Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054016 Staphylococcus warneri strain FDAARGOS_754 plasmid unnamed, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP054017 Staphylococcus warneri strain FDAARGOS_754 chromosome, complete genome 3 crisprs DEDDh,DinG,cas3,csa3,WYL 0 2 8 0

Results visualization

1. NZ_CP054016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7132 4 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_2 14421 : 17951 3 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_3 28260 : 28854 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_4 37336 : 41132 4 Staphylococcus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054017_1 1378516-1378599 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054017_2 1440421-1440510 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054017_3 1446644-1446737 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054017_3 3.1|1446676|30|NZ_CP054017|CRISPRCasFinder 1446676-1446705 30 NZ_CP032837 Klebsiella pneumoniae strain INF237 plasmid pINF237_04, complete sequence 12996-13025 5 0.833
NZ_CP054017_1 1.1|1378543|30|NZ_CP054017|CRISPRCasFinder 1378543-1378572 30 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 284262-284291 9 0.7

1. spacer 3.1|1446676|30|NZ_CP054017|CRISPRCasFinder matches to NZ_CP032837 (Klebsiella pneumoniae strain INF237 plasmid pINF237_04, complete sequence) position: , mismatch: 5, identity: 0.833

ttttctcttcggttcgccttagcttgcgct-	CRISPR spacer
atttttcttcggttcgctttagc-tgcgccc	Protospacer
 ***.************.***** *****. 

2. spacer 1.1|1378543|30|NZ_CP054017|CRISPRCasFinder matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7

gccgttggtgaattcaatgtgagttgttga	CRISPR spacer
atgatcggtgaattcaatgtgagtcgtact	Protospacer
.. .*.******************.**   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 189739 : 198209 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 755229 : 764256 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 801007 : 808576 7 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_4 889666 : 925445 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_5 952114 : 1023518 79 uncultured_Caudovirales_phage(84.48%) tRNA,protease,integrase,holin,portal,terminase,tail,capsid attL 973665:973682|attR 1027287:1027304
DBSCAN-SWA_6 1950402 : 2015506 71 Staphylococcus_phage(41.67%) terminase,protease,integrase,transposase attL 2004775:2004804|attR 2018710:2018739
DBSCAN-SWA_7 2353836 : 2360846 8 Staphylococcus_phage(14.29%) NA NA
DBSCAN-SWA_8 2373602 : 2387075 12 uncultured_Caudovirales_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage