Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044403 Escherichia coli strain NMBU-W10C18 chromosome, complete genome 3 crisprs RT,DEDDh,c2c9_V-U4,cas3,DinG,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 11 11 0
NZ_CP044406 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_04, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP044402 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP044404 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP044405 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_03, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP044403
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044403_1 643093-643242 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044403_2 4026096-4026731 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044403_3 4053867-4054200 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044403_2 2.1|4026122|35|NZ_CP044403|CRT 4026122-4026156 35 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246934-246968 0 1.0
NZ_CP044403_2 2.16|4026488|32|NZ_CP044403|PILER-CR 4026488-4026519 32 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42679-42710 1 0.969
NZ_CP044403_2 2.7|4026488|35|NZ_CP044403|CRT,CRISPRCasFinder 4026488-4026522 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP044403_3 3.3|4054018|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR 4054018-4054049 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP044403_2 2.13|4026305|32|NZ_CP044403|PILER-CR 4026305-4026336 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 39410-39441 7 0.781
NZ_CP044403_2 2.12|4026244|32|NZ_CP044403|PILER-CR 4026244-4026275 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP044403_2 2.15|4026427|32|NZ_CP044403|PILER-CR 4026427-4026458 32 KC847113 Bacillus phage PBP180, complete sequence 100-131 8 0.75
NZ_CP044403_3 3.2|4053957|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR 4053957-4053988 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP044403_3 3.5|4054140|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR 4054140-4054171 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP044403_3 3.5|4054140|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR 4054140-4054171 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP044403_2 2.11|4026183|32|NZ_CP044403|PILER-CR 4026183-4026214 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP044403_2 2.15|4026427|32|NZ_CP044403|PILER-CR 4026427-4026458 32 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20183 9 0.719
NZ_CP044403_2 2.15|4026427|32|NZ_CP044403|PILER-CR 4026427-4026458 32 NC_049837 Klebsiella phage vB_KpnS_Alina, complete genome 13583-13614 9 0.719
NZ_CP044403_2 2.16|4026488|32|NZ_CP044403|PILER-CR 4026488-4026519 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 287201-287232 9 0.719
NZ_CP044403_2 2.15|4026427|32|NZ_CP044403|PILER-CR 4026427-4026458 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 179050-179081 10 0.688
NZ_CP044403_2 2.6|4026427|35|NZ_CP044403|CRT,CRISPRCasFinder 4026427-4026461 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 2.1|4026122|35|NZ_CP044403|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

caagtgatgtccatcatcgcatccagtgcgtccgg	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtccgg	Protospacer
***********************************

2. spacer 2.16|4026488|32|NZ_CP044403|PILER-CR matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
atgagattaaaatactcagcactcttactcgc	Protospacer
*******************.************

3. spacer 2.7|4026488|35|NZ_CP044403|CRT,CRISPRCasFinder matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943

atgagattaaaatactcagtactcttactcgccga	CRISPR spacer
atgagattaaaatactcagcactcttactcgccgt	Protospacer
*******************.************** 

4. spacer 3.3|4054018|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

5. spacer 2.13|4026305|32|NZ_CP044403|PILER-CR matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.781

gatcgcctgctccagcgtcactccctgcccct	CRISPR spacer
gttcgcctgctccagcgtcaatgccccctccc	Protospacer
* ****************** * **. *.**.

6. spacer 2.12|4026244|32|NZ_CP044403|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

7. spacer 2.15|4026427|32|NZ_CP044403|PILER-CR matches to KC847113 (Bacillus phage PBP180, complete sequence) position: , mismatch: 8, identity: 0.75

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ttctctctaatgtagttaataaagtcgatggt	Protospacer
*  .*.*.**** ************* ****.

8. spacer 3.2|4053957|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

9. spacer 3.5|4054140|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

10. spacer 3.5|4054140|32|NZ_CP044403|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

11. spacer 2.11|4026183|32|NZ_CP044403|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****  

12. spacer 2.15|4026427|32|NZ_CP044403|PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggc	Protospacer
.  .   ************ *** ********

13. spacer 2.15|4026427|32|NZ_CP044403|PILER-CR matches to NC_049837 (Klebsiella phage vB_KpnS_Alina, complete genome) position: , mismatch: 9, identity: 0.719

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
acattggcgatgaagttaataacgtgtatggc	Protospacer
  *..  *.************* ** ******

14. spacer 2.16|4026488|32|NZ_CP044403|PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
cgggaattaacatactcggtactcttaccgtc	Protospacer
  *..***** ******.**********.  *

15. spacer 2.15|4026427|32|NZ_CP044403|PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 10, identity: 0.688

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
gtagattcaatgaagttaataaaaactatgat	Protospacer
  *  ..****************. *****..

16. spacer 2.6|4026427|35|NZ_CP044403|CRT,CRISPRCasFinder matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657

taacccccaatgaagttaataaagtctatggccga	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggcgat	Protospacer
.  .   ************ *** ******** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1031849 : 1093447 52 Emiliania_huxleyi_virus(12.5%) transposase,tRNA,protease,plate NA
DBSCAN-SWA_2 1787138 : 1885743 90 Escherichia_phage(37.29%) portal,capsid,tRNA,holin,lysis,terminase,head,protease,tail,plate,integrase attL 1800660:1800675|attR 1838709:1838724
DBSCAN-SWA_3 2071794 : 2133042 75 Escherichia_phage(37.5%) portal,capsid,holin,lysis,tRNA,terminase,head,tail,transposase,integrase attL 2065250:2065264|attR 2092390:2092404
DBSCAN-SWA_4 2354403 : 2412596 68 Escherichia_phage(50.0%) tRNA,holin,lysis,terminase,tail NA
DBSCAN-SWA_5 2559551 : 2666811 110 Enterobacteria_phage(40.74%) portal,capsid,lysis,terminase,head,tail,transposase NA
DBSCAN-SWA_6 3148803 : 3219820 60 Escherichia_phage(17.39%) terminase,head,protease,tail,transposase NA
DBSCAN-SWA_7 3242964 : 3270226 34 Escherichia_phage(46.88%) portal,capsid,tRNA,holin,lysis,terminase,head,tail,plate NA
DBSCAN-SWA_8 3276462 : 3281960 11 Enterobacteria_phage(30.0%) integrase attL 3275884:3275897|attR 3286422:3286435
DBSCAN-SWA_9 3319490 : 3328933 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_10 3542555 : 3614618 88 Enterobacteria_phage(64.41%) portal,tRNA,lysis,holin,terminase,head,coat,integrase attL 3574234:3574256|attR 3622357:3622379
DBSCAN-SWA_11 4001029 : 4009798 7 Escherichia_phage(71.43%) integrase attL 3991551:3991563|attR 4013468:4013480
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044404
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1220 : 39810 33 Enterobacteria_phage(23.08%) integrase,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage