Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053978 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP053977 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP053980 Bacillus thuringiensis strain FDAARGOS_795 chromosome, complete genome 3 crisprs WYL,csa3,DEDDh,cas14j,cas3,c2c9_V-U4,cas14k,DinG 0 0 6 0
NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 2 crisprs NA 3 10 1 0

Results visualization

1. NZ_CP053977
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3038 : 49574 63 Bacillus_phage(69.77%) portal,holin,terminase,capsid,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053980
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053980_1 162527-162629 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053980_2 3234083-3234191 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053980_3 4824994-4825168 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 201997 : 216035 15 Bacillus_phage(61.54%) transposase NA
DBSCAN-SWA_2 1544722 : 1586510 53 Prochlorococcus_phage(12.5%) protease,transposase,coat NA
DBSCAN-SWA_3 2334678 : 2342627 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_4 2380469 : 2388846 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 3796229 : 3840100 65 Bacillus_phage(87.27%) protease,tail,holin,terminase,portal,capsid,integrase,head attL 3784888:3784903|attR 3845975:3845990
DBSCAN-SWA_6 3927387 : 3936113 9 Bacillus_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP053979
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053979_1 70998-71135 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053979_2 264168-264628 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP053979.1 104000-104018 1 0.947
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP053980.1 1155867-1155885 2 0.895
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP053979.1 104000-104018 2 0.895
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP053980.1 2916330-2916348 2 0.895
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP053980.1 4880637-4880655 2 0.895

1. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to position: 104000-104018, mismatch: 1, identity: 0.947

agatttagaagacgaagat	CRISPR spacer
agaattagaagacgaagat	Protospacer
*** ***************

2. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to position: 1155867-1155885, mismatch: 2, identity: 0.895

agatttagaagacgaagat	CRISPR spacer
agatttagaagaagatgat	Protospacer
************ ** ***

3. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to position: 104000-104018, mismatch: 2, identity: 0.895

agaattagatgacgaggat	CRISPR spacer
agaattagaagacgaagat	Protospacer
********* *****.***

4. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to position: 2916330-2916348, mismatch: 2, identity: 0.895

ttttgaagaagacgaagat	CRISPR spacer
ttttgaaggagaagaagat	Protospacer
********.*** ******

5. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to position: 4880637-4880655, mismatch: 2, identity: 0.895

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagataaagat	Protospacer
************..*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 267632-267667 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 162809-162844 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 71022-71057 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 289344-289379 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 56745-56780 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 289345-289380 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 201829-201864 0 1.0
NZ_CP053979_1 1.1|71022|36|NZ_CP053979|CRISPRCasFinder 71022-71057 36 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 288957-288992 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 267578-267607 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 162869-162898 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 71082-71111 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 289404-289433 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 56805-56834 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 289405-289434 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 201775-201804 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 289017-289046 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74482-74500 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6377-6395 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264191-264209 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 132911-132929 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 249912-249930 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 132911-132929 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8678-8696 0 1.0
NZ_CP053979_2 2.1|264191|19|NZ_CP053979|CRISPRCasFinder 264191-264209 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132419-132437 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74428-74458 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6419-6449 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264233-264263 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 132953-132983 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 249954-249984 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 132953-132983 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8624-8654 0 1.0
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132461-132491 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74347-74365 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8543-8561 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6512-6530 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264326-264344 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133046-133064 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250047-250065 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133046-133064 0 1.0
NZ_CP053979_2 2.4|264326|19|NZ_CP053979|CRISPRCasFinder 264326-264344 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132554-132572 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74305-74323 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8501-8519 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6554-6572 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264368-264386 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133088-133106 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250089-250107 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133088-133106 0 1.0
NZ_CP053979_2 2.5|264368|19|NZ_CP053979|CRISPRCasFinder 264368-264386 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132596-132614 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6596-6635 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264410-264449 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133130-133169 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250131-250170 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133130-133169 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132638-132677 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74242-74281 0 1.0
NZ_CP053979_2 2.6|264410|40|NZ_CP053979|CRISPRCasFinder 264410-264449 40 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8438-8477 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74191-74218 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8387-8414 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6659-6686 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264473-264500 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133193-133220 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250194-250221 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133193-133220 0 1.0
NZ_CP053979_2 2.7|264473|28|NZ_CP053979|CRISPRCasFinder 264473-264500 28 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132701-132728 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6710-6749 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264524-264563 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133244-133283 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250245-250284 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133244-133283 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132752-132791 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74128-74167 0 1.0
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8324-8363 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74086-74104 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6773-6791 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264587-264605 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133307-133325 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250308-250326 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133307-133325 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8282-8300 0 1.0
NZ_CP053979_2 2.9|264587|19|NZ_CP053979|CRISPRCasFinder 264587-264605 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132815-132833 0 1.0
NZ_CP053979_1 1.2|71082|30|NZ_CP053979|CRISPRCasFinder 71082-71111 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 39281-39310 5 0.833
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KJ019094 Synechococcus phage ACG-2014e isolate Syn7803US33, complete genome 126876-126906 5 0.839
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KJ019156 Synechococcus phage ACG-2014e isolate Syn7803C2, complete genome 126967-126997 5 0.839
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KJ019054 Synechococcus phage ACG-2014e isolate Syn7803C85, complete genome 126967-126997 5 0.839
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 849306-849336 6 0.806
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MN694597 Marine virus AFVG_250M99, complete genome 9510-9540 6 0.806
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_041878 Pectobacterium phage CBB, complete genome 189070-189100 6 0.806
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 73969-73999 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6878-6908 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264692-264722 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133412-133442 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250413-250443 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133412-133442 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8165-8195 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132920-132950 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MT325768 Psychrobacillus phage Perkons, complete genome 24091-24121 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_047815 Erwinia phage vB_EamM_Yoloswag, complete genome 248783-248813 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_041887 Rhodococcus phage Weasels2, complete genome 61428-61458 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_047920 Citrobacter phage vB_CroP_CrRp3, complete genome 3181-3211 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 LC494302 Escherichia phage SP27 DNA, complete genome 271901-271931 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 370932-370962 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 204541-204571 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_027364 Escherichia phage PBECO 4, complete genome 12987-13017 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MH383160 Escherichia phage UB, complete genome 73575-73605 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MK327931 Escherichia phage vB_EcoM_G17, complete genome 229835-229865 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 213513-213543 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KM236246 Bacillus phage Moonbeam, complete genome 124274-124304 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KM507819 Escherichia phage 121Q, complete genome 272645-272675 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_049857 Lactococcus phage P1048, complete genome 82457-82487 7 0.774
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 2052-2082 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 10031-10061 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 2602-2632 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 13775-13805 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 144599-144629 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 114591-114621 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 26911-26941 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP026718 Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence 88033-88063 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MG967616 Bacillus phage v_B-Bak1, complete genome 44632-44662 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_047815 Erwinia phage vB_EamM_Yoloswag, complete genome 248759-248789 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 KC595511 Bacillus phage Basilisk, complete genome 45666-45696 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MG967618 Bacillus phage v_B-Bak10, complete genome 46060-46090 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MG967617 Bacillus phage v_B-Bak6, complete genome 44632-44662 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_013160 Rippkaea orientalis PCC 8802 plasmid pP880201, complete sequence 58963-58993 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP032289 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.4, complete sequence 43-73 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MG592495 Vibrio phage 1.121.O._10N.286.46.C4, partial genome 130932-130962 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MK448911 Streptococcus phage Javan34, complete genome 36795-36825 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MH518298 Pseudomonas phage SCYZ1, complete genome 16480-16510 8 0.742
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 255363-255393 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 175083-175113 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 83296-83326 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 301618-301648 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 69019-69049 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 301619-301649 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 189560-189590 9 0.71
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 301231-301261 9 0.71
NZ_CP053979_2 2.8|264524|40|NZ_CP053979|CRISPRCasFinder 264524-264563 40 MH844558 Exiguobacterium phage vB_EauM-23, complete genome 29181-29220 9 0.775
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MK448704 Streptococcus phage Javan213, complete genome 32825-32855 10 0.677
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_048080 Acinetobacter phage vB_AbaM_B09_Aci05, complete genome 92031-92061 10 0.677
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MT623546 Acinetobacter phage Ab_121, complete genome 42972-43002 10 0.677
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 NC_048074 Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome 92258-92288 10 0.677
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MH800199 Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome 92464-92494 10 0.677
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 MT121964 Phage DP SC_6_H4_2017 DNA cytosine methyltransferase and putative helicase genes, complete cds 66589-66619 11 0.645
NZ_CP053979_2 2.2|264233|31|NZ_CP053979|CRISPRCasFinder 264233-264263 31 AP014193 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S24-C63, *** SEQUENCING IN PROGRESS *** 10293-10323 11 0.645

1. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

2. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

3. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

4. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

5. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

6. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

7. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

8. spacer 1.1|71022|36|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

9. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

10. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

11. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

12. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

13. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

14. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

15. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

16. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

17. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

18. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

19. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

20. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

21. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

22. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

23. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

24. spacer 2.1|264191|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

25. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

26. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

27. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

28. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

29. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

30. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

31. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

32. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

33. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

34. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

35. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

36. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

37. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

38. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

39. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

40. spacer 2.4|264326|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

41. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

42. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

43. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

44. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

45. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

46. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

47. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

48. spacer 2.5|264368|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

49. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

50. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

51. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

52. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

53. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

54. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

55. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

56. spacer 2.6|264410|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

57. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

58. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

59. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

60. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

61. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

62. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

63. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

64. spacer 2.7|264473|28|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

65. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

66. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

67. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

68. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

69. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

70. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

71. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

72. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

73. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

74. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

75. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

76. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

77. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

78. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

79. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

80. spacer 2.9|264587|19|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

81. spacer 1.2|71082|30|NZ_CP053979|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 5, identity: 0.833

ttgctc-aaacacaacaagcgaagtctcaac	CRISPR spacer
-tgcacgaaacacaacaagcgaactcgcaaa	Protospacer
 *** * **************** ** *** 

82. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KJ019094 (Synechococcus phage ACG-2014e isolate Syn7803US33, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

83. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KJ019156 (Synechococcus phage ACG-2014e isolate Syn7803C2, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

84. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KJ019054 (Synechococcus phage ACG-2014e isolate Syn7803C85, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

85. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 6, identity: 0.806

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gcagcttattgaagaggaagatgatgaagtt	Protospacer
* *.*********** ******** ****  

86. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MN694597 (Marine virus AFVG_250M99, complete genome) position: , mismatch: 6, identity: 0.806

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gtatccttttgcagatgaagatgaggaggaa	Protospacer
* * *.* *** ***************.***

87. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.806

ggaactta--ttgaagatgaagatgaggaagaa	CRISPR spacer
--aagtgaatttgatgatgaagatgacgaagaa	Protospacer
  ** * *  **** *********** ******

88. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

89. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

90. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

91. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

92. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

93. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

94. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

95. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

96. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MT325768 (Psychrobacillus phage Perkons, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
atggattattgaaaatgaatatgaggaagaa	Protospacer
. .. ********.***** ***********

97. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_047815 (Erwinia phage vB_EamM_Yoloswag, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggacgaagatgaagatgaagatgaggacgaa	Protospacer
***    . ****************** ***

98. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_041887 (Rhodococcus phage Weasels2, complete genome) position: , mismatch: 7, identity: 0.774

----ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gcgcgga----tttgaagatgaagatgagggagat	Protospacer
    ***     ******************.*** 

99. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_047920 (Citrobacter phage vB_CroP_CrRp3, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttat-tgaagatgaagatgaggaagaa	CRISPR spacer
-agtctggtatgaagatgaagaagaggaagaa	Protospacer
 .. ** .* ************ *********

100. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

101. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 7, identity: 0.774

---ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tatcgaat---ttgaagatgaagatgatgaggaa	Protospacer
    ***.   **************** **.***

102. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

103. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

104. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

105. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

106. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

107. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KM236246 (Bacillus phage Moonbeam, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgaacgtattgtagatgaagatgaaaaacac	Protospacer
 **** ***** ************..** * 

108. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

109. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_049857 (Lactococcus phage P1048, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agagttatttgaagatgatgatgaagaagaa	Protospacer
.**..*  ********** *****.******

110. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tgcctgtattgaagatgaagataaggcagat	Protospacer
 *  . ****************.*** *** 

111. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

112. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

113. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

114. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

115. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

116. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

117. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP026718 (Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

118. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MG967616 (Bacillus phage v_B-Bak1, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

119. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_047815 (Erwinia phage vB_EamM_Yoloswag, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgacgaagatgaagatgaagatgaggacgaa	Protospacer
 **    . ****************** ***

120. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to KC595511 (Bacillus phage Basilisk, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

121. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MG967618 (Bacillus phage v_B-Bak10, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

122. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MG967617 (Bacillus phage v_B-Bak6, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

123. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_013160 (Rippkaea orientalis PCC 8802 plasmid pP880201, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ttatttaattgaacatgaagatgacgaagat	Protospacer
  * .* ****** ********** ***** 

124. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP032289 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.4, complete sequence) position: , mismatch: 8, identity: 0.742

---ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ttcaaaat---ttgaagatgaagatgaagatgaa	Protospacer
   ..**.   ****************.** ***

125. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MG592495 (Vibrio phage 1.121.O._10N.286.46.C4, partial genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tgtgtatcttgaagtagaagatgaggaagaa	Protospacer
 * .. * ******  ***************

126. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tcagtttattgaagctgaagaggaggaaaag	Protospacer
  *..********* ****** ******.*.

127. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gttctatgttgaagatgaagaagaggaggaa	Protospacer
*   . *.************* *****.***

128. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

129. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

130. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

131. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

132. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

133. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

134. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

135. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

136. spacer 2.8|264524|40|NZ_CP053979|CRISPRCasFinder matches to MH844558 (Exiguobacterium phage vB_EauM-23, complete genome) position: , mismatch: 9, identity: 0.775

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
tgcctaaaccgacgaggacgaagaatgtgatgatgaagaa	Protospacer
* *. **.  ****************  *********** 

137. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
acgctggattgaagatgaagaacaggaagag	Protospacer
. . .  **************  *******.

138. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_048080 (Acinetobacter phage vB_AbaM_B09_Aci05, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

139. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MT623546 (Acinetobacter phage Ab_121, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

140. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to NC_048074 (Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

141. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MH800199 (Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

142. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to MT121964 (Phage DP SC_6_H4_2017 DNA cytosine methyltransferase and putative helicase genes, complete cds) position: , mismatch: 11, identity: 0.645

ggaacttattgaagatgaagatgaggaagaa------	CRISPR spacer
------tactgatgatgaagatgaagaggaggaagaa	Protospacer
      **.*** ***********.**.**.      

143. spacer 2.2|264233|31|NZ_CP053979|CRISPRCasFinder matches to AP014193 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S24-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 11, identity: 0.645

ggaacttattgaagatgaagatgaggaagaa------	CRISPR spacer
------cgatgaagatgaagatgaagaagaggaagaa	Protospacer
      .. ***************.*****.      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 248482 : 258469 17 Bacillus_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage