Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053960 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed3 0 crisprs NA 0 0 0 0
NZ_CP053959 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053957 Staphylococcus capitis strain FDAARGOS_753 chromosome, complete genome 3 crisprs csa3,DEDDh,cas3,DinG 1 1 7 0
NZ_CP053958 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1 2 crisprs NA 0 2 0 0

Results visualization

1. NZ_CP053957
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053957_1 1625074-1625162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053957_2 1638699-1638791 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053957_3 2094383-2094490 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 20192-20216 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 1542802-1542826 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 1710321-1710345 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 1767885-1767909 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 1797093-1797117 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 1927025-1927049 0 1.0
NZ_CP053957_1 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder 1625106-1625130 25 NZ_CP053957.1 2045993-2046017 0 1.0

1. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 20192-20216, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

2. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 1542802-1542826, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

3. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 1710321-1710345, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

4. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 1767885-1767909, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

5. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 1797093-1797117, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

6. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 1927025-1927049, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

7. spacer 1.1|1625106|25|NZ_CP053957|CRISPRCasFinder matches to position: 2045993-2046017, mismatch: 0, identity: 1.0

agaaattctctatgttggggccccg	CRISPR spacer
agaaattctctatgttggggccccg	Protospacer
*************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053957_3 3.1|2094423|28|NZ_CP053957|CRISPRCasFinder 2094423-2094450 28 KP063903 Bacillus phage BalMu-1 copy 2, complete genome 18374-18401 6 0.786
NZ_CP053957_3 3.1|2094423|28|NZ_CP053957|CRISPRCasFinder 2094423-2094450 28 KP063902 Bacillus phage BalMu-1 copy 1, complete genome 18386-18413 6 0.786

1. spacer 3.1|2094423|28|NZ_CP053957|CRISPRCasFinder matches to KP063903 (Bacillus phage BalMu-1 copy 2, complete genome) position: , mismatch: 6, identity: 0.786

tgctcttcgtggtttacaatcgcttttg	CRISPR spacer
ttttgaacgtggtttacaatcgctttta	Protospacer
* .*   ********************.

2. spacer 3.1|2094423|28|NZ_CP053957|CRISPRCasFinder matches to KP063902 (Bacillus phage BalMu-1 copy 1, complete genome) position: , mismatch: 6, identity: 0.786

tgctcttcgtggtttacaatcgcttttg	CRISPR spacer
ttttgaacgtggtttacaatcgctttta	Protospacer
* .*   ********************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1006832 : 1105789 113 Staphylococcus_phage(48.15%) terminase,tRNA,protease,plate,tail,capsid,head,integrase,portal,holin attL 1019381:1019399|attR 1111416:1111434
DBSCAN-SWA_2 1233748 : 1245289 8 uncultured_Mediterranean_phage(57.14%) tRNA NA
DBSCAN-SWA_3 1363344 : 1375601 13 Bacillus_phage(37.5%) NA NA
DBSCAN-SWA_4 1799967 : 1808437 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2060690 : 2067977 10 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_6 2151363 : 2201238 47 Staphylococcus_phage(60.0%) integrase,transposase attL 2158372:2158411|attR 2208093:2208132
DBSCAN-SWA_7 2418046 : 2431805 19 Staphylococcus_phage(42.86%) terminase,integrase attL 2419135:2419149|attR 2436831:2436845
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053958
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053958_1 429-541 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053958_2 14548-14660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053958_1 1.1|460|51|NZ_CP053958|CRISPRCasFinder 460-510 51 NZ_CP053958 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1 460-510 0 1.0
NZ_CP053958_1 1.1|460|51|NZ_CP053958|CRISPRCasFinder 460-510 51 NZ_CP053958 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1 14579-14629 0 1.0
NZ_CP053958_2 2.1|14579|51|NZ_CP053958|CRISPRCasFinder 14579-14629 51 NZ_CP053958 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1 460-510 0 1.0
NZ_CP053958_2 2.1|14579|51|NZ_CP053958|CRISPRCasFinder 14579-14629 51 NZ_CP053958 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1 14579-14629 0 1.0
NZ_CP053958_1 1.1|460|51|NZ_CP053958|CRISPRCasFinder 460-510 51 NZ_CP023971 Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence 6757-6807 3 0.941
NZ_CP053958_1 1.1|460|51|NZ_CP053958|CRISPRCasFinder 460-510 51 NZ_CP014131 Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed2, complete sequence 4640-4690 3 0.941
NZ_CP053958_2 2.1|14579|51|NZ_CP053958|CRISPRCasFinder 14579-14629 51 NZ_CP023971 Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence 6757-6807 3 0.941
NZ_CP053958_2 2.1|14579|51|NZ_CP053958|CRISPRCasFinder 14579-14629 51 NZ_CP014131 Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed2, complete sequence 4640-4690 3 0.941

1. spacer 1.1|460|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP053958 (Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgattaaacgaattataacacctattatatagagaataaaga	Protospacer
***************************************************

2. spacer 1.1|460|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP053958 (Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgattaaacgaattataacacctattatatagagaataaaga	Protospacer
***************************************************

3. spacer 2.1|14579|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP053958 (Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgattaaacgaattataacacctattatatagagaataaaga	Protospacer
***************************************************

4. spacer 2.1|14579|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP053958 (Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgattaaacgaattataacacctattatatagagaataaaga	Protospacer
***************************************************

5. spacer 1.1|460|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP023971 (Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.941

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgatcaaacgaattataacacctattatatagaggataaagc	Protospacer
*************.*****************************.****** 

6. spacer 1.1|460|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP014131 (Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.941

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgatcaaacgaattataacacctattatatagaggataaagc	Protospacer
*************.*****************************.****** 

7. spacer 2.1|14579|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP023971 (Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.941

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgatcaaacgaattataacacctattatatagaggataaagc	Protospacer
*************.*****************************.****** 

8. spacer 2.1|14579|51|NZ_CP053958|CRISPRCasFinder matches to NZ_CP014131 (Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.941

ctataataatgattaaacgaattataacacctattatatagagaataaaga	CRISPR spacer
ctataataatgatcaaacgaattataacacctattatatagaggataaagc	Protospacer
*************.*****************************.****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage