025|49|NZ_CP054303|CRT 950025-950073 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1678-1726 4 0.918
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1132-1162 4 0.871
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3154-3184 4 0.871
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3472-3502 4 0.871
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 4 0.871
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151257-151287 4 0.871
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153211-153241 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151990-152020 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153565-153595 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153775-153805 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155869-155899 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156049-156079 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156523-156553 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156679-156709 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1696-1726 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2050-2080 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2824-2854 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3472-3502 4 0.871
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2896-2926 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2806-2836 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2860-2890 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151390-151420 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151426-151456 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151606-151636 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151972-152002 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153457-153487 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153877-153907 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154009-154039 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154153-154183 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154597-154627 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154789 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155029-155059 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155185 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155239 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155263-155293 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155419 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155527-155557 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155617-155647 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155653-155683 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157267-157297 4 0.871
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1042-1072 4 0.871
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1600-1630 4 0.871
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1870-1900 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152995-153025 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153655-153685 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153673-153703 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153811-153841 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153859-153889 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156085-156115 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156661-156691 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156829-156859 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156997-157027 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157429-157459 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1492-1522 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1720-1750 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2278-2308 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2356-2386 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2410-2440 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2842-2872 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3364-3394 4 0.871
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3028-3058 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154243-154273 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154381-154411 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154525-154555 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154795-154825 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155011-155041 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155245-155275 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157141-157171 4 0.871
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157627-157657 4 0.871
NZ_CP054303_2 2.6|947385|49|NZ_CP054303|CRT 947385-947433 49 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3766-3814 5 0.898
NZ_CP054303_2 2.9|947571|37|NZ_CP054303|CRT 947571-947607 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1774-1810 5 0.865
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 13-49 5 0.865
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155473-155509 5 0.865
NZ_CP054303_2 2.10|947631|37|NZ_CP054303|CRT 947631-947667 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156253-156289 5 0.865
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 5 0.839
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 5 0.839
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3340-3376 5 0.865
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1276-1306 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1678-1708 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2170-2200 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3010-3040 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3472-3502 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153547-153577 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154789 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154957-154987 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155185 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155419 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155581-155611 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157447-157477 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153139-153169 5 0.839
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154309-154339 5 0.839
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3586-3622 5 0.865
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3028-3058 5 0.839
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154291-154321 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153859 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156133 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156607 5 0.839
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157645-157675 5 0.839
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 5 0.839
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 5 0.839
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157105-157153 5 0.898
NZ_CP054303_2 2.39|949611|55|NZ_CP054303|CRT 949611-949665 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154147-154201 5 0.909
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1456-1498 5 0.884
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 5 0.839
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 5 0.839
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155473-155503 5 0.839
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156253-156283 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153859 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156133 5 0.839
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156607 5 0.839
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 5 0.839
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 5 0.839
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2524-2554 5 0.839
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 5 0.839
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 5 0.839
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155461-155491 5 0.839
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156241-156271 5 0.839
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1738-1768 5 0.839
NZ_CP054303_2 2.4|947265|55|NZ_CP054303|CRT 947265-947319 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153985-154039 6 0.891
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153859 6 0.806
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 6 0.806
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156133 6 0.806
NZ_CP054303_2 2.15|947997|31|NZ_CP054303|CRT 947997-948027 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156607 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 13-43 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-31 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154291-154321 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 6 0.806
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1168-1198 6 0.806
NZ_CP054303_2 2.19|948243|31|NZ_CP054303|CRT 948243-948273 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2446-2476 6 0.806
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3778-3814 6 0.838
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154291-154321 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155461-155491 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156241-156271 6 0.806
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1738-1768 6 0.806
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 6 0.806
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 31-61 6 0.806
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 67-97 6 0.806
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 6 0.806
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 6 0.806
NZ_CP054303_2 2.40|949689|43|NZ_CP054303|CRT 949689-949731 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154063-154105 6 0.86
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 6 0.806
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-31 6 0.806
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2134-2164 6 0.806
NZ_CP054303_2 2.41|949755|31|NZ_CP054303|CRT 949755-949785 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1168-1198 6 0.806
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 6 0.806
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 6 0.806
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154561-154591 6 0.806
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156169-156199 6 0.806
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157645-157675 6 0.806
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16976-17006 6 0.806
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 67-97 6 0.806
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 31-61 6 0.806
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3784-3814 6 0.806
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157696-157726 6 0.806
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3082-3112 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154507-154537 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154189-154219 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155461-155491 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156241-156271 6 0.806
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 6 0.806
NZ_CP054303_2 2.13|947847|49|NZ_CP054303|CRT 947847-947895 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155845 7 0.857
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3586-3622 7 0.811
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155467-155503 7 0.811
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156247-156283 7 0.811
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153859 7 0.774
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156133 7 0.774
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156607 7 0.774
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1654-1690 7 0.811
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2116-2152 7 0.811
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2134-2164 7 0.774
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3334-3364 7 0.774
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3784-3814 7 0.774
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 7 0.774
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154099-154129 7 0.774
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154135-154165 7 0.774
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 KP790009 Gordonia phage Gmala1, complete genome 62625-62655 7 0.774
NZ_CP054303_2 2.26|948639|31|NZ_CP054303|CRT 948639-948669 31 KP790008 Gordonia phage GordTnk2, complete genome 63343-63373 7 0.774
NZ_CP054303_2 2.32|949107|49|NZ_CP054303|CRT 949107-949155 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154879 7 0.857
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154207-154255 7 0.857
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154099-154129 7 0.774
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154135-154165 7 0.774
NZ_CP054303_2 2.46|950097|31|NZ_CP054303|CRT 950097-950127 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-25 7 0.774
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152062-152092 7 0.774
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153829-153859 7 0.774
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156103-156133 7 0.774
NZ_CP054303_2 2.48|950241|31|NZ_CP054303|CRT 950241-950271 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156577-156607 7 0.774
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154861 7 0.774
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155827 7 0.774
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1-31 7 0.774
NZ_CP054303_2 2.50|950349|31|NZ_CP054303|CRT 950349-950379 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1168-1198 7 0.774
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155461-155491 7 0.774
NZ_CP054303_2 2.51|950403|31|NZ_CP054303|CRT 950403-950433 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156241-156271 7 0.774
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152074 7 0.774
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 7 0.774
NZ_CP054303_2 2.8|947499|49|NZ_CP054303|CRT 947499-947547 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154219 8 0.837
NZ_CP054303_2 2.9|947571|37|NZ_CP054303|CRT 947571-947607 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1564-1600 8 0.784
NZ_CP054303_2 2.11|947691|43|NZ_CP054303|CRT 947691-947733 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156037-156079 8 0.814
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1168-1204 8 0.784
NZ_CP054303_2 2.16|948051|37|NZ_CP054303|CRT 948051-948087 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 7-43 8 0.784
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155749-155779 8 0.742
NZ_CP054303_2 2.18|948189|31|NZ_CP054303|CRT 948189-948219 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 8 0.742
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1168-1204 8 0.784
NZ_CP054303_2 2.21|948357|31|NZ_CP054303|CRT 948357-948387 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2122-2152 8 0.742
NZ_CP054303_2 2.23|948459|31|NZ_CP054303|CRT 948459-948489 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-25 8 0.742
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154171-154219 8 0.837
NZ_CP054303_2 2.44|949971|31|NZ_CP054303|CRT 949971-950001 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2122-2152 8 0.742
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 8 0.742
NZ_CP054303_2 2.52|950457|31|NZ_CP054303|CRT 950457-950487 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887814-2887844 8 0.742
NZ_CP054303_2 2.53|950511|31|NZ_CP054303|CRT 950511-950541 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2122-2152 8 0.742
NZ_CP054303_2 2.9|947571|37|NZ_CP054303|CRT 947571-947607 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3064-3100 9 0.757
NZ_CP054303_2 2.9|947571|37|NZ_CP054303|CRT 947571-947607 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3208-3244 9 0.757
NZ_CP054303_2 2.11|947691|43|NZ_CP054303|CRT 947691-947733 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1786-1828 9 0.791
NZ_CP054303_2 2.11|947691|43|NZ_CP054303|CRT 947691-947733 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151360-151402 9 0.791
NZ_CP054303_2 2.24|948513|31|NZ_CP054303|CRT 948513-948543 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-25 9 0.71
NZ_CP054303_2 2.38|949539|49|NZ_CP054303|CRT 949539-949587 49 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155731-155779 9 0.816
NZ_CP054303_2 2.42|949809|67|NZ_CP054303|CRT 949809-949875 67 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2524-2590 9 0.866
NZ_CP054303_2 2.1|947007|55|NZ_CP054303|CRT 947007-947061 55 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154129-154183 10 0.818
NZ_CP054303_2 2.20|948297|37|NZ_CP054303|CRT 948297-948333 37 KX752698 Mycobacterium phage Tonenili, complete genome 37355-37391 10 0.73
NZ_CP054303_2 2.49|950295|31|NZ_CP054303|CRT 950295-950325 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-25 10 0.677
NZ_CP054303_2 2.12|947757|67|NZ_CP054303|CRT 947757-947823 67 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1642-1708 16 0.761

1. spacer 2.5|947343|19|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

tgactccgactccgacagc	CRISPR spacer
tgactccgactccgacagc	Protospacer
*******************

2. spacer 2.5|947343|19|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgactccgactccgacagc	CRISPR spacer
tgactccgactccgacagc	Protospacer
*******************

3. spacer 2.5|947343|19|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgactccgactccgacagc	CRISPR spacer
tgactccgactccgacagc	Protospacer
*******************

4. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagtgattcggatgctgacagcgactctgactcc	Protospacer
*************************************

5. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgactcggattct	Protospacer
*******************************

6. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
*******************************

7. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
*******************************

8. spacer 2.26|948639|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgactcggattctgactccgactctgattcc	CRISPR spacer
cgactcggattctgactccgactctgattcc	Protospacer
*******************************

9. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
*******************************

10. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
*******************************

11. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactctgacagcgattcggattct	Protospacer
*******************************

12. spacer 2.50|950349|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgatagtgactccgattcg	Protospacer
*******************************

13. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcagactctgacagcgattccgactcc	Protospacer
*******************************

14. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
********** ********************

15. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
********** ********************

16. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.******************************

17. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.******************************

18. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.******************************

19. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.******************************

20. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.******************************

21. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggattct	Protospacer
****** ************************

22. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggatgctgacagcgattcggatgct	Protospacer
*********************.*********

23. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcc	Protospacer
*********************.*********

24. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcagactctgacagcgattccgactcc	Protospacer
******.************************

25. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
************************ ******

26. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgattcc	Protospacer
.************************

27. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcc	Protospacer
****** ******************

28. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcc	Protospacer
****** ******************

29. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcc	Protospacer
****** ******************

30. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcc	Protospacer
****** ******************

31. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgattcc	Protospacer
************ ************

32. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgattcc	Protospacer
************ ************

33. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgattccgattcggacagcgattcc	Protospacer
***.*********************

34. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgattcc	Protospacer
.************************

35. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcggacagtgattcc	Protospacer
******************.******

36. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
************************ ******

37. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
************.******************

38. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** ************************

39. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
************************ ******

40. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.***************************

41. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.***************************

42. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
************.******************

43. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
************************ ******

44. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
************************ ******

45. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
************.******************

46. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.***************************

47. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** ************************

48. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.***************************

49. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgactctgacagcgattcggactct	Protospacer
******************************.

50. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgactctgacagcgactcggactcc	Protospacer
*********************.*********

51. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactcggactctgacagcgattcggactcc	Protospacer
****** ************************

52. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
***.***************************

53. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
***.***************************

54. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.98

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
tgattccgactctgacagcgactcggattccgacagcgactcggactct	Protospacer
****** ******************************************

55. spacer 2.33|949179|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.98

cgactcggactccgacagcgactcggattctgactccgactctgattcc	CRISPR spacer
cgactccgactccgacagcgactcggattctgactccgactctgattcc	Protospacer
****** ******************************************

56. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
******************************.

57. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
******************************.

58. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagcgactcggactcc	Protospacer
.******************************

59. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
***************************.***

60. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
***************************.***

61. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
***************************.***

62. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
***************************.***

63. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgactccgactctgacagcgactcggactcc	Protospacer
***.***************************

64. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
*********************.*********

65. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
*********************.*********

66. spacer 2.45|950025|49|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.98

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactccgacagcgactcggattctgacagcgactctgactct	Protospacer
************************************************.

67. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
************.******************

68. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
****** ************************

69. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattcggattct	Protospacer
************ ******************

70. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
****** ************************

71. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
************.******************

72. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
************.******************

73. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgattcggattct	Protospacer
.******************************

74. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.968

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactctgacagcgattcggactct	Protospacer
***************************.***

75. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
****************************** 

76. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
****************************** 

77. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
****************************** 

78. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
****************************** 

79. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
****************************** 

80. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********************.*********

81. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
************.******************

82. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
************ ******************

83. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
************ ******************

84. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
************.******************

85. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********************.*********

86. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********************.*********

87. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
************.******************

88. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********************.*********

89. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********************.*********

90. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
************ ******************

91. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattccgacagcgactctgactcg	Protospacer
*********************.*********

92. spacer 2.50|950349|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
***************.***************

93. spacer 2.50|950349|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
***************.***************

94. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
***************.***************

95. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
******************.************

96. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.968

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactctgacagtgattccgactct	Protospacer
************************ ******

97. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagtgattcggattctgacagcgactcagactcc	Protospacer
**************** ************* ******

98. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggatgctgacagcgattcggactct	Protospacer
*********.*****************.***

99. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
*********. ********************

100. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggatgctgacagcgattcggatgct	Protospacer
*********.****************** **

101. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactctgactctgacagcgattcggattct	Protospacer
****** *** ********************

102. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
*********. ********************

103. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattcg	Protospacer
********** ******************* 

104. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
***.****** ********************

105. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
********** **********.*********

106. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
********** **********.*********

107. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
********** **********.*********

108. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
***.****** ********************

109. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattcggacagcgactctgactccgacagc	Protospacer
.**.*********************************

110. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattcggattcggacagcgactccgactccgacagc	Protospacer
****** *****************.************

111. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgactccgattcggacagcgactctgactctgacagc	Protospacer
***.**************************.******

112. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattcggattcggacagcgactctgactcggacagc	Protospacer
****** *********************** ******

113. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgactccgattcggacagcgactctgactcggacagc	Protospacer
***.************************** ******

114. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactcggattccgacagc	Protospacer
************************ **.*********

115. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattccgacagcgactcggactccgacagc	Protospacer
************ *********** ************

116. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactcggattccgacagc	Protospacer
************************ **.*********

117. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactcggattccgacagc	Protospacer
************************ **.*********

118. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactcggattccgacagc	Protospacer
************************ **.*********

119. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattcggacagcgactcggattccgacagc	Protospacer
************************ **.*********

120. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
ggactcggactctgacagcgactcggattct	Protospacer
 **.***************************

121. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
.***********.******************

122. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
*********************.********.

123. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactcggacagcgattcggattct	Protospacer
************ ********.*********

124. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattcc	Protospacer
.*****************************.

125. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattcg	Protospacer
.***************************** 

126. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.********************.*********

127. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactccgattct	Protospacer
.*********************** ******

128. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
.**.***************************

129. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactccgacagcgactcggattcg	Protospacer
************.***************** 

130. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
****** ***********************.

131. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
.***********.******************

132. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
****** ***********************.

133. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
****** ***********************.

134. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
.***********.******************

135. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
****** ***********************.

136. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
.**.***************************

137. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
.**.***************************

138. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.**************************.***

139. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.**************************.***

140. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.********************.*********

141. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
****** ********************.***

142. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
****** ********************.***

143. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactcggacagcgactcggactct	Protospacer
************ **************.***

144. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
*********************.*****.***

145. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
.***********.******************

146. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgattcggattct	Protospacer
****** **************.*********

147. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcagactctgacagcgactctgattct	Protospacer
******.***************** ******

148. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcagactctgacagcgactctgattct	Protospacer
******.***************** ******

149. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcagactctgacagcgactctgattct	Protospacer
******.***************** ******

150. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgactcggattctgacagcgactcggatgct	Protospacer
.********* ********************

151. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggatgctgacagcgactcggattcc	Protospacer
**************************** *.

152. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattcggacagcgactctgactccgacagc	Protospacer
.********.***************************

153. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
tgactccgattcggacagcgactctgactctgacagc	Protospacer
*********.********************.******

154. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
tgactccgattcggacagcgactctgactcggacagc	Protospacer
*********.******************** ******

155. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattccgactct	Protospacer
.*****************************.

156. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
****** ***********************.

157. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
****** ***********************.

158. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*********************** ******

159. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactcggacagcgattccgactct	Protospacer
************ *****************.

160. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*********************** ******

161. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*********************** ******

162. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*********************** ******

163. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
************************ *****.

164. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattccgattcc	Protospacer
.**************************.***

165. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagtgattccgactct	Protospacer
******************.***********.

166. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactccgactcc	Protospacer
.********************.*********

167. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcg	Protospacer
*********************.******** 

168. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggattctgacagcgattccgactcc	Protospacer
.********.*********************

169. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgactcggactctgacagcgattcggactcc	Protospacer
***.******************** ******

170. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgactcggattctgacagcgattccgactcc	Protospacer
***.*****.*********************

171. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
************************ **.***

172. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***************** ******

173. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***************** ******

174. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

175. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

176. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

177. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

178. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

179. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgattcg	Protospacer
************ *********** 

180. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

181. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgattcg	Protospacer
****** ***************** 

182. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgattcc	Protospacer
.**.*********************

183. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagcgattcg	Protospacer
************ *********** 

184. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcc	Protospacer
****** ***** ************

185. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcc	Protospacer
****** ***** ************

186. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagtgattcc	Protospacer
************ *****.******

187. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagtgattcc	Protospacer
****** ***********.******

188. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagtgattcc	Protospacer
************ *****.******

189. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcc	Protospacer
****** ***** ************

190. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgattccgattctgacagcgattcc	Protospacer
***.******** ************

191. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgattccgattctgacagcgattcc	Protospacer
***.******** ************

192. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgattccgattctgacagcgattcc	Protospacer
***.******** ************

193. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcc	Protospacer
****** ***** ************

194. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcc	Protospacer
****** ***** ************

195. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgattccgattctgacagcgattcc	Protospacer
***.******** ************

196. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
ggactccgattcggacagcgattcg	Protospacer
 *********************** 

197. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgattcg	Protospacer
.*********************** 

198. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagcgattct	Protospacer
************ ***********.

199. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcggacagcgactct	Protospacer
*********************.**.

200. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgactcggacagcgattct	Protospacer
*********.**************.

201. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcc	Protospacer
******.**.***************

202. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagtgattcc	Protospacer
************ *****.******

203. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcc	Protospacer
****** **************.***

204. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcg	Protospacer
***.************************** 

205. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggactcc	Protospacer
***************************.**.

206. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
************.***************** 

207. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
*********.********************.

208. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
*********.********************.

209. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
*********.********************.

210. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
*********.********************.

211. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
*********.********************.

212. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
***.**************************.

213. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
***.**************************.

214. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
***.***********************.***

215. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
************.**************.***

216. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
************.**************.***

217. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattct	Protospacer
*********.***********.*********

218. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagtgactcggattct	Protospacer
***.**************.************

219. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

220. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

221. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

222. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
*********.*****************.***

223. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

224. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
***.********.******************

225. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
************.**************.***

226. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactcagacagcgactcggactct	Protospacer
************ **************.***

227. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattct	Protospacer
***.** ************************

228. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
************.**************.***

229. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactccgacagcgactcggactct	Protospacer
****** ********************.***

230. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
ggactcggactctgacagcgactcggattct	Protospacer
 ***********.******************

231. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
****** **************.*********

232. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
************.********.*********

233. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
************.**************.***

234. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
***.***********************.***

235. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
************.********.*********

236. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcagactccgacagcgactcggactct	Protospacer
******.********************.***

237. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgattccgacagcgactcggattct	Protospacer
****** **.*********************

238. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
****** **************.*********

239. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgattcggattct	Protospacer
****** **************.*********

240. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
*********.*****************.***

241. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgactcggatgct	Protospacer
****** ********************* **

242. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
****** *****.******************

243. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgattctgacagcgattcggactcc	Protospacer
.********.*********************

244. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgattctgacagcgattcggactct	Protospacer
*********.********************.

245. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactctgactctgacagcgattcggactct	Protospacer
******.***********************.

246. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactctgactctgacagcgattcggactct	Protospacer
******.***********************.

247. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactctgactctgacagcgactcggactcc	Protospacer
******.**************.*********

248. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactcggactccgacagcgattcggactcc	Protospacer
****** *****.******************

249. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
***.*****************.*********

250. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
***.** ************************

251. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
***.*****************.*********

252. spacer 2.26|948639|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggattctgactccgactctgattcc	CRISPR spacer
cgactcggactctgactccgactccgattcc	Protospacer
*********.**************.******

253. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.959

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgactcggactct	Protospacer
.*****************************.******************

254. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.959

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
tgattccgactctgacagcgactcggattccgacagcgactcggactcc	Protospacer
****** *****************************************.

255. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.959

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
tgattccgactctgacagcgactcggattccgacagcgactcggactcc	Protospacer
****** *****************************************.

256. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.959

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
tgattccgactctgacagcgactcggattccgacagcgactcggactcc	Protospacer
****** *****************************************.

257. spacer 2.32|949107|49|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.959

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
tgattcggactctgacagcgactccgactccgacagcgactcggactct	Protospacer
************************ **.*********************

258. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
.*****************.************

259. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
.*****************.************

260. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
.*****************.************

261. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggattcc	Protospacer
.*****************.************

262. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
************.*****.************

263. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
************.*****.************

264. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattcc	Protospacer
****** ***********.************

265. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
************.*****.************

266. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
***.** ************************

267. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
*********************.*****.***

268. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
*********************.*****.***

269. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagcgactcggactcc	Protospacer
******************.********.***

270. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagcgactccgattcc	Protospacer
******************.***** ******

271. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattctgactctgacagtgactcggattct	Protospacer
******.***********************.

272. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgactccgactctgacagtgactcggattct	Protospacer
***.**************************.

273. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgactccgactctgacagtgactcggattct	Protospacer
***.**************************.

274. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
***.** ************************

275. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagtgactccgactcc	Protospacer
************************ **.***

276. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggactcc	Protospacer
.***** ************************

277. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggattct	Protospacer
***************************.**.

278. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgactctgactctgacagcgactcggactcc	Protospacer
***.**.************************

279. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattccgacagcgactcggactcc	Protospacer
*********.**.******************

280. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattccgacagcgactcggactcc	Protospacer
*********.**.******************

281. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactccgacagcgactcggactct	Protospacer
************.*****************.

282. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
****** **************.*********

283. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcc	Protospacer
****** ***************** ******

284. spacer 2.45|950025|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.959

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattccgactccgacagcgactcggattctgacagcgactcggactcc	Protospacer
****** *********************************** ******

285. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattcggactct	Protospacer
************ **************.***

286. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
****** **.*********************

287. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattcggactct	Protospacer
************ **************.***

288. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
****** **.*********************

289. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
******.**************.*********

290. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattcg	Protospacer
****** *********************** 

291. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgattcggactct	Protospacer
.**************************.***

292. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgattcggactct	Protospacer
.**************************.***

293. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
***.** ************************

294. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
****** **************.*********

295. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
****** **************.*********

296. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
****** **************.*********

297. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
***.** ************************

298. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
*********.******************** 

299. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggattct	Protospacer
*********************.******** 

300. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
***************************.** 

301. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
***************************.** 

302. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
***************************.** 

303. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
***************************.** 

304. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
*********.******************** 

305. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattcg	Protospacer
***.*****.*********************

306. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattcggacagcgactcggattcg	Protospacer
***.******** ******************

307. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgattcggattcg	Protospacer
************ ********.*********

308. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattctgacagcgactcggattcg	Protospacer
***.********.******************

309. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
*********.**.******************

310. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattccgacagcgattcggattcg	Protospacer
***.*****************.*********

311. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagtgactccgattcg	Protospacer
******************.***** ******

312. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagtgactccgattcg	Protospacer
******************.***** ******

313. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagtgactccgattcg	Protospacer
******************.***** ******

314. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattccgacagcgactcggattcc	Protospacer
.***************************** 

315. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactccgattccgacagcgactcggattct	Protospacer
****** *********************** 

316. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
***************************.** 

317. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactccgattcg	Protospacer
************.*********** ******

318. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattctgactct	Protospacer
************.***************** 

319. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactccgacagtgactccgattcg	Protospacer
************.**.***************

320. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgactctgattcg	Protospacer
***************.********.******

321. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgattcggactcc	Protospacer
************************ ***** 

322. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattccgattctgacagtgattccgactct	Protospacer
****** *********************** 

323. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
*********.******************** 

324. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
*********.******************** 

325. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
*********.******************** 

326. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
*********.******************** 

327. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattccgattctgacagtgattccgactcc	Protospacer
****** *********************** 

328. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgactctgactcg	Protospacer
*********************.**.******

329. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgactctgactcg	Protospacer
*********************.**.******

330. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgattccgattcg	Protospacer
***.***********************.***

331. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgattcggactct	Protospacer
************************ ***** 

332. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagcgattccgactcc	Protospacer
******************.*********** 

333. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgattccgattcc	Protospacer
***************************.** 

334. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattccgacagtgattccgactct	Protospacer
************.***************** 

335. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggatgctgacagtgattcggactcg	Protospacer
********** ************* ******

336. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgattcggactcg	Protospacer
***.******************** ******

337. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgactcggactcg	Protospacer
*********************.** ******

338. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagcgactccgactcg	Protospacer
******************.**.*********

339. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.*****************.************

340. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*********************** ******

341. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*********************** ******

342. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*********************** ******

343. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*********************** ******

344. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactctgacagtgactctgactct	Protospacer
*********************.** ******

345. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgactcggactctgacagtgactcggactct	Protospacer
***.*****************.*********

346. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgattcggactct	Protospacer
.********.*********************

347. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
******************.***********.

348. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggattctgacagcgattcggactct	Protospacer
*********.********.************

349. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
******.***************** ******

350. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***************** ******

351. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***************** ******

352. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
****** ***********************.

353. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
****** ***********************.

354. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.935

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcc	Protospacer
******.**************.*********

355. spacer 2.6|947385|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

cgactcagactccgacagcgactctgactccgacagcgactccgattcg	CRISPR spacer
cgactcggactccgacagcgactcggactccgacagcgactccgattct	Protospacer
******.***************** *********************** 

356. spacer 2.8|947499|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.939

tgattccgatgctgacagcgattcggactccgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgattcggactccgacagcgactcggattct	Protospacer
.***** *** **************************************

357. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
tgacagcgattcggatgctgacagcgactctgactct	Protospacer
.*****.*****************************.

358. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagtgattcggattcggacagcgactctgactcg	Protospacer
**************** * ***************** 

359. spacer 2.13|947847|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggattcggacagcgactccgactctgacagcgattcggactct	CRISPR spacer
cgattccgattcggacagcgattccgactctgacagcgattcggactct	Protospacer
.***** **************.***************************

360. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggacgctgacagcgattcggattct	CRISPR spacer
ggactcggactctgacagcgactcggattct	Protospacer
 ********* **********.*********

361. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggatgctgacagcgactcggattcc	Protospacer
*********.***********.********.

362. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
********** **********.******** 

363. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgattcggattct	Protospacer
.***** *** ********************

364. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.**.******** ************************

365. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.**.******** ************************

366. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattccgacagcgactcggactccgacagt	Protospacer
************ *********** ***********.

367. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.919

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.**.******** ************************

368. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
.**.*****************.*********

369. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.***********************.***

370. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
.***********.**************.***

371. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgattcggactcc	Protospacer
*********************.*****.**.

372. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagtgactcggattct	Protospacer
.********.********.************

373. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
.**.*****************.*********

374. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgactccgactcg	Protospacer
************************ **.** 

375. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattctgactctgacagtgactcggattct	Protospacer
.***** ***********.************

376. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
****** ********************.**.

377. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
.**.** ************************

378. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcg	Protospacer
.***********.***************** 

379. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactcggacagcgactcggattcg	Protospacer
.*********** ***************** 

380. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactcggattcg	Protospacer
.********.******************** 

381. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggactcc	Protospacer
.**************************.**.

382. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
.**.************************** 

383. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactcggacagcgactcggattcg	Protospacer
.*********** ***************** 

384. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
.***********.*****************.

385. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
.***********.*****************.

386. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
.**.********.******************

387. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
.***********.**************.***

388. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.***********************.***

389. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.***********************.***

390. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
.********.*****************.***

391. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgattcggattct	Protospacer
.********.***********.*********

392. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgattcggattct	Protospacer
.********.***********.*********

393. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagtgactcggattct	Protospacer
.***********.*****.************

394. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.********************.*****.***

395. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattcggacagcgactcggattct	Protospacer
.********.** ******************

396. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.***********************.***

397. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagcgactcggattct	Protospacer
.**.********.******************

398. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
****** ********************.**.

399. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggattctgacagtgactcggattcc	Protospacer
*********.********.***********.

400. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattct	Protospacer
.***** *****.******************

401. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.***********************.***

402. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactcggacagcgactccgattcc	Protospacer
************ *********** *****.

403. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
.********.*****************.***

404. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgactccgactcc	Protospacer
************************ **.**.

405. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggatgctgacagcgattcggactct	Protospacer
*********************.*****. **

406. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
********** ***************** * 

407. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
********** ***************** * 

408. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
********** ***************** * 

409. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggactct	Protospacer
********** ****************. **

410. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.********.** ************************

411. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgactccgacagcgactctgactcggacagc	Protospacer
.*********** ***************** ******

412. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgactcggacagcgactcggactctgacagc	Protospacer
.*********************** *****.******

413. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.********.** ************************

414. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgactcggacagcgattctgactctgacagc	Protospacer
.********************.********.******

415. spacer 2.20|948297|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
tgactccgactctgacagcgactcggactccgacagt	Protospacer
************ *********** ***********.

416. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.919

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgattctgacagcgactctgactccgacagc	Protospacer
.********.** ************************

417. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.*********************** *****.

418. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****************.***********.

419. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****************.***********.

420. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****************.***********.

421. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****************.***********.

422. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactcggactcc	Protospacer
.********************.** ******

423. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*********** ******

424. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*********** ******

425. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*********** ******

426. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*********** ******

427. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggattctgacagcgattcggactct	Protospacer
*********.************** *****.

428. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggattctgacagcgattcggactcc	Protospacer
.********.************** ******

429. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactctgacagcgactccgactcc	Protospacer
.**.*****************.*********

430. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactcggacagcgactccgactcc	Protospacer
.*********** ********.*********

431. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggattctgacagcgattcggactcg	Protospacer
*********.************** ***** 

432. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

433. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattcggacagcgattcg	Protospacer
.***** ***************** 

434. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagtgattcg	Protospacer
.*****************.***** 

435. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

436. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattctgacagcgattcg	Protospacer
.*********** *********** 

437. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

438. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactctgattcggacagcgattcg	Protospacer
.*****.***************** 

439. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

440. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

441. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

442. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

443. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

444. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcg	Protospacer
****** **************.** 

445. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcg	Protospacer
****** **************.** 

446. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcg	Protospacer
****** **************.** 

447. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagtgactcc	Protospacer
.*****************.**.***

448. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

449. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgattcggattcggacagcgattcg	Protospacer
***.** ***************** 

450. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgattcggattcggacagcgattcg	Protospacer
***.** ***************** 

451. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

452. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

453. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgattcggattcggacagcgattcg	Protospacer
***.** ***************** 

454. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

455. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcg	Protospacer
****** **************.** 

456. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

457. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgattcggattcggacagcgattcg	Protospacer
***.** ***************** 

458. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

459. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

460. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgattcggattcggacagcgattcg	Protospacer
***.** ***************** 

461. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattccgacagcgattcg	Protospacer
****** ***** *********** 

462. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattcggacagcgactcg	Protospacer
****** **************.** 

463. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

464. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

465. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

466. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

467. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagtgactcc	Protospacer
.*****************.**.***

468. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattccgacagcgattcc	Protospacer
.***** ***** ************

469. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagtgattcg	Protospacer
************ *****.***** 

470. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagtgattcg	Protospacer
************ *****.***** 

471. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactct	Protospacer
.********************.**.

472. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactct	Protospacer
.********************.**.

473. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagcgactcg	Protospacer
.********************.** 

474. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgactct	Protospacer
************ ********.**.

475. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcg	Protospacer
******.**.************** 

476. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcg	Protospacer
******.**.************** 

477. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcg	Protospacer
******.**.************** 

478. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattctgacagcgattcc	Protospacer
.***** ***** ************

479. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgactcggacagcgactcg	Protospacer
*********.***********.** 

480. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattccgacagcgactcg	Protospacer
************ ********.** 

481. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

482. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcg	Protospacer
******.**.************** 

483. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgactct	Protospacer
************ ********.**.

484. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
tgattcggattcggacagcgattcc	Protospacer
.**.** ******************

485. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgactct	Protospacer
************ ********.**.

486. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgactcggacagcgactct	Protospacer
*********.***********.**.

487. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcggattctgacagcgattcg	Protospacer
****** ***** *********** 

488. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagacagtgattca	Protospacer
************.*****.***** 

489. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattctgacagcgactct	Protospacer
************ ********.**.

490. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactctgactcggacagcgattcg	Protospacer
******.**.************** 

491. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagacagtgattca	Protospacer
************.*****.***** 

492. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagacagtgattca	Protospacer
************.*****.***** 

493. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagacagtgattca	Protospacer
************.*****.***** 

494. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagacagtgattca	Protospacer
************.*****.***** 

495. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactcagattcagacagcgattca	Protospacer
****** *****.*********** 

496. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

cgactccgattcggacagcgattcc	CRISPR spacer
cgactccgattcagatagcgattcg	Protospacer
************.**.******** 

497. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagcgattcggattcg	Protospacer
.********************.******** 

498. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.**************************.**.

499. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgattcggactccgacagcgactcggattcg	Protospacer
.**.************************** 

500. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.**************************.**.

501. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactcggacagcgactcggattcg	Protospacer
***.******** ***************** 

502. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcg	Protospacer
***.** *********************** 

503. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
***.** ***********************.

504. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
***.** ***********************.

505. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********.***********.******** 

506. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
*********.**.***************** 

507. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
*********.** ***************** 

508. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
*********.** ***************** 

509. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
*********.**.***************** 

510. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgattcggattcc	Protospacer
***.*****************.********.

511. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattcc	Protospacer
***.********.*****************.

512. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
***.** ***********************.

513. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactcggattcg	Protospacer
***.********.***************** 

514. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggattccgacagcgactcggactct	Protospacer
.********.*****************.***

515. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
************.*****.***********.

516. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********.***********.******** 

517. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
*********.*****************.**.

518. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********.***********.******** 

519. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
*********.**.***************** 

520. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********.***********.******** 

521. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
*********.*****************.**.

522. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
*********.***********.******** 

523. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
*********.*****************.**.

524. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
*********.** ***************** 

525. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactcggacagcgactcggattcg	Protospacer
***.******** ***************** 

526. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattcg	Protospacer
************.********.******** 

527. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagtgactccgattcg	Protospacer
******************.***** ***** 

528. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagtgactccgattcg	Protospacer
******************.***** ***** 

529. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactccgattcc	Protospacer
************.*********** *****.

530. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactcc	Protospacer
************.**************.**.

531. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggattccgacagcgactcggattcc	Protospacer
.********.********************.

532. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.**************************.**.

533. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgattcggactctgacagcgactcggattct	Protospacer
.**.********.******************

534. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagtgattcggattcg	Protospacer
******************.**.******** 

535. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
************.*****.***********.

536. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
ggactcggactcggacagcgactcggactct	Protospacer
 *********** **************.***

537. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactccgactccgacagcgattcggattct	Protospacer
.***** **************.*********

538. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactccgacagtgattcggattcg	Protospacer
******************.**.******** 

539. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactctgacagcgattcggactct	Protospacer
.**.**************************.

540. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactcggattctgacagcgattcggactct	Protospacer
****** **.********************.

541. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
***.******************** *****.

542. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
***.******************** *****.

543. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.**.** ************************

544. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
***.*****************.********.

545. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactctgactctgacagcgattcggattct	Protospacer
******.********************.**.

546. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
***.*****************.********.

547. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.**.**************.************

548. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgactccgacagcgattcagactcg	Protospacer
************.***********.***** 

549. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.**.**************.************

550. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgattctgacagcgattccgactcc	Protospacer
.********.************** ******

551. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactctgacagcgactcggactcc	Protospacer
.**.*****************.*********

552. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.**.** ************************

553. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgattctgacagcgattccgactcc	Protospacer
.********.************** ******

554. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.**.** ************************

555. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.**.** ************************

556. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactcc	Protospacer
.***** **************.*********

557. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
***.** ***********************.

558. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactcggacagcgattcggactcc	Protospacer
.*****.***** ******************

559. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgactccgacagcgattcggattct	Protospacer
************.**************.**.

560. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactctgacagcgattcggactct	Protospacer
.*****.***********************.

561. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactcggacagcgattcggactcc	Protospacer
.*****.***** ******************

562. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggattct	Protospacer
***.***********************.**.

563. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgattctgacagtgattcggactct	Protospacer
*********.********.***********.

564. spacer 2.25|948567|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.939

cgactcggatgctgacagcgactcggatgctgacagcgattcggactcc	CRISPR spacer
tgactcggattctgacagcgactcggatgctgacagcgattcggactct	Protospacer
.********* *************************************.

565. spacer 2.30|948933|61|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.951

cgattccgactccgacagcgactcggattccgacagcgactccgattcggacagcgattc	CRISPR spacer
cgattccgactccgacagcgactcggattccgacagtgactccgattcggacagcgactc	Protospacer
************************************.********************.**

566. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgactcggactctgacagtgactcggattccgacagcgactcggactct	Protospacer
.**.**************.******************************

567. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgattcggactct	Protospacer
.*****************************.********.*********

568. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgattcggactct	Protospacer
.*****************************.********.*********

569. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggactctgacagcgactcggactct	Protospacer
.**************************.**.******************

570. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgattcggattctgacagcgactcggactct	Protospacer
.********************.********.******************

571. spacer 2.38|949539|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.939

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
tgattccgactctgacagcgattcggactccgacagtgattcggattcg	Protospacer
***************************************.****** * 

572. spacer 2.39|949611|55|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.945

cgattcggactctgacagtgactcggattcggacagcgactccgactccgactct	CRISPR spacer
cgattcggactccgacagtgattcggattcggacagcgactccgactccgactcg	Protospacer
************.********.******************************** 

573. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattccgacagcgattccgactccgacagcgactcggattcc	Protospacer
 **************.******** ******************

574. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggattct	Protospacer
.*****************.***********.

575. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagcgactcggattcg	Protospacer
************.*****.*********** 

576. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactccgacagtgactcggattct	Protospacer
****** *****.*****************.

577. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
****** ***********.***********.

578. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagtgactccgattct	Protospacer
************.*********** *****.

579. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattcg	Protospacer
****** ***********.*********** 

580. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagtgactctgattcg	Protospacer
****** ***************** ***** 

581. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
****** ***********.***********.

582. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
****** ***********.***********.

583. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
****** ***********.***********.

584. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
****** ***********.***********.

585. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactctgacagcgattcggattcg	Protospacer
******************.**.******** 

586. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
.*****************.********.***

587. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattcggattctgacagtgactcggattcc	Protospacer
.***** **.*********************

588. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
****** ***************** ***** 

589. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagtgactccgattcg	Protospacer
************.*********** ***** 

590. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagtgactccgattcg	Protospacer
************.*********** ***** 

591. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattccgactccgacagcgactcggattct	Protospacer
************.*****.***********.

592. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
****** ***************** ***** 

593. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggattctgacagtgactcggattct	Protospacer
****** **.********************.

594. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
****** ***************** ***** 

595. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggactcc	Protospacer
.*****************.********.***

596. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgactctgacagtgactcggattcc	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
***.**************.***********.

597. spacer 2.43|949899|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

tgattccgactcggacagcgattccgattccgacagtgattccgactct	CRISPR spacer
cgattccgactctgacagcgattccgattctgacagtgattccgactct	Protospacer
.*********** *****************.******************

598. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactcagacagcgactcggactca	Protospacer
.*********** ***************** 

599. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagcgattcggactct	Protospacer
.********************.********.

600. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.***** ***********************.

601. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.***** ***********************.

602. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***********.**************.***

603. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***********.**************.***

604. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattccgacagcgactcggactct	Protospacer
*********.**.*****************.

605. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
*********************.** *****.

606. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattccgactct	Protospacer
*********************.** *****.

607. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattcc	Protospacer
.***** ********************.***

608. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***********.**************.***

609. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.***** **************.*********

610. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgactccgactctgacagcgattcggactct	Protospacer
***.*****************.********.

611. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.*****************.**.*********

612. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.*****************.**.*********

613. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.***** **************.*********

614. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.***** **************.*********

615. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.***** **************.*********

616. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattccgacagcgactcggactct	Protospacer
*********.**.*****************.

617. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactcggacagcgactcggactct	Protospacer
****** ***** *****************.

618. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactcc	Protospacer
.**.** ************************

619. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
****** **************.********.

620. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagcgactccgattcc	Protospacer
.*********************** **.***

621. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggactct	Protospacer
.***********.*****************.

622. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgactcggattct	Protospacer
****** ********************.**.

623. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggattctgacagcgactcggactcc	Protospacer
.***** **.*********************

624. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactccgactcc	Protospacer
.***** ***************** ******

625. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattctgactctgacagcgactctgactcc	Protospacer
.*****.***************** ******

626. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcg	Protospacer
****** ***************** ***** 

627. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcagactcc	Protospacer
.***********.***********.******

628. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagtgactccgactcc	Protospacer
.*****************.***** ******

629. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggattct	Protospacer
*********************.*****.**.

630. spacer 2.45|950025|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgactcggactct	Protospacer
************.***************************** *****.

631. spacer 2.45|950025|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactccgacagcgactcggattctgacagcgattcggactct	Protospacer
***************************************.** *****.

632. spacer 2.45|950025|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.939

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactccgacagcgactcggattctgacagcgattcggactct	Protospacer
***************************************.** *****.

633. spacer 2.45|950025|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.939

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
cgattcggactccgacagcgactcggactctgacagcgactcggactct	Protospacer
***************************.************** *****.

634. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactctgacagcgactccgattcc	Protospacer
*********************.** *****.

635. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattcggactcc	Protospacer
************ **************.**.

636. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
ggactcggactctgacagcgactcggattct	Protospacer
 ***** **************.*********

637. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattccgattcc	Protospacer
************ *********** *****.

638. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactccgactccgacagcgattcggattct	Protospacer
.*****.*****.******************

639. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgactccgattct	Protospacer
.********************.** ******

640. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactcggatagcgattcggattct	Protospacer
.*********** **.***************

641. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
****** **************.******** 

642. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactccgactctgacagcgattcggactct	Protospacer
.*****.********************.***

643. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgattccgactctgacagcgattcggattcg	Protospacer
***.**.*********************** 

644. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcggacagcgattcggactcc	Protospacer
************ **************.**.

645. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgattccgactctgacagcgattcggattct	Protospacer
.**.**.************************

646. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattccgacagcgactcggactct	Protospacer
.**************************.** 

647. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgattccgattccgacagcgactcggattcg	Protospacer
.**.** ************************

648. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgattcggattct	Protospacer
************ ********.******** 

649. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattccgacagcgattcggactcc	Protospacer
*********************.*****.** 

650. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattcggacagcgactcggattcc	Protospacer
***.******** ***************** 

651. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggactccgacagcgattcggattcg	Protospacer
.********.***********.*********

652. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
*********.************** ***** 

653. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactcggactcc	Protospacer
*********.*****************.** 

654. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactcggactct	Protospacer
************ **************.** 

655. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
*********.**.***************** 

656. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactcggactct	Protospacer
************.**************.** 

657. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** **.******************** 

658. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
*********.************** ***** 

659. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgattcggactccgacagcgactcggattcg	Protospacer
.**.*****.*********************

660. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggattcg	Protospacer
.***** ***** ******************

661. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactcggactcc	Protospacer
************ **************.** 

662. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.*****.******************** 

663. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.*****.******************** 

664. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
*********.**.***************** 

665. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattcggacagcgactcggattct	Protospacer
***.******** ***************** 

666. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggattcggacagcgactcggattcc	Protospacer
***.******** ***************** 

667. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattcggacagtgactcggattcg	Protospacer
.*********** *****.************

668. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
*********.************** ***** 

669. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
***.*****.******************** 

670. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactccgacagcgactccgattct	Protospacer
*********.************** ***** 

671. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactcggactcc	Protospacer
************.**************.** 

672. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattcc	Protospacer
***.*****.******************** 

673. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggactctgacagcgactcggattct	Protospacer
*********.**.***************** 

674. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactccgactccgacagcgactcggattct	Protospacer
****** **.******************** 

675. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattccgacagcgactctgactcg	Protospacer
.*********************** **.***

676. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactccgattccgacagtgactcggattcc	Protospacer
****** ***********.*********** 

677. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
************.********.******** 

678. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.*****.******************** 

679. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgactccgattct	Protospacer
************.*********** ***** 

680. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggatgctgacagcgactcggattcc	Protospacer
********** *.***************** 

681. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattcggacagcgactccgattct	Protospacer
************ *********** ***** 

682. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgattcggattct	Protospacer
************.********.******** 

683. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgattcggactccgacagcgactcggattct	Protospacer
***.*****.******************** 

684. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactccgattccgacagcgattctgactct	Protospacer
.***** *********************** 

685. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgactctgactcg	Protospacer
.***********.********.*********

686. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattccgactcc	Protospacer
************.***********.***** 

687. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattccgactcc	Protospacer
.***********************.***** 

688. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattccgactcc	Protospacer
.***********************.***** 

689. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggactcc	Protospacer
.*********************** ***** 

690. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattccgactct	Protospacer
.***********************.***** 

691. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattccgactct	Protospacer
.***********************.***** 

692. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattccgactcc	Protospacer
.***********************.***** 

693. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattcggactcg	Protospacer
.*********** *********** ******

694. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
.*********************** **.***

695. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattcggacagcgattcggactct	Protospacer
************ *********** ***** 

696. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattctgacagcgattcggactct	Protospacer
************.*********** ***** 

697. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggactccgacagcgattcggactcc	Protospacer
*********.************** ***** 

698. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattccgacagcgactcggactct	Protospacer
*********************.** ***** 

699. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
.*********************** **.***

700. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
.*********************** **.***

701. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
.*********************** **.***

702. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattcg	Protospacer
.*********************** **.***

703. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactcg	Protospacer
.***********.*********** ******

704. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgactcggattccgacagcgattctgactcg	CRISPR spacer
tgactcggattccgacagcgattccgattct	Protospacer
************************.**.** 

705. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagcgactccgattct	Protospacer
***************.**.*********** 

706. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggactctgatagtgactccgattcg	CRISPR spacer
cgattcggactctgacagtgattccgattca	Protospacer
***************.*****.********.

707. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactccgattctgacagtgattccgactct	Protospacer
***.** *********************** 

708. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactccgattctgacagtgattccgactct	Protospacer
***.** *********************** 

709. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgactcggactcc	Protospacer
*********************.** ***** 

710. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagtgattccgattca	Protospacer
*********.*****************.**.

711. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggactctgacagcgattccgactct	Protospacer
*********.********.*********** 

712. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagcgattcggactct	Protospacer
******************.***** ***** 

713. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
***.*****.******************** 

714. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
***.*****.******************** 

715. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgactcggactcc	Protospacer
*********************.** ***** 

716. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgactccgactct	Protospacer
***.*****************.******** 

717. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagtgattcggattct	Protospacer
************************ **.** 

718. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgattcggactcc	Protospacer
***.******************** ***** 

719. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattccgattctgacagcgattccgactct	Protospacer
****** ***********.*********** 

720. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactcggattctgacagtgattcagactct	Protospacer
***.******************** ***** 

721. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgattcggattccgacagtgattcggactcg	Protospacer
.***********.*********** ******

722. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattctgacagcgattcggactcc	Protospacer
******************.***** ***** 

723. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgattcggattccgacagtgactccgactcc	Protospacer
************.********.******** 

724. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
cgactccgattctgacagtgattccgactcc	Protospacer
***.** *********************** 

725. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgattcggattctgacagcgattcggactcg	Protospacer
.*****************.***** ******

726. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgattcggactctgacagtgattccgactct	Protospacer
.********.******************** 

727. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgattcggactcc	Protospacer
.********.********************.

728. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****************.***********.

729. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.***** ***********************.

730. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattccgactctgacagtgattcggactcc	Protospacer
.***** ***********************.

731. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****************.***********.

732. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****************.***********.

733. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****************.***********.

734. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.*****************.********.***

735. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattccgactct	Protospacer
.*****************.***** ******

736. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagcgattcggactct	Protospacer
.********.********.************

737. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattccgactccgacagtgattcggactct	Protospacer
.***** *****.******************

738. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
.**.******************** ******

739. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
.**.******************** ******

740. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgattcggattct	Protospacer
.********.*****************.***

741. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgactctgactct	Protospacer
.********************.** ******

742. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattccgactctgacagcgattcggactct	Protospacer
.***** ***********.************

743. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.*****************.**.*********

744. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactctgacagtgactcggactct	Protospacer
.**.*****************.*********

745. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.*****************.**.*********

746. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactcggacagcgattcggactct	Protospacer
.*********** *****.************

747. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.*****************.********.***

748. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagtgattcggactcc	Protospacer
.***********.*****************.

749. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgactcggactctgacagcgattcggactcc	Protospacer
***.**************.***********.

750. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggattccgacagtgattcggactcg	Protospacer
*********.**.***************** 

751. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
******************.********.**.

752. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***********.***********.

753. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggattctgacagcgattcggactcg	Protospacer
*********.********.*********** 

754. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattccgactctgacagcgattcggactcc	Protospacer
****** ***********.***********.

755. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactccgactcc	Protospacer
.*****.**************.*********

756. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgactccgactcg	Protospacer
******.**************.******** 

757. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggattctgacagcgattccgactcc	Protospacer
.*****.**.*********************

758. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattccgactct	Protospacer
.*****.***********************.

759. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****.***************** ******

760. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactcggacagcgattccgactct	Protospacer
******.***** *****************.

761. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****.***************** ******

762. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****.***************** ******

763. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.*****.***************** ******

764. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagcgattcggactct	Protospacer
******.***************** *****.

765. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattccgattcc	Protospacer
.*****.********************.***

766. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcggactctgacagtgattccgactct	Protospacer
******.***********.***********.

767. spacer 2.53|950511|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.903

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattcagactcagacagcgattcagactca	Protospacer
************ *********** ***** 

768. spacer 2.6|947385|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

cgactcagactccgacagcgactctgactccgacagcgactccgattcg	CRISPR spacer
tgactcggactccgacagcgactcggactccgacagcgactccgattct	Protospacer
.*****.***************** *********************** 

769. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.892

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
tgacagcgattcggattctgacagcgactctgactcg	Protospacer
.*****.********* ******************* 

770. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgactcggactctgacagcgattcggactcc	Protospacer
.********* ****************.**.

771. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
.**.****** *******************.

772. spacer 2.15|947997|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgactcggattctgacagcgattcggattcc	Protospacer
.********. *******************.

773. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
********** *****************  .

774. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgactcggactccgacagcgattcggattcg	Protospacer
.********* *.***************** 

775. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactcggactcc	Protospacer
.********.*****************.**.

776. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
.*****************.***** ***** 

777. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgactccgactcc	Protospacer
.*********************** **.**.

778. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactccgattcc	Protospacer
.********.************** *****.

779. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
.*****************.***** ***** 

780. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
.**.**************.***********.

781. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattctgactctgacagcgactccgattcg	Protospacer
.***** ***************** ***** 

782. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattcggacagcgactcggattcg	Protospacer
.********.** ***************** 

783. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcg	Protospacer
.***** *****.***************** 

784. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***** *****.*****************.

785. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***** *****.*****************.

786. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattcggacagcgactcggattcc	Protospacer
.********.** *****************.

787. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
.**.*****.******************** 

788. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
.**.*****.******************** 

789. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgattcggattcc	Protospacer
.***********.********.********.

790. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactccgacagcgactcggattcc	Protospacer
.***** *****.*****************.

791. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.********************.*****.**.

792. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagtgactcggattcc	Protospacer
.**.**************.***********.

793. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagtgactctgattcg	Protospacer
.*****************.***** ***** 

794. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggattctgacagcgactcggattcg	Protospacer
.**.*****.******************** 

795. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactctgacagcgattcggattcg	Protospacer
.***** **************.******** 

796. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattcggacagcgactcggattcc	Protospacer
.********.** *****************.

797. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggattcg	Protospacer
.**.*****************.******** 

798. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagtgactccgattcg	Protospacer
.*****************.***** ***** 

799. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactctgacagcgactcggactcc	Protospacer
.***** ********************.**.

800. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.********************.*****.**.

801. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.********************.*****.**.

802. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattcggactcc	Protospacer
.********************.*****.**.

803. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactccgattcc	Protospacer
.**.******************** *****.

804. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactcggactcc	Protospacer
.**.***********************.**.

805. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattccgactctgacagcgactccgattcc	Protospacer
.***** ***************** *****.

806. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
****** **************.******  *

807. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactctgacagcgattccgattcc	Protospacer
.********************.** *****.

808. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcagactctgacagcgactctgattca	Protospacer
.*****.***************** ***** 

809. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcagactctgacagcgactctgattca	Protospacer
.*****.***************** ***** 

810. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcagactctgacagcgactctgattca	Protospacer
.*****.***************** ***** 

811. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcagactctgacagcgactctgattca	Protospacer
.*****.***************** ***** 

812. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcagactctgacagcgactctgattca	Protospacer
.*****.***************** ***** 

813. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggatgctgacagcgactccgactcc	Protospacer
************************ **. *.

814. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactccgattcg	Protospacer
********** ************* *** * 

815. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
*********. ****************. **

816. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggatgctgacagcgactctgactct	Protospacer
***.******************** **. **

817. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
********** *.**************. **

818. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactcggactcc	Protospacer
********** ****************. *.

819. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggattctgacagcgactcggattcg	Protospacer
***.****** ***************** * 

820. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggattcg	Protospacer
*********. ***************** * 

821. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
********** * *************** * 

822. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
********** * *************** * 

823. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
********** *.*************** *.

824. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
********** *.*************** *.

825. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
********** *.*************** *.

826. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
********** *.*************** *.

827. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggattcc	Protospacer
********** *.*************** *.

828. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattcggacagcgactcggattcg	Protospacer
********** * *************** * 

829. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
*********. ****************. **

830. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
*********. ****************. **

831. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
***.****** ****************. **

832. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattcggacagcgactcggactct	Protospacer
********** * **************. **

833. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
********** **********.*****. **

834. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
********** **********.*****. **

835. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
********** *.**************. **

836. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
********** **********.*****. **

837. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
********** **********.*****. **

838. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
********** **********.*****. **

839. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
*********. ****************. **

840. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
*********. ****************. **

841. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
***.****** ****************. **

842. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactctgactct	Protospacer
********** ************* **. **

843. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.*********************** **.**.

844. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactccgattct	Protospacer
.********************.*****.**.

845. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgattca	Protospacer
.*****************.********.** 

846. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattccgactctgacagcgattccgattct	Protospacer
.***** ********************.**.

847. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggattctgacagcgattcggactct	Protospacer
.********.************** *****.

848. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
.**.**************.***********.

849. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactctgacagtgattccgactct	Protospacer
.**.**************.***********.

850. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattccgactctgacagcgattcggactct	Protospacer
.***** ***************** *****.

851. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.********************.** *****.

852. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgactcggactct	Protospacer
.********************.** *****.

853. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactcggacagcgattcggactct	Protospacer
.*********** *********** *****.

854. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggattct	Protospacer
.*********************** **.**.

855. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattccgattctgacagcgattccgactct	Protospacer
.***** **.********************.

856. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactccgacagcgattccgactct	Protospacer
.**.********.*****************.

857. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggattctgacagcgactccgactcg	Protospacer
.********.***********.******** 

858. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggattcggacagcgattccgacagc	Protospacer
*********.** ***************  *

859. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgactcg	Protospacer
.**.*****************.** 

860. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattctgacagcgattcg	Protospacer
.***** ***** *********** 

861. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgactctgacagcgattcg	Protospacer
.********.** *********** 

862. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgactcg	Protospacer
.**.*****************.** 

863. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgactcg	Protospacer
.**.*****************.** 

864. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgactcg	Protospacer
.**.*****************.** 

865. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcggacagcgactcg	Protospacer
.**.*****************.** 

866. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgactccgacagcgattca	Protospacer
.********.** *********** 

867. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattcggacagtgattcg	Protospacer
.***** ***********.***** 

868. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattcggacagtgactcg	Protospacer
.*****************.**.** 

869. spacer 2.22|948411|25|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattccgacagcgattcg	Protospacer
.**.******** *********** 

870. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattctgacagcgattct	Protospacer
.***** ***** ***********.

871. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattccgacagcgattcg	Protospacer
.**.******** *********** 

872. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgactccgacagcgattcg	Protospacer
.********.** *********** 

873. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattcggacagtgattcg	Protospacer
.***** ***********.***** 

874. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattccgacagtgattcg	Protospacer
.*********** *****.***** 

875. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactcggattctgacagcgattcg	Protospacer
.***** ***** *********** 

876. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcagacagcgattct	Protospacer
.**.********.***********.

877. spacer 2.22|948411|25|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgactccgattctgacagtgattcg	Protospacer
.*********** *****.***** 

878. spacer 2.22|948411|25|NZ_CP054303|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.84

cgactccgattcggacagcgattcc	CRISPR spacer
tgattccgattcagacagcgattct	Protospacer
.**.********.***********.

879. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagcgattcggactcc	Protospacer
.********************.*****.**.

880. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagtgactcggactcc	Protospacer
.*****************.********.**.

881. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactcggactccgacagtgactcggactcc	Protospacer
.*****************.********.**.

882. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.***** **************.********.

883. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.***** **************.********.

884. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.**.** ***********************.

885. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***** **.********************.

886. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***** **.********************.

887. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***** **.********************.

888. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactcg	Protospacer
.***** **.******************** 

889. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***** **.********************.

890. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***** **.********************.

891. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactctgacagcgattcggattcg	Protospacer
.**.***********************.** 

892. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgattcggattcg	Protospacer
.***** ********************.** 

893. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.***** **************.********.

894. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
*********************.*****.  *

895. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.***** **************.********.

896. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgattccgacagcgattcggactct	Protospacer
.********.**.*****************.

897. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.***  .************************

898. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
.***** ********************.**.

899. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.***** **************.********.

900. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactcggacagcgattcggactct	Protospacer
.*****.***** *****************.

901. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgattcggattct	Protospacer
.***** ********************.**.

902. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgactcggacagcgactcggactct	Protospacer
.*********** ********.********.

903. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactcggacagcgattcggactct	Protospacer
.*****.***** *****************.

904. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactctgacagcgattcggattct	Protospacer
.*****.********************.**.

905. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
.********************.*****.**.

906. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgactcggacagcgattctgactct	Protospacer
.*********** *********** *****.

907. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactccgactccgacagcgactcggactct	Protospacer
.***********.********.********.

908. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgattcggactcg	Protospacer
.*****************************.********.******** 

909. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggactctgacagcgactcggactcc	Protospacer
.**************************.**.*****************.

910. spacer 2.38|949539|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.918

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
tgattccgactctgacagcgattcggactccgacagtgattcggactcc	Protospacer
***************************************.*****. *.

911. spacer 2.38|949539|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.918

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
tgattccgactctgacagcgactcggactccgacagtgattcggattcg	Protospacer
*********************.*****************.****** * 

912. spacer 2.38|949539|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
tgattccgactctgacagcgactcggactctgacagtgactcggattcc	Protospacer
*********************.********.*************** *.

913. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattccgacagcgattccgactccgacagcgactcggattcg	Protospacer
 **************.******** ***************** 

914. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattctgacagcgactccgactccgacagcgactcggattct	Protospacer
 *****.***************** *****************.

915. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattccgacagtgactccgattcggacagcgactcggattcg	Protospacer
 ***********.********.******************** 

916. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattccgacagcgattccgactccgacagcgactcggattct	Protospacer
 **************.******** *****************.

917. spacer 2.40|949689|43|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattcggacagcgactccgactccgacagcgactcggattct	Protospacer
 ***** ***************** *****************.

918. spacer 2.40|949689|43|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattccgacagcgactctgactcggacagcgattcggattct	Protospacer
 *****************.**************.********.

919. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgactccgattctgacagtgactcggattcg	Protospacer
.**.*****.******************** 

920. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
.*****************.********.**.

921. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgactcggactct	Protospacer
.*****************.********.**.

922. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattcggactctgacagcgactcggattct	Protospacer
.***** ***********.***********.

923. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgattcggattct	Protospacer
.*****************.**.********.

924. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
.***** *****.*****************.

925. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggattcg	Protospacer
.***********.**************.** 

926. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.** ***********************.

927. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.** ***********************.

928. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
.***** **.********************.

929. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.***** ********************.**.

930. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattcg	Protospacer
.***** ********************.** 

931. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.***** **************.********.

932. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.***** ********************.**.

933. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.***** ********************.**.

934. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.***** ********************.**.

935. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactctgacagcgactcggattct	Protospacer
.***** ********************.**.

936. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactctgacagcgattcggattcg	Protospacer
.********************.*****.** 

937. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.** ***********************.

938. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
***.***********************.  *

939. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgactcggattct	Protospacer
.***********.**************.**.

940. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.** ***********************.

941. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggattctgacagcgactcggactct	Protospacer
.***** **.********************.

942. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactcggactctgacagcgactcggactct	Protospacer
.**.** ***********************.

943. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattcggactccgacagcgactcggactct	Protospacer
.***** *****.*****************.

944. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactccgactcggacagcgactcggactct	Protospacer
.**.******** *****************.

945. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactccgactctgacagcgactcggattct	Protospacer
.**.***********************.**.

946. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgactccgactccgacagcgactcggactct	Protospacer
.**.********.*****************.

947. spacer 2.45|950025|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.918

cgattcggactccgacagcgactcggattctgacagc-gactctgactcc	CRISPR spacer
cgattcggactccgacagcgactcggactctgacagtggattctgactc-	Protospacer
***************************.********. **.******** 

948. spacer 2.45|950025|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.918

cgattcggactccgacagcgactcggattctgacagcgactctgactcc	CRISPR spacer
ggactcggactctgacagcgactcggattctgacagcgactctgactcg	Protospacer
 **.********.*********************************** 

949. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactcggactctgacagcgattcggactcc	Protospacer
.***** ********************.**.

950. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgattcggactctgacagcgattcggattcc	Protospacer
.**.** ***********************.

951. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactcggattctgacagcgattcggattcc	Protospacer
.***** **.********************.

952. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
****** *********************  .

953. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgactctgacagcgactcggactcc	Protospacer
.********************.*****.**.

954. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactcggactccgacagcgattcggattcg	Protospacer
.***** *****.***************** 

955. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggattcc	Protospacer
.***** ***** ***************** 

956. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggattct	Protospacer
.***** ***** ***************** 

957. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.********.*****************.** 

958. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggattcc	Protospacer
.***** ***** ***************** 

959. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.********.*****************.** 

960. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattccgacagcgattccgattct	Protospacer
.********************.** ***** 

961. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggattct	Protospacer
.***** ***** ***************** 

962. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
ggactcggactctgacagcgactcggattct	Protospacer
 ********.**.***************** 

963. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattctgacagcgactcggatgct	Protospacer
.***********.*************** * 

964. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggactccgacagcgactcggactcc	Protospacer
.********.*****************.** 

965. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactcggattctgacagcgattcggattcc	Protospacer
.***********.********.******** 

966. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactctgactccgacagcgactcggatgct	Protospacer
****** **.****************** * 

967. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggactccgacagcgattccgactct	Protospacer
.********.**************.***** 

968. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
.********************.** ***** 

969. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattcggactcc	Protospacer
.*********** *********** ***** 

970. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattcggactcc	Protospacer
.*********** *********** ***** 

971. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattccgactcc	Protospacer
.*********** ***********.***** 

972. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgattcggattct	Protospacer
.*********************** **.** 

973. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattcggactct	Protospacer
.*********** *********** ***** 

974. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattcggactct	Protospacer
.*********** *********** ***** 

975. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattccgactcc	Protospacer
.*********** ***********.***** 

976. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattccgactcc	Protospacer
.*********** ***********.***** 

977. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***********.*********** ***** 

978. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
.********************.** ***** 

979. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***********.*********** ***** 

980. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
.********************.** ***** 

981. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgactcggactct	Protospacer
.********************.** ***** 

982. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***********.*********** ***** 

983. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
.********************.** ***** 

984. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattcggacagcgattccgactct	Protospacer
.*********** ***********.***** 

985. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***********.*********** ***** 

986. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggactct	Protospacer
.***********.*********** ***** 

987. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactccgattccgacagcgattcggactct	Protospacer
.***** ***************** ***** 

988. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgactctgactct	Protospacer
.***********.********.******** 

989. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgattcggattctgacagcgattcggactct	Protospacer
.*****************.***** ***** 

990. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgactcggattctgacagcgattccgactcc	Protospacer
.**.**************.*********** 

991. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagcgactcggactcc	Protospacer
.*****************.**.********.

992. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*****.***********.

993. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*****.***********.

994. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgactcggactcc	Protospacer
.********.***********.********.

995. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactctgacagtgattccgattca	Protospacer
.*********************** **.** 

996. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgactcggactcc	Protospacer
.********.***********.********.

997. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggattctgacagtgattcggactcc	Protospacer
.**.*****.********************.

998. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*****.***********.

999. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcggactcc	Protospacer
.***********.*****.***********.

1000. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactccgacagtgattcggactcg	Protospacer
.**.********.***************** 

1001. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagtgattcggattcg	Protospacer
.***********.**************.** 

1002. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggatgctgacagtgattcggactcg	Protospacer
.********. ******************* 

1003. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggattctgacagtgattcggactcg	Protospacer
.**.*****.******************** 

1004. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagtgactcggactcg	Protospacer
.********.***********.******** 

1005. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggattctgacagcgattcggactcc	Protospacer
.********.********.***********.

1006. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactctgacagtgactcggactcc	Protospacer
.**.*****************.********.

1007. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagtgattcggattcg	Protospacer
.***********.**************.** 

1008. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattcggactcggacagcgattcggatgct	Protospacer
************ *****.********. **

1009. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagcgattcggactct	Protospacer
.*****.***************** *****.

1010. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattccgactctgacagcgattccgattct	Protospacer
.***** ********************.**.

1011. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****.***********.***********.

1012. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****.***********.***********.

1013. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****.***********.***********.

1014. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattcggactctgacagtgattccgactct	Protospacer
.*****.***********.***********.

1015. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattccgactctgacagcgattcggactct	Protospacer
.***** ***************** *****.

1016. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgattccgattctgacagcgattccgactct	Protospacer
.***** **.********************.

1017. spacer 2.6|947385|49|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.898

cgactcagactccgacagcgactctgactccgacagcgactccgattcg	CRISPR spacer
ggatgcagactccgacagcgactctgactcggacagcgactccgactcg	Protospacer
 **. ************************* **************.***

1018. spacer 2.9|947571|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

tgattcggactccgacagcgacagtgattcggatgct	CRISPR spacer
cgactctgactccgacagcgacagtgattcggactct	Protospacer
.**.** **************************. **

1019. spacer 2.10|947631|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagcgattcggattctgacagcgactctgacagt	Protospacer
******.********* *****************  .

1020. spacer 2.10|947631|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.865

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagtgattccgattctgacagcgactctgacagt	Protospacer
************ *** *****************  .

1021. spacer 2.10|947631|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.865

cgacagtgattcggatgctgacagcgactctgactcc	CRISPR spacer
cgacagtgattccgattctgacagcgactctgacagt	Protospacer
************ *** *****************  .

1022. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
*********. *****************  .

1023. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggacgctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
*********. *****************  .

1024. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattcggattcggacagcgactccgactccgactcg	Protospacer
****** *****************.*********   

1025. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
***.** *********************  .

1026. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggattctgacagcgactcggactcc	Protospacer
***.****** ****************. *.

1027. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactctgactcg	Protospacer
********** ************* **. * 

1028. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgactcggattccgacagcgactcggattcc	Protospacer
.********* *.*************** *.

1029. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgattcggatgctgacagcgattcggactcc	Protospacer
***.*****************.*****. *.

1030. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgactcggattctgacagcgattcggattcc	Protospacer
.********* **********.****** *.

1031. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
********** **********.******. .

1032. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
********** **********.******. .

1033. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgactccgactcc	Protospacer
********** ************* **. *.

1034. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
********** *.**************. *.

1035. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattcggacagcgactcggactcc	Protospacer
********** * **************. *.

1036. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
********** *.**************. *.

1037. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattccgacagcgactcggactcc	Protospacer
********** *.**************. *.

1038. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggattctgacagcgattcggactcg	Protospacer
********** **********.*****. * 

1039. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
cgactcggactctgacagcgactcggactcc	Protospacer
*********. ****************. *.

1040. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgactcggattctgacagcgattcggactct	Protospacer
.********* **********.*****. **

1041. spacer 2.19|948243|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgactcggattccgacagcgactcggactct	Protospacer
.********* *.**************. **

1042. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgactcggacagcgactctgactccgattcg	Protospacer
.********************************.   

1043. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattcggactcggacagcgattcggatgct	Protospacer
************ *********** **. *.

1044. spacer 2.21|948357|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagcgattc--cgactcc	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg--	Protospacer
.***********.***********  ****   

1045. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
************.********.******  .

1046. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactccgacagt	Protospacer
************.*********** **.  *

1047. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **************.*********

1048. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **************.*********

1049. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **************.*********

1050. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgatgcggactccgacagcgattccgattct	Protospacer
.**. ****************.** ******

1051. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgactccgactctgacagcgattcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
***.***********************.  .

1052. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
.***** ********************.  *

1053. spacer 2.38|949539|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.898

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagtgactctgactct	Protospacer
.***** *********************************** **. **

1054. spacer 2.39|949611|55|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.909

cgattcggactctgacagtgactcggattcggacagcgactccgactccgactct	CRISPR spacer
cgattcggactctgacagcgactcggattcggacagcgattccgactccgacagc	Protospacer
******************.********************.************  .

1055. spacer 2.40|949689|43|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.884

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggattcggacagcgactctgactcggacagcgactcggatgct	Protospacer
 ***** ***********.********************* *.

1056. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
.**.**************.*********  *

1057. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
*********************.*****.  .

1058. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattctgacagcgactctgacagt	Protospacer
*********.************** ***  .

1059. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgattccgattctgacagcgactctgacagt	Protospacer
*********.************** ***  .

1060. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
****** **.******************  .

1061. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
****** **.******************  .

1062. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
.**.**.*********************  *

1063. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***  .*****.******************

1064. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***  .*****.******************

1065. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactctgactctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***  .*****.******************

1066. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
************.********.******   

1067. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

cgactcggattccgacagcgactcggattcg	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
************.********.******   

1068. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgactccgattcggacagcgactcggatgct	Protospacer
.***** ***** *************** * 

1069. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
****** ***********.********.  *

1070. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
***.   ***********.************

1071. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***************** ******

1072. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagtgattcggactct	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***************** ******

1073. spacer 2.52|950457|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcggatgct	Protospacer
.***********.*****.********. **

1074. spacer 2.4|947265|55|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.891

tgattcggattcggacagcgattccgactccgacagtgactccgactctgattcc	CRISPR spacer
cgactcggattcggacagcgattccgactccgacagtgactccgattctgacagc	Protospacer
.**.*****************************************.*****.  *

1075. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactcggacgctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   *** *.******************

1076. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactcggacgctgacagcgattcggattct	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
.***   *** ****************.***

1077. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactcggacgctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   *** *.******************

1078. spacer 2.15|947997|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactcggacgctgacagcgattcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   *** *.******************

1079. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggattctgacagcgactctgacagt	Protospacer
.********.************** **.  *

1080. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
***.   ***********.***** ******

1081. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
.**.*****************.******  .

1082. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgactcggactctgacagcgactccgacagt	Protospacer
.**.******************** **.  *

1083. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
***.   **************.*****.***

1084. spacer 2.18|948189|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgactcggattct	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
***.   ***********.***** ******

1085. spacer 2.19|948243|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgactcggatgctgacagcgactcggatgct	CRISPR spacer
tgattcggatgctgacagcgactctgactcc	Protospacer
.**.******************** **. *.

1086. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.838

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
ggatgcagactccgacagcgactctgactcggacagc	Protospacer
 **. * ***** ***************** ******

1087. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactctgacagcgactccgacagt	Protospacer
.**.*****************.******  .

1088. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
****** ***************** **.  .

1089. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
.**.******************** **.  *

1090. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.**.   ***************** ******

1091. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
***.   ***************** *****.

1092. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***********.***********.

1093. spacer 2.21|948357|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***********.***********.

1094. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgattcggactccgacagcgattcggatgct	Protospacer
.***********.*********** **. *.

1095. spacer 2.23|948459|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
.***** *****.***************  .

1096. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.806

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgatgcagattccgacagcgactccgattct	Protospacer
.**. *.**.************** ******

1097. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgatgcagattccgacagcgactccgattct	Protospacer
.**. *.**.************** ******

1098. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
.***** **.*****************.  *

1099. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
.***** **.*****************.  *

1100. spacer 2.40|949689|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.86

cgattccgacagcgactccgactcggacagcgactcggattcc	CRISPR spacer
ggatagtgacagcgattccgactccgacagcgactcggattcc	Protospacer
 ***  .********.******** ******************

1101. spacer 2.41|949755|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
.*****************.**.******  .

1102. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
.**.  ****************** *****.

1103. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgactccgactccgacagtgactcggacagc	Protospacer
.**.********.**************.  *

1104. spacer 2.41|949755|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.806

cgattccgactctgacagtgactcggattcc	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
.**.  ****************** *****.

1105. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.**.  .**************.*********

1106. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattccgactctgacagcgactcggactcc	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
***.  .**************.********.

1107. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactctgattcggacagcgattcggatagc	Protospacer
.********.** ***************  .

1108. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgactccgactctgacagcgactcggatagc	Protospacer
.*****.**************.******  .

1109. spacer 2.46|950097|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgactctgactctgacagcgattcggattct	CRISPR spacer
tgatgcggactccgacagcgattccgattct	Protospacer
.**. * *****.*********** ******

1110. spacer 2.46|950097|31|NZ_CP054303|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactcagacagcgatagcgactca	Protospacer
************ *********   **.** 

1111. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgatgcagattccgacagcgactccgattct	Protospacer
.**. *.***************** ***** 

1112. spacer 2.48|950241|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.806

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgatgcagattccgacagcgactccgattct	Protospacer
.**. *.***************** ***** 

1113. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

tgactcggattccgacagcgattctgactcg	CRISPR spacer
ggatgcagactccgacagcgactctgactcg	Protospacer
 **. *.**.***********.*********

1114. spacer 2.50|950349|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgattcggactctgatagtgactccgattcg	CRISPR spacer
ggactcggactctgacagtgactccgatctt	Protospacer
 **.***********.************.. 

1115. spacer 2.51|950403|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgattcggattcggacagcgattccgacagc	Protospacer
.*********** *****.*********   

1116. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgattccgactctgacagcgattcggatagt	Protospacer
****** ***************** **.  .

1117. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.**.   ***************** ******

1118. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgacagtgactctgacagcgattcggactct	Protospacer
***.   ***************** *****.

1119. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***********.***********.

1120. spacer 2.53|950511|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattccgactcc	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
***.   ***********.***********.

1121. spacer 2.53|950511|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806

tgattcagactctgacagcgattc--cgactcc	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg--	Protospacer
.*****.*****.***********  ****   

1122. spacer 2.13|947847|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.857

tgattcggattcggacagcgactccgactctgacagcgattcggactct	CRISPR spacer
cgattcggattcggacagcgactcggattctgacagcgattcggatagc	Protospacer
.*********************** **.*****************.  .

1123. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.811

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgactccgactcggacagcgactctgactccgattcg	Protospacer
.**.*****.***********************.   

1124. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.811

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattctgacagcgactctgacagtgattcc	Protospacer
************ ***************  .**.  *

1125. spacer 2.16|948051|37|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.811

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
tgattccgattctgacagcgactctgacagtgattcc	Protospacer
************ ***************  .**.  *

1126. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattcggactctgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 **.   *****.********.*********

1127. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattcggactctgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 **.   *****.********.*********

1128. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattcggactctgacagcgactcggattct	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 **.   *****.********.*********

1129. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.811

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgactctgactcggacagcgactcggactccgattcg	Protospacer
.*****.***************** ********.   

1130. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.811

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactcggacagcgactccgactctgacagt	Protospacer
.***  .*****************.*****.*****.

1131. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

cgactcggactccgacagcgactcggattct	CRISPR spacer
tgactccgactccgacagtgactcggacagc	Protospacer
.***** ***********.********.  .

1132. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

cgactcggactccgacagcgactcggattct	CRISPR spacer
ggacagcgactccgactccgactcggattcg	Protospacer
 ***   *********  ************ 

1133. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

cgactcggactccgacagcgactcggattct	CRISPR spacer
ggatgcagactccgacagcgactctgactcg	Protospacer
 **. *.***************** **.** 

1134. spacer 2.23|948459|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg	Protospacer
***.*****************.***    * 

1135. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactccgacagcgattcggatagt	Protospacer
.**.********.**************.  .

1136. spacer 2.24|948513|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgattccgactccgacagcgattcggatagt	Protospacer
.**.********.**************.  .

1137. spacer 2.26|948639|31|NZ_CP054303|CRT matches to KP790009 (Gordonia phage Gmala1, complete genome) position: , mismatch: 7, identity: 0.774

cgactcggattctgactccgactctgattcc	CRISPR spacer
tgaagaagattctgactctgactctgattct	Protospacer
.**   .***********.***********.

1138. spacer 2.26|948639|31|NZ_CP054303|CRT matches to KP790008 (Gordonia phage GordTnk2, complete genome) position: , mismatch: 7, identity: 0.774

cgactcggattctgactccgactctgattcc	CRISPR spacer
tgaagaagattctgactctgactctgattct	Protospacer
.**   .***********.***********.

1139. spacer 2.32|949107|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.857

tgattcggactctgacagcgactcggattccgacagcgactcggactct	CRISPR spacer
cgattcggactctgacagcgactcggattctgacagcgattcggatagc	Protospacer
.*****************************.********.*****.  .

1140. spacer 2.38|949539|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.857

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagtgacagtgactct	Protospacer
.***** *********************************   **. **

1141. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgattcggatagt	Protospacer
.***********.********.*****.  .

1142. spacer 2.44|949971|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgattccgactccgacagcgattcggatagt	Protospacer
.***********.********.*****.  .

1143. spacer 2.46|950097|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.774

cgactctgactctgacagcgattcggattct	CRISPR spacer
cgactctgactccgacagcgattcg------	Protospacer
************.************      

1144. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgactcggattccgacagcgactcggattcg	CRISPR spacer
tgatgcagattcggacagcgactcggactct	Protospacer
.**. *.***** **************.** 

1145. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgactcggattccgacagcgactcggattcg	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **.***********.******** 

1146. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgactcggattccgacagcgactcggattcg	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **.***********.******** 

1147. spacer 2.48|950241|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgactcggattccgacagcgactcggattcg	CRISPR spacer
agacagcgactccgacagcgattcggattct	Protospacer
 ***   **.***********.******** 

1148. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
.***********.*********** **.   

1149. spacer 2.49|950295|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactcggattctgacagcgattcggatagc	Protospacer
.***********.*********** **.   

1150. spacer 2.50|950349|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

cgattcggactctgatagtgactccgattcg	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
.**.   ********.************** 

1151. spacer 2.50|950349|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.774

cgattcggactctgatagtgactccgattcg	CRISPR spacer
tgacagcgactctgacagtgactccgattct	Protospacer
.**.   ********.************** 

1152. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
.**.   **.******************** 

1153. spacer 2.51|950403|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

cgattcggattctgacagtgattccgactcg	CRISPR spacer
tgacagcgactctgacagtgattccgactct	Protospacer
.**.   **.******************** 

1154. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgactcggactctgacagcgattcggatagc	Protospacer
.**.**************.********.  .

1155. spacer 2.52|950457|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.774

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.**.   ***********.***********.

1156. spacer 2.8|947499|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.837

tgattccgatgctgacagcgattcggactccgacagcgactcggattct	CRISPR spacer
tgacagtgactctgacagcgattcggactctgacagcgactcggattcg	Protospacer
***.  .**. *******************.***************** 

1157. spacer 2.9|947571|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.784

tgattcggactccgacagcgacagtgattcggatgct	CRISPR spacer
tgacagcgactccgactccgacagtgattcggattcc	Protospacer
***.   *********  **************** *.

1158. spacer 2.11|947691|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.814

cgattcggactccgacagcgactctgactccgattccgattcc	CRISPR spacer
tgactcggactccgacagcgactcggactccgacagtgactcc	Protospacer
.**.******************** ********.  .**.***

1159. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.784

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgacagtgattcggacagcgactccgactccgactcc	Protospacer
.**.  .*****************.*********  *

1160. spacer 2.16|948051|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.784

tgattccgattcggacagcgactctgactccgacagc	CRISPR spacer
cgattcggattctgacagcgactctgacagtgactcc	Protospacer
.***** ***** ***************  .***  *

1161. spacer 2.18|948189|31|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.742

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgacagtgactctgacagcgattcggactcc	Protospacer
.**.   **************.*****.**.

1162. spacer 2.18|948189|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742

tgattcggactctgacagcgactcggattct	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg	Protospacer
.***********.********.***    * 

1163. spacer 2.20|948297|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.784

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
cgacagtgattcggacagcgactccgactccgactcc	Protospacer
.***  .**.**************.*********  *

1164. spacer 2.21|948357|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.742

tgattcggactctgacagcgattccgactcc	CRISPR spacer
cgacagtgactcggacagcgactccgactct	Protospacer
.**.   ***** ********.********.

1165. spacer 2.23|948459|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 8, identity: 0.742

cgactcggactccgacagcgactcggattct	CRISPR spacer
cgactctgactccgacagcgattcg------	Protospacer
****** **************.***      

1166. spacer 2.38|949539|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.837

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
tgacagtgactctgacagcgattcggactctgacagcgactcggattcg	Protospacer
***.  .***********************.*****.********* * 

1167. spacer 2.44|949971|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.742

tgattccgactctgacagcgactcggactcc	CRISPR spacer
cgacagtgactcggacagcgactccgactct	Protospacer
.**.  .***** *********** *****.

1168. spacer 2.49|950295|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg	Protospacer
.**.*****.**************     **

1169. spacer 2.52|950457|31|NZ_CP054303|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742

tgattcggactctgacagtgattcggactct	CRISPR spacer
cgattcggactccgacagcgattcgtcgacg	Protospacer
.***********.*****.******    * 

1170. spacer 2.53|950511|31|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.742

tgattcagactctgacagcgattccgactcc	CRISPR spacer
cgacagtgactcggacagcgactccgactct	Protospacer
.**.   ***** ********.********.

1171. spacer 2.9|947571|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.757

tgattcggactccgacagcgacagtgattcggatgct	CRISPR spacer
ggacagcgattccgacagcgacagtgactcggattcg	Protospacer
 **.   **.*****************.****** * 

1172. spacer 2.9|947571|37|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.757

tgattcggactccgacagcgacagtgattcggatgct	CRISPR spacer
ggacagcgattccgacagcgacagcgattcggattcc	Protospacer
 **.   **.**************.********* *.

1173. spacer 2.11|947691|43|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.791

cgattcggactccgacagcgactctgactccgattccgattcc	CRISPR spacer
cgattctgactctgacagcgactctgactccgacagcgacagt	Protospacer
****** *****.********************.  ***.  .

1174. spacer 2.11|947691|43|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.791

cgattcggactccgacagcgactctgactccgattccgattcc	CRISPR spacer
cgattcggactccgacagcgactcggactctgacagtggattc	Protospacer
************************ *****.**.  .*. *.*

1175. spacer 2.24|948513|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 9, identity: 0.71

tgactccgactctgacagcgattcggactcc	CRISPR spacer
cgactctgactccgacagcgattcg------	Protospacer
.*****.*****.************      

1176. spacer 2.38|949539|49|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.816

tgattccgactctgacagcgattcggactccgacagtgactcggatgct	CRISPR spacer
cgacagtgactctgacagcgattcggactccgacagtgactccgactcc	Protospacer
.**.  .*********************************** **. *.

1177. spacer 2.42|949809|67|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 9, identity: 0.866

cgactccgactccgacagcgattcggactctgatagtgactccgattcggacagcgactc	CRISPR spacer
cgactctgactcggacagcgattcggactctgatagtgactccgattcggacagcgactc	Protospacer
******.***** ***********************************************

1178. spacer 2.1|947007|55|NZ_CP054303|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.818

cgactcggattcggacagtgattcggactccgacagcgacagtgattcggattct-----	CRISPR spacer
cgactcggattcggacagcgattccgactccgacagc------gattcggatagtgacag	Protospacer
******************.***** ************      *********  *     

1179. spacer 2.20|948297|37|NZ_CP054303|CRT matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 10, identity: 0.73

tgactccgactcggacagcgactctgactccgacagc	CRISPR spacer
ttcgggcagctcggacagcgactccgacaccgacacc	Protospacer
*     *..***************.*** ****** *

1180. spacer 2.49|950295|31|NZ_CP054303|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 10, identity: 0.677

tgactcggattccgacagcgattctgactcg	CRISPR spacer
cgactctgactccgacagcgattcg------	Protospacer
.***** **.**************       

1181. spacer 2.12|947757|67|NZ_CP054303|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 16, identity: 0.761

tgactcggattctgacagcgattctgactcggacagcgactctgactccgacagcgactc	CRISPR spacer
cgactcggattctgacagcgactctgactcggacagcgactcggactccgattcggacag	Protospacer
.********************.******************** ********.   ***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8104 : 80694 78 Pseudomonas_phage(38.46%) protease,tail,plate,head,capsid,tRNA,terminase,transposase NA
DBSCAN-SWA_2 842384 : 851847 8 Dickeya_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_3 1118877 : 1199049 89 Enterobacteria_phage(26.32%) holin,protease,tail,portal,tRNA,terminase,integrase,transposase attL 1109162:1109176|attR 1152002:1152016
DBSCAN-SWA_4 1309484 : 1360113 65 Enterobacteria_phage(21.57%) holin,tail,terminase,integrase,transposase attL 1312164:1312179|attR 1366717:1366732
DBSCAN-SWA_5 1396597 : 1476090 79 Klebsiella_phage(45.83%) transposase,holin,protease,tail,plate,head,capsid,terminase,integrase,portal attL 1401969:1401985|attR 1446252:1446268
DBSCAN-SWA_6 1669336 : 1680223 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 2444064 : 2494845 78 Cronobacter_phage(22.58%) terminase,holin,head,integrase attL 2442651:2442678|attR 2491899:2491926
DBSCAN-SWA_8 2735341 : 2742244 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_9 2954157 : 3040789 87 Escherichia_phage(20.0%) protease,tail,holin,head,portal,capsid,tRNA,terminase,integrase,transposase attL 2976888:2976912|attR 3017759:3017783
DBSCAN-SWA_10 3205072 : 3288406 93 Klebsiella_phage(71.43%) protease,tail,holin,head,capsid,tRNA,terminase,integrase,portal attL 3200359:3200374|attR 3298370:3298385
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054304
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14907 : 62475 42 uncultured_Caudovirales_phage(27.27%) transposase,bacteriocin NA
DBSCAN-SWA_2 117112 : 173406 51 uncultured_Caudovirales_phage(31.25%) transposase,holin,integrase,protease attL 106005:106020|attR 152432:152447
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP054305
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31690 : 37940 8 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_2 84207 : 107109 22 Escherichia_phage(37.5%) transposase,integrase attL 81531:81546|attR 86461:86476
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage