Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053995 Bacillus cereus strain FDAARGOS_780 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053997 Bacillus cereus strain FDAARGOS_780 chromosome, complete genome 4 crisprs csa3,WYL,cas3,RT,DinG,cas14k,DEDDh,cas14j 0 0 429 0
NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 1 crisprs RT,cas14j,csa3 0 1 0 0
NZ_CP053996 Bacillus cereus strain FDAARGOS_780 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP053996
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 50387 72 Bacillus_phage(55.32%) capsid,tail,portal,plate,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053997
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053997_1 673189-673316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053997_2 1960478-1960733 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053997_3 3365553-3365650 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053997_4 5076040-5076141 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1114 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_2 12973 : 15241 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 33105 : 37205 4 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_4 40439 : 41555 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_5 57458 : 60506 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_6 63883 : 64555 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_7 77559 : 79077 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_8 86062 : 88107 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_9 93310 : 103233 8 Mycobacterium_phage(66.67%) transposase NA
DBSCAN-SWA_10 112216 : 112981 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_11 117565 : 118228 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_12 123972 : 124377 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 130954 : 131509 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 137982 : 139413 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_15 142498 : 143524 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 151427 : 154017 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_17 169601 : 170420 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 173825 : 175388 3 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_19 179283 : 182686 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_20 190215 : 192822 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_21 211632 : 213180 1 Campylobacter_virus(100.0%) transposase NA
DBSCAN-SWA_22 232068 : 232383 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_23 241844 : 245452 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_24 263715 : 265272 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_25 270328 : 272272 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_26 276281 : 283205 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_27 291909 : 293367 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_28 306940 : 309434 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_29 315536 : 321195 5 Streptococcus_phage(75.0%) transposase NA
DBSCAN-SWA_30 333171 : 334653 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_31 342942 : 344547 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_32 347926 : 350914 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_33 356541 : 360194 3 Cafeteria_roenbergensis_virus(33.33%) NA NA
DBSCAN-SWA_34 369805 : 374652 3 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_35 384413 : 385211 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_36 390468 : 391224 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_37 400077 : 400950 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_38 424848 : 424989 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 432114 : 434131 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_40 441625 : 442627 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_41 462258 : 462924 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_42 471087 : 477861 5 Indivirus(50.0%) protease NA
DBSCAN-SWA_43 482257 : 497847 20 Geobacillus_phage(20.0%) NA NA
DBSCAN-SWA_44 507845 : 509225 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_45 522120 : 522882 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_46 531043 : 532477 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 545777 : 555373 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_48 559947 : 560451 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_49 573323 : 573701 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_50 580787 : 584923 3 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_51 592563 : 592902 1 Saudi_moumouvirus(100.0%) NA NA
DBSCAN-SWA_52 599068 : 599932 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_53 605801 : 606968 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_54 610089 : 611052 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 615109 : 616132 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_56 622490 : 631074 9 Erysipelothrix_phage(25.0%) NA NA
DBSCAN-SWA_57 639924 : 640557 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_58 652396 : 676655 26 Bacillus_phage(65.22%) head,portal,tail,capsid,protease,integrase,terminase attL 647636:647651|attR 676848:676863
DBSCAN-SWA_59 680347 : 692123 19 Bacillus_phage(93.75%) integrase attL 675477:675493|attR 692945:692961
DBSCAN-SWA_60 695230 : 695395 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_61 705769 : 710006 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_62 722017 : 723388 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_63 729994 : 733694 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_64 744004 : 747045 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_65 750068 : 755307 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_66 761592 : 762318 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_67 768297 : 777446 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_68 781783 : 782884 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_69 797289 : 800043 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_70 816778 : 817540 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_71 824441 : 825794 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_72 841827 : 842412 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_73 845685 : 847074 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_74 854208 : 859093 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_75 875179 : 878554 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_76 884773 : 885424 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 900951 : 903892 2 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_78 909370 : 912436 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 915497 : 922655 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_80 952237 : 953781 4 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_81 959697 : 960830 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_82 965974 : 974102 10 Bacillus_phage(75.0%) integrase attL 973283:973299|attR 975663:975679
DBSCAN-SWA_83 977105 : 979383 5 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_84 989622 : 990741 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_85 1003536 : 1017030 13 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_86 1021623 : 1023579 4 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_87 1027818 : 1033380 5 Acanthamoeba_polyphaga_moumouvirus(50.0%) NA NA
DBSCAN-SWA_88 1039858 : 1041323 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_89 1047587 : 1048298 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 1060808 : 1069611 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_91 1076080 : 1083560 5 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_92 1087019 : 1090121 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_93 1096632 : 1100764 2 Orpheovirus(50.0%) tRNA NA
DBSCAN-SWA_94 1104402 : 1113548 9 Pseudomonas_phage(20.0%) NA NA
DBSCAN-SWA_95 1136864 : 1138627 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_96 1142387 : 1143863 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_97 1152491 : 1157054 5 Fowlpox_virus(50.0%) NA NA
DBSCAN-SWA_98 1161679 : 1162849 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_99 1170463 : 1172110 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_100 1178641 : 1184138 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_101 1218108 : 1221794 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_102 1236113 : 1237577 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_103 1240829 : 1245695 5 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_104 1251312 : 1262996 14 Bacillus_phage(33.33%) protease NA
DBSCAN-SWA_105 1271128 : 1275609 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_106 1288002 : 1305234 17 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_107 1314203 : 1320051 6 Organic_Lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_108 1341853 : 1346752 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_109 1354510 : 1355812 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_110 1373466 : 1375222 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_111 1384802 : 1385246 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_112 1398994 : 1400707 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_113 1406669 : 1407374 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_114 1412677 : 1413595 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_115 1426546 : 1429456 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_116 1436839 : 1441978 4 Heterosigma_akashiwo_virus(50.0%) NA NA
DBSCAN-SWA_117 1453706 : 1456512 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_118 1462745 : 1464299 1 Campylobacter_virus(100.0%) transposase NA
DBSCAN-SWA_119 1478006 : 1478666 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_120 1488413 : 1490237 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_121 1502402 : 1503395 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_122 1506508 : 1507720 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_123 1521536 : 1522322 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_124 1526483 : 1527392 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_125 1561221 : 1561539 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_126 1575578 : 1575776 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_127 1597288 : 1599981 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_128 1607477 : 1611511 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_129 1631576 : 1632131 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_130 1635759 : 1636362 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1640329 : 1651365 11 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_132 1655029 : 1655911 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1662536 : 1672733 11 Bacillus_virus(14.29%) NA NA
DBSCAN-SWA_134 1686897 : 1687428 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_135 1693138 : 1702111 9 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_136 1708082 : 1710233 2 Erythrobacter_phage(50.0%) NA NA
DBSCAN-SWA_137 1715184 : 1723090 7 Bacillus_phage(50.0%) integrase,transposase attL 1705563:1705581|attR 1733258:1733276
DBSCAN-SWA_138 1747834 : 1749106 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_139 1755806 : 1756943 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_140 1760630 : 1764452 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_141 1775687 : 1780453 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_142 1795469 : 1800655 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_143 1808655 : 1816250 7 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_144 1819472 : 1821851 4 Pneumococcus_phage(25.0%) NA NA
DBSCAN-SWA_145 1826798 : 1828295 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 1839830 : 1840832 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_147 1846662 : 1854052 10 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_148 1858853 : 1860929 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_149 1866468 : 1914812 55 Bacillus_phage(27.27%) bacteriocin,portal,capsid,protease,integrase,terminase attL 1874847:1874863|attR 1915536:1915552
DBSCAN-SWA_150 1930748 : 1936898 5 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_151 1941116 : 1943183 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_152 1948267 : 1950544 3 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_153 1955051 : 1959852 5 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_154 1966914 : 1968741 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_155 1972744 : 1973419 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_156 1978279 : 1980251 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_157 1986338 : 1987085 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_158 1992797 : 1995398 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_159 2006698 : 2013778 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_160 2017398 : 2021674 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_161 2028241 : 2028445 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_162 2033849 : 2034509 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_163 2039941 : 2042398 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_164 2049343 : 2050357 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2067509 : 2072408 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_166 2076544 : 2077486 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_167 2115743 : 2117481 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_168 2132135 : 2133496 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_169 2137113 : 2143340 8 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_170 2146897 : 2147899 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_171 2153473 : 2155753 4 Listeria_phage(50.0%) NA NA
DBSCAN-SWA_172 2161674 : 2167885 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_173 2201349 : 2203493 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_174 2212263 : 2219567 5 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_175 2223785 : 2228895 5 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_176 2236476 : 2241729 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_177 2247773 : 2250873 2 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_178 2255569 : 2258059 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_179 2268637 : 2273996 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_180 2288295 : 2298025 8 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_181 2302373 : 2304371 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_182 2316118 : 2316604 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_183 2331291 : 2332901 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_184 2340027 : 2343683 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_185 2376988 : 2379358 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_186 2384386 : 2386477 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_187 2396137 : 2399342 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_188 2409220 : 2412265 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_189 2433484 : 2435109 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_190 2441955 : 2456171 15 Acinetobacter_phage(16.67%) NA NA
DBSCAN-SWA_191 2460576 : 2465929 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_192 2471049 : 2472982 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_193 2477610 : 2484466 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_194 2490446 : 2492018 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_195 2509668 : 2516486 6 Halovirus(25.0%) NA NA
DBSCAN-SWA_196 2520077 : 2521427 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_197 2537499 : 2541935 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_198 2553360 : 2555561 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_199 2560895 : 2566734 4 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_200 2570024 : 2571550 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_201 2575113 : 2576211 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_202 2583437 : 2585414 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_203 2591198 : 2592749 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_204 2597292 : 2638364 56 Bacillus_phage(84.44%) holin,portal,tail,capsid,protease,integrase,terminase attL 2590461:2590479|attR 2645156:2645174
DBSCAN-SWA_205 2658722 : 2659736 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_206 2667160 : 2668921 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_207 2677549 : 2690966 12 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_208 2698792 : 2700172 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_209 2715633 : 2734368 17 Caulobacter_phage(37.5%) tRNA NA
DBSCAN-SWA_210 2740057 : 2745221 3 Mimivirus(33.33%) NA NA
DBSCAN-SWA_211 2753110 : 2755300 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_212 2770614 : 2772840 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_213 2779296 : 2780079 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_214 2788119 : 2789169 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_215 2796702 : 2798229 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2803202 : 2810086 7 Oenococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_217 2821401 : 2822307 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_218 2830749 : 2831769 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_219 2837148 : 2841417 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_220 2845496 : 2857063 11 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_221 2862871 : 2863663 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_222 2870209 : 2872924 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_223 2887219 : 2900713 11 Bacillus_phage(25.0%) tRNA,protease NA
DBSCAN-SWA_224 2911815 : 2912166 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_225 2917238 : 2918825 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_226 2922043 : 2923315 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_227 2929206 : 2931149 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_228 2937923 : 2942872 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_229 2949187 : 2950024 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_230 2959530 : 2962007 3 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_231 2971347 : 2973128 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_232 2980131 : 2981568 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_233 2984602 : 2985643 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_234 2994197 : 2995607 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_235 3003134 : 3004937 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_236 3009305 : 3011554 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_237 3021434 : 3022148 1 Deep-sea_thermophilic_phage(100.0%) NA NA
DBSCAN-SWA_238 3025349 : 3027049 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_239 3042241 : 3054414 7 Catovirus(25.0%) NA NA
DBSCAN-SWA_240 3058006 : 3058540 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_241 3061551 : 3062949 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_242 3070682 : 3073118 1 Klebsiella_phage(100.0%) protease NA
DBSCAN-SWA_243 3086468 : 3100971 15 Tupanvirus(25.0%) tRNA,protease NA
DBSCAN-SWA_244 3109792 : 3110329 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_245 3115029 : 3119496 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_246 3124940 : 3132544 9 Streptococcus_phage(60.0%) tRNA NA
DBSCAN-SWA_247 3141322 : 3153055 11 Bacteriophage(16.67%) tRNA NA
DBSCAN-SWA_248 3159458 : 3166599 5 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_249 3175060 : 3178346 4 Leptospira_phage(25.0%) protease NA
DBSCAN-SWA_250 3181429 : 3181951 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_251 3185768 : 3216598 26 Streptococcus_phage(14.29%) protease NA
DBSCAN-SWA_252 3221063 : 3226195 3 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_253 3229944 : 3231498 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_254 3236614 : 3237916 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_255 3247221 : 3248277 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_256 3255693 : 3256992 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_257 3260066 : 3264532 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_258 3270254 : 3271526 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_259 3276453 : 3283449 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_260 3287369 : 3288095 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_261 3316176 : 3319937 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_262 3329775 : 3332509 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_263 3338703 : 3339288 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_264 3343072 : 3344113 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_265 3349565 : 3350807 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_266 3377397 : 3380576 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_267 3383957 : 3389880 5 Clostridium_phage(33.33%) NA NA
DBSCAN-SWA_268 3396499 : 3403158 6 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_269 3407821 : 3408502 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_270 3414336 : 3417093 1 Pneumococcus_phage(100.0%) NA NA
DBSCAN-SWA_271 3422808 : 3436464 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_272 3443234 : 3444593 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_273 3448923 : 3449808 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_274 3457210 : 3458692 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_275 3470613 : 3480670 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_276 3486610 : 3497303 10 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_277 3504369 : 3507246 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_278 3513163 : 3519853 8 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_279 3531824 : 3533120 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_280 3536826 : 3539840 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_281 3543948 : 3544965 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_282 3553356 : 3554859 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_283 3558718 : 3559978 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_284 3564285 : 3565125 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_285 3581055 : 3583130 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_286 3591039 : 3601122 7 uncultured_Caudovirales_phage(40.0%) tRNA NA
DBSCAN-SWA_287 3608079 : 3608973 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 3618148 : 3622063 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_289 3629288 : 3630972 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_290 3639065 : 3639431 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_291 3645675 : 3649410 4 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_292 3667457 : 3669912 4 Bacillus_virus(50.0%) coat NA
DBSCAN-SWA_293 3674706 : 3675366 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_294 3678638 : 3679574 2 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_295 3694044 : 3695034 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_296 3698052 : 3707188 9 Geobacillus_virus(20.0%) tRNA NA
DBSCAN-SWA_297 3711966 : 3712506 1 Goatpox_virus(100.0%) NA NA
DBSCAN-SWA_298 3722153 : 3722834 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_299 3740002 : 3744953 4 Iris_mild_mosaic_virus(50.0%) NA NA
DBSCAN-SWA_300 3750129 : 3755543 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_301 3767800 : 3768553 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_302 3775773 : 3776544 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_303 3780919 : 3789336 10 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_304 3797781 : 3798654 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_305 3805043 : 3807969 7 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_306 3811817 : 3812582 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_307 3816825 : 3817635 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_308 3824961 : 3828267 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_309 3837793 : 3853699 15 Staphylococcus_phage(50.0%) tRNA,integrase attL 3842180:3842197|attR 3847862:3847879
DBSCAN-SWA_310 3860050 : 3860356 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_311 3871479 : 3877975 9 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_312 3891760 : 3897908 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_313 3911847 : 3913993 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_314 3918151 : 3922990 5 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_315 3931302 : 3935712 4 Faustovirus(33.33%) tRNA NA
DBSCAN-SWA_316 3955272 : 3955536 1 Marinitoga_camini_virus(100.0%) NA NA
DBSCAN-SWA_317 3968355 : 3971682 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_318 3976841 : 3978599 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_319 3987098 : 4005740 17 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_320 4014988 : 4027319 11 Orpheovirus(25.0%) tRNA NA
DBSCAN-SWA_321 4035569 : 4037313 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_322 4040749 : 4045204 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_323 4052980 : 4054666 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_324 4058225 : 4058540 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_325 4068922 : 4069807 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_326 4076567 : 4079415 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_327 4088268 : 4088448 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_328 4091836 : 4101008 10 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_329 4107134 : 4108610 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_330 4120056 : 4120665 1 Ugandan_cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_331 4126910 : 4132461 3 Bacillus_virus(33.33%) protease NA
DBSCAN-SWA_332 4139267 : 4145777 4 Klosneuvirus(100.0%) tRNA,coat NA
DBSCAN-SWA_333 4162201 : 4162978 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_334 4169141 : 4170281 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_335 4180206 : 4183917 5 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_336 4187416 : 4204093 13 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_337 4207980 : 4215779 7 Virus_Rctr197k(50.0%) tRNA NA
DBSCAN-SWA_338 4218969 : 4221854 3 Phage_TP(66.67%) NA NA
DBSCAN-SWA_339 4227041 : 4229102 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_340 4234443 : 4235262 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_341 4242268 : 4245022 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_342 4257757 : 4258471 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_343 4266968 : 4275406 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_344 4278961 : 4282117 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_345 4285858 : 4289043 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_346 4297129 : 4309604 12 Helicobacter_phage(16.67%) tRNA NA
DBSCAN-SWA_347 4313945 : 4314557 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_348 4321303 : 4328932 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_349 4332721 : 4339651 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_350 4346502 : 4347984 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_351 4351732 : 4355081 8 Caldibacillus_phage(50.0%) NA NA
DBSCAN-SWA_352 4358330 : 4359950 1 Staphylococcus_phage(100.0%) head,protease NA
DBSCAN-SWA_353 4365880 : 4366531 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_354 4369680 : 4375692 4 Prochlorococcus_phage(66.67%) NA NA
DBSCAN-SWA_355 4387921 : 4388584 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_356 4393171 : 4393750 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_357 4403260 : 4405506 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_358 4416939 : 4417668 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_359 4423584 : 4425006 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_360 4430053 : 4434044 6 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_361 4438529 : 4439768 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_362 4443704 : 4444544 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_363 4449953 : 4452077 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_364 4459653 : 4462923 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_365 4465965 : 4469390 4 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_366 4479064 : 4480836 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_367 4483883 : 4489397 5 Brevibacillus_phage(33.33%) NA NA
DBSCAN-SWA_368 4494954 : 4499311 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_369 4508095 : 4512727 7 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_370 4540711 : 4541161 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_371 4546983 : 4548084 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_372 4561044 : 4561479 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_373 4576691 : 4579951 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_374 4590479 : 4591034 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_375 4595324 : 4596737 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_376 4607778 : 4609107 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_377 4618789 : 4620625 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_378 4623906 : 4628132 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_379 4632107 : 4634725 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_380 4638029 : 4638536 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_381 4660254 : 4661911 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_382 4666457 : 4676806 9 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_383 4682408 : 4683041 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_384 4689836 : 4699940 9 Paramecium_bursaria_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_385 4703129 : 4705103 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_386 4715496 : 4717336 3 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_387 4727976 : 4728750 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_388 4732127 : 4738525 5 Indivirus(33.33%) tRNA,protease NA
DBSCAN-SWA_389 4742859 : 4743636 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_390 4748818 : 4760383 10 Clostridium_phage(33.33%) tRNA NA
DBSCAN-SWA_391 4764189 : 4765431 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_392 4774625 : 4785841 8 Mycobacterium_phage(20.0%) NA NA
DBSCAN-SWA_393 4791818 : 4792244 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_394 4795397 : 4795658 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_395 4802720 : 4808594 3 Tetraselmis_virus(33.33%) NA NA
DBSCAN-SWA_396 4812445 : 4817232 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_397 4836258 : 4838279 3 Megavirus(50.0%) NA NA
DBSCAN-SWA_398 4841608 : 4847719 7 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_399 4859437 : 4860370 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_400 4867116 : 4868073 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_401 4873591 : 4881047 9 Phage_Wrath(40.0%) terminase NA
DBSCAN-SWA_402 4884960 : 4888739 4 Pithovirus(50.0%) NA NA
DBSCAN-SWA_403 4892159 : 4899328 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_404 4904580 : 4905492 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_405 4922634 : 4924152 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_406 4939808 : 4940261 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_407 4947996 : 4951681 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_408 4958962 : 4962781 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_409 4966638 : 4981056 13 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_410 5038527 : 5043589 8 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_411 5050242 : 5050920 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_412 5055312 : 5061362 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_413 5066017 : 5070353 5 Erysipelothrix_phage(33.33%) protease NA
DBSCAN-SWA_414 5076704 : 5077649 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_415 5081734 : 5082868 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_416 5088860 : 5091293 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_417 5101397 : 5102432 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_418 5110393 : 5112792 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_419 5121673 : 5122711 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_420 5129579 : 5130341 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_421 5145061 : 5147278 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_422 5156583 : 5157756 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_423 5169810 : 5172039 1 Lonomia_obliqua_multiple_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_424 5175532 : 5183772 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_425 5204050 : 5204809 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_426 5218572 : 5219298 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_427 5226554 : 5236933 8 Pseudomonas_phage(40.0%) tRNA NA
DBSCAN-SWA_428 5247661 : 5249323 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_429 5261709 : 5262627 1 Mycobacterium_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP053994
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053994_1 206955-207102 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 266982-267063 22 0.732
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 133217-133298 22 0.732
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 206988-207069 22 0.732
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 190004-190085 22 0.732
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 191569-191650 22 0.732
NZ_CP053994_1 1.1|206988|82|NZ_CP053994|CRISPRCasFinder 206988-207069 82 NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence 99749-99830 23 0.72

1. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 22, identity: 0.732

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	Protospacer
************************************************************

2. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 22, identity: 0.732

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	Protospacer
************************************************************

3. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 22, identity: 0.732

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	Protospacer
************************************************************

4. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 22, identity: 0.732

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	Protospacer
************************************************************

5. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 22, identity: 0.732

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	Protospacer
************************************************************

6. spacer 1.1|206988|82|NZ_CP053994|CRISPRCasFinder matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 23, identity: 0.72

cttattatggctataagcttttatttcaaattttatagctttatcacggctattacttct	CRISPR spacer
cttattatggctataagcttttatttcaaattttatagctttatcacggcaattacttct	Protospacer
************************************************** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage