Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053929 Pseudomonas sp. B14-6 chromosome, complete genome 3 crisprs csa3,DEDDh,DinG,WYL,cas3,PD-DExK 1 0 3 0

Results visualization

1. NZ_CP053929
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053929_1 3024727-3024829 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053929_2 3149849-3149951 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053929_3 5770133-5770226 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053929_1 1.1|3024760|37|NZ_CP053929|CRISPRCasFinder 3024760-3024796 37 NZ_CP053929.1 5295610-5295646 2 0.946

1. spacer 1.1|3024760|37|NZ_CP053929|CRISPRCasFinder matches to position: 5295610-5295646, mismatch: 2, identity: 0.946

agcaggctcgctcctacagtggaatgggtgtacctgc	CRISPR spacer
agcaggctcactcctacagtggaatgtgtgtacctgc	Protospacer
*********.**************** **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 212005 : 218286 7 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_2 3998659 : 4055242 43 Lake_Baikal_phage(16.67%) holin,protease NA
DBSCAN-SWA_3 5917130 : 5987051 63 Pseudomonas_phage(57.14%) plate,tail,tRNA,lysis,holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage