Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 0 crisprs NA 0 0 1 1
NZ_CP053739 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence 1 crisprs RT 2 2 0 0
NZ_CP053741 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncQ, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP053736 Escherichia coli strain CP8-3_Sichuan chromosome, complete genome 6 crisprs DEDDh,DinG,cas3,c2c9_V-U4,RT,csa3,PD-DExK 0 11 344 0
NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP053743 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-2k, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053742 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-ColYe4449, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP053737
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1988 : 29536 18 Escherichia_phage(45.45%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053736
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_1 232481-232627 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_2 763166-763310 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_3 903454-903550 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_4 2693376-2693502 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_5 3252674-3253007 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053736_6 3271241-3271513 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 44629-44660 0 1.0
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 CP043735 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence 40067-40098 0 1.0
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP047660 Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence 58891-58922 0 1.0
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP053736_5 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252703-3252734 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 143044-143075 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 71931-71962 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 66435-66466 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 98748-98779 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 66168-66199 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 2476-2507 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 49059-49090 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 132702-132733 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 108045-108076 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 87153-87184 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 287-318 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 33752-33783 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 67716-67747 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 25730-25761 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 57687-57718 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP019890 Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence 122841-122872 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 102403-102434 2 0.938
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 65860-65891 2 0.938
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_008562 Microcystis phage Ma-LMM01 DNA, complete genome 140086-140117 6 0.812
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014325 Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence 38109-38140 6 0.812
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP044019 Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence 94508-94539 7 0.781
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013516 Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence 7628-7659 7 0.781
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP027399 Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence 1421-1452 7 0.781
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 LN681534 Clostridium phage phiCD24-1, complete genome 11241-11272 7 0.781
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MN718463 Clostridium phage phiCDKH01, complete genome 30675-30706 7 0.781
NZ_CP053736_6 6.2|3271331|32|NZ_CP053736|CRISPRCasFinder 3271331-3271362 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP037738 Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence 45049-45080 8 0.75
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_MF344556 Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence 9368-9399 8 0.75
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK448998 Streptococcus phage Javan636, complete genome 14722-14753 8 0.75
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP023400 Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence 41988-42019 8 0.75
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK318083 Aeromonas phage Akh-2, complete genome 49017-49048 8 0.75
NZ_CP053736_6 6.1|3271270|32|NZ_CP053736|CRISPRCasFinder 3271270-3271301 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP053736_6 6.2|3271331|32|NZ_CP053736|CRISPRCasFinder 3271331-3271362 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
NZ_CP053736_6 6.6|3271331|33|NZ_CP053736|PILER-CR,CRT 3271331-3271363 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_015919 Borreliella bissettii DN127 plasmid lp54, complete sequence 25464-25495 9 0.719
NZ_CP053736_6 6.4|3271453|32|NZ_CP053736|CRISPRCasFinder 3271453-3271484 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
NZ_CP053736_2 2.1|763209|59|NZ_CP053736|CRISPRCasFinder 763209-763267 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_016942 Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence 5299-5330 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029750 Staphylococcus aureus strain Smith plasmid pSS41, complete sequence 37023-37054 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030488 Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence 15239-15270 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030517 Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence 3411-3442 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030707 Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence 14760-14791 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP053186 Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence 13516-13547 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP016857 Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence 26128-26159 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP053184 Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence 21385-21416 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030633 Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence 12815-12846 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013228 UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence 8986-9017 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013228 UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence 36054-36085 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013229 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence 2612-2643 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013229 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence 29549-29580 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013230 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence 7844-7875 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP030325 Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence 20301-20332 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018956 Staphylococcus aureus plasmid p18806-P03, complete sequence 668-699 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP018767 Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence 6436-6467 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030383 Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030587 Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence 25607-25638 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030607 Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence 17509-17540 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030663 Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence 14708-14739 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP039449 Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030385 Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence 25939-25970 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030530 Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence 12165-12196 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014408 Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence 15980-16011 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014411 Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014367 Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP054441 Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence 24016-24047 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 LC383633 Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence 21436-21467 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP031889 Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence 17895-17926 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030387 Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence 19330-19361 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030513 Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence 25938-25969 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030666 Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence 15479-15510 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014386 Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence 15017-15048 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030397 Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence 17149-17180 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030414 Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence 25948-25979 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP011527 Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence 9393-9424 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030497 Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence 23633-23664 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013956 Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence 23708-23739 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_003140 Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP016862 Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence 19070-19101 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_010419 Staphylococcus aureus plasmid pTZ2162, complete sequence 34334-34365 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP013954 Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence 17875-17906 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030416 Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence 19505-19536 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030477 Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence 13032-13063 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030521 Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence 7859-7890 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP012975 Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence 659-690 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_LR130519 Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2 25866-25897 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020323 Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence 647-678 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030444 Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence 25920-25951 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030533 Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence 14862-14893 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014434 Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_010077 Staphylococcus aureus plasmid EDINA, complete sequence 21421-21452 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030466 Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence 15690-15721 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030555 Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence 22953-22984 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP011529 Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence 659-690 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013289 Staphylococcus aureus plasmid SAP015A, complete sequence 8040-8071 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013292 Staphylococcus aureus plasmid pWBG752, complete sequence 9031-9062 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013294 Staphylococcus aureus plasmid SAP046A, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013296 Staphylococcus aureus plasmid SAP049A, complete sequence 14146-14177 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013298 Staphylococcus aureus plasmid SAP050A, complete sequence 23118-23149 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013299 Staphylococcus aureus plasmid SAP051A, complete sequence 5070-5101 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018952 Staphylococcus aureus plasmid pWBG747, complete sequence 3829-3860 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029677 Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence 7608-7639 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP035102 Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence 26596-26627 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029199 Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence 11131-11162 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030523 Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence 13725-13756 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030616 Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence 18237-18268 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 LC377540 Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_019150 Staphylococcus aureus plasmid p18805-P03, complete sequence 667-698 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_019148 Staphylococcus aureus PM1 plasmid pPM1, complete sequence 20952-20983 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030442 Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030494 Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030698 Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence 18913-18944 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014063 Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence 17439-17470 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP007679 Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence 30489-30520 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP030324 Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence 23370-23401 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933272 Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence 23155-23186 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933273 Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence 15714-15745 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933274 Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence 20951-20982 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933275 Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence 17919-17950 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933276 Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence 20954-20985 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP017095 Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence 19097-19128 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_005127 Staphylococcus aureus plasmid pUB101, complete sequence 3611-3642 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933268 Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence 23155-23186 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933269 Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence 15714-15745 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933270 Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence 20848-20879 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MK933271 Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence 20950-20981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020314 Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence 11249-11280 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP012118 Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence 19046-19077 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030571 Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030567 Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence 15482-15513 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030461 Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence 11132-11163 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030535 Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence 3041-3072 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030643 Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence 14712-14743 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030669 Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030623 Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence 1460-1491 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013322 Staphylococcus aureus plasmid SAP019A, complete sequence 17285-17316 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013324 Staphylococcus aureus plasmid SAP027A, complete sequence 12132-12163 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013326 Staphylococcus aureus plasmid pWBG746, complete sequence 18676-18707 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013330 Staphylococcus aureus plasmid pWBG759, complete sequence 14220-14251 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013332 Staphylococcus aureus plasmid SAP052A, complete sequence 21512-21543 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013348 Staphylococcus aureus plasmid pSK156, complete sequence 14549-14580 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030463 Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030697 Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence 22984-23015 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_023278 Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence 15133-15164 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP040802 Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence 16440-16471 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030446 Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030536 Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence 15475-15506 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030660 Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence 24585-24616 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP025250 Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence 16154-16185 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030539 Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030690 Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence 17158-17189 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047853 Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence 2010-2041 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047848 Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence 3612-3643 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP009362 Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence 17342-17373 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP007177 Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029079 Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence 7866-7897 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_007931 Staphylococcus aureus plasmid pSA1379, complete sequence 668-699 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018957 Staphylococcus aureus plasmid p18807-P03, complete sequence 668-699 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018959 Staphylococcus aureus plasmid p18808-P03, complete sequence 662-693 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018961 Staphylococcus aureus plasmid p18809-P03, complete sequence 668-699 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018963 Staphylococcus aureus plasmid p18810-P03, complete sequence 667-698 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_018974 Staphylococcus aureus plasmid p18811-P03, complete sequence 669-700 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030700 Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence 25950-25981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014394 Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence 18871-18902 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020325 Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence 647-678 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020319 Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence 647-678 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014414 Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP025497 Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence 41779-41810 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP025497 Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence 56386-56417 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030672 Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence 12814-12845 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030433 Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030528 Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence 18895-18926 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030625 Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence 20623-20654 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030644 Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence 25902-25933 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047831 Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence 17727-17758 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047836 Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence 4515-4546 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP048646 Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence 22813-22844 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030436 Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence 4976-5007 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP019544 Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence 6047-6078 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP019546 Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence 7961-7992 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_013550 Staphylococcus aureus plasmid pBORa53, complete sequence 13204-13235 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030629 Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence 25787-25818 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030597 Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030662 Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence 12348-12379 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP016860 Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence 41779-41810 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP016860 Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence 56386-56417 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP012121 Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence 41814-41845 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP012121 Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence 56421-56452 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP053635 Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence 8278-8309 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030676 Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence 667-698 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP020021 Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence 13316-13347 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MN909556 Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence 31179-31210 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030425 Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence 12269-12300 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030602 Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030598 Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence 4931-4962 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020312 Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence 21359-21390 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP020321 Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence 647-678 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030427 Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence 25944-25975 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 9620-9651 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP014943 Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030576 Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence 667-698 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030649 Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence 22953-22984 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047857 Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence 9719-9750 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP053637 Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence 12644-12675 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP031887 Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence 47280-47311 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030408 Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence 22948-22979 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030578 Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence 14490-14521 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030694 Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence 12813-12844 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP040999 Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence 9425-9456 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP047842 Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence 10849-10880 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_AP014922 Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence 21443-21474 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030560 Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence 24585-24616 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030714 Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029666 Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence 3562-3593 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014404 Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence 18871-18902 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030485 Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence 17712-17743 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP021906 Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence 17341-17372 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP029665 Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence 8863-8894 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP016854 Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence 31240-31271 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030376 Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence 14116-14147 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030563 Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence 25949-25980 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030680 Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence 16732-16763 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_017345 Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence 7115-7146 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030509 Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030584 Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence 22889-22920 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_009619 Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence 4854-4885 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP044105 Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence 6241-6272 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030401 Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence 22947-22978 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030409 Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence 25300-25331 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030473 Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence 5945-5976 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030549 Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence 25300-25331 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP043303 Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence 26366-26397 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP039996 Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP014364 Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence 15950-15981 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP054445 Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence 24443-24474 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP040621 Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence 26370-26401 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP053638 Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence 22613-22644 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030593 Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence 15475-15506 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030511 Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence 25946-25977 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_010063 Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_MH068822 Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence 6049-6080 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_MH587574 Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence 680-711 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_MH785258 Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence 5698-5729 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP042047 Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence 34719-34750 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030405 Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence 15469-15500 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030565 Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence 15480-15511 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP022608 Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence 6784-6815 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_021552 Staphylococcus aureus CA-347 plasmid, complete sequence 899-930 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP031891 Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence 18710-18741 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NC_009477 Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence 19663-19694 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030519 Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence 456-487 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 CP030657 Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence 4976-5007 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 NZ_CP045473 Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence 11777-11808 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MG757166 Gordonia phage SuperSulley, complete genome 59774-59805 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MF919510 Gordonia phage Kabluna, complete genome 58585-58616 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MH598798 Pelagibacter phage HTVC022P, complete genome 1600-1631 10 0.688
NZ_CP053736_5 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252825-3252856 32 MH779499 Gordonia phage Buggaboo, complete genome 59774-59805 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 336675-336706 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1404898-1404929 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1367023-1367054 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 335612-335643 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1471121-1471152 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1573137-1573168 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 331703-331734 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 330856-330887 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 969811-969842 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 949767-949798 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 677508-677539 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 581426-581457 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1091515-1091546 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 212989-213020 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 631547-631578 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1119650-1119681 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 683917-683948 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 335137-335168 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1523229-1523260 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1299620-1299651 10 0.688
NZ_CP053736_5 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT 3252886-3252917 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1404905-1404936 10 0.688
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
NZ_CP053736_6 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder 3271392-3271423 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
NZ_CP053736_2 2.1|763209|59|NZ_CP053736|CRISPRCasFinder 763209-763267 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP053736_6 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT 3271392-3271424 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
NZ_CP053736_4 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder 2693415-2693463 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

2. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

3. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

4. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

5. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

6. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

7. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

8. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

9. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

10. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

11. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

12. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

13. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

14. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

15. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

16. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

17. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

18. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

19. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

20. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

21. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

22. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

23. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

24. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

25. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ccctcacaccgattcgccaaacggtggagaag	Protospacer
********************************

26. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ccctcacaccgattcgccaaacggtggagaag	Protospacer
********************************

27. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ccctcacaccgattcgccaaacggtggagaag	Protospacer
********************************

28. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

29. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

30. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

31. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

32. spacer 5.1|3252703|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc	Protospacer
***************** * ************

33. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

34. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

35. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

36. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

37. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

38. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

39. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

40. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

41. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

42. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

43. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

44. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

45. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

46. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

47. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

48. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

49. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

50. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.938

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
ctctcacaccgattcgccaaacggtagagaag	Protospacer
*.***********************.******

51. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

52. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

53. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaaccc	Protospacer
********************.*****.*** *

54. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

55. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

56. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtgagcgttaacgccgcgaacccc	Protospacer
********************.*****.*** * 

57. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacc	Protospacer
*********** ********.****** *  *

58. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 6, identity: 0.812

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ggatgattatttcaataattaattctaacaat	Protospacer
***  . *********** ***** *******

59. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 6, identity: 0.812

-ggaatgatatttcaataaataattataacaat	CRISPR spacer
tttaatga-atttctaaaaataattataacaaa	Protospacer
   ***** ***** * *************** 

60. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
gaaatgctggtcagcgttaacgccgcacaacct	Protospacer
*********** ********.****** *  * 

61. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.781

--ggaatgatatttcaataaataattataacaat	CRISPR spacer
cagcattg--atttctatagataattataacaaa	Protospacer
  * * **  ***** ***.************* 

62. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013516 (Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence) position: , mismatch: 7, identity: 0.781

ggaatgat--atttcaataaataattataacaat	CRISPR spacer
--atttatcaatttcaataaataattatgataaa	Protospacer
  * * **  ******************.*.** 

63. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027399 (Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ggaatgat--atttcaataaataattataacaat	CRISPR spacer
--atttatcaatttcaataaataattatgataaa	Protospacer
  * * **  ******************.*.** 

64. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to LN681534 (Clostridium phage phiCD24-1, complete genome) position: , mismatch: 7, identity: 0.781

ggaatgatatttcaataaataattataacaat-	CRISPR spacer
agaattatatttgaataaataatt-taataggg	Protospacer
.**** ****** *********** ***.*.  

65. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN718463 (Clostridium phage phiCDKH01, complete genome) position: , mismatch: 7, identity: 0.781

ggaatgatatttcaataaataattataacaat-	CRISPR spacer
agaattatatttgaataaataatt-taataggg	Protospacer
.**** ****** *********** ***.*.  

66. spacer 6.2|3271331|32|NZ_CP053736|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

tggctctgcaacagcagcacccatgaccacgt	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgg	Protospacer
.* ..* ****************.******* 

67. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 8, identity: 0.75

ggaatgatatttcaataaataattataacaat	CRISPR spacer
tgaatgatatttcaataactgattatctcggg	Protospacer
 ***************** *.*****  *.. 

68. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 8, identity: 0.75

ggaatgatatttcaataaataattataacaat	CRISPR spacer
tgaatgatatttcaataactgattatctcggg	Protospacer
 ***************** *.*****  *.. 

69. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 8, identity: 0.75

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ttaaaaatatttccataaaaaattataacata	Protospacer
  ** .******* ***** **********  

70. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 8, identity: 0.75

ggaatgatatttcaataaataattataacaat	CRISPR spacer
agaatgttatttaaataaataattgctacaga	Protospacer
.***** ***** ***********.. ***. 

71. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK318083 (Aeromonas phage Akh-2, complete genome) position: , mismatch: 8, identity: 0.75

ggaatgatatttcaataaataattataacaat	CRISPR spacer
gaacggcgatttcaacaagtaattataacaac	Protospacer
*.*  *  *******.**.************.

72. spacer 6.1|3271270|32|NZ_CP053736|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

73. spacer 6.2|3271331|32|NZ_CP053736|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggctctgcaacagcagcacccatgaccacgt	CRISPR spacer
catcactgcaacatcagcatccatgaccgcat	Protospacer
.. * ******** *****.********.*.*

74. spacer 6.6|3271331|33|NZ_CP053736|PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

tggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgga	Protospacer
.* ..* ****************.*******  

75. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

76. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

77. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

78. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

79. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

80. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

81. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

82. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

83. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

84. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

85. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

86. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

87. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 9, identity: 0.719

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatgatatttaaaaaaataattaacgaatt	Protospacer
. ********** ** *********  . * *

88. spacer 6.4|3271453|32|NZ_CP053736|CRISPRCasFinder matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

attacgcctttttgcgattgcccggtttttgc	CRISPR spacer
tcgtcatctttttgcgattgggcggttttttc	Protospacer
 .  *..*************  ******** *

89. spacer 2.1|763209|59|NZ_CP053736|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

90. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

91. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

92. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

93. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

94. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

95. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

96. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

97. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

98. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

99. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

100. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030488 (Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

101. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030517 (Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

102. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030707 (Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

103. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053186 (Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

104. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016857 (Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

105. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053184 (Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

106. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030633 (Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

107. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

108. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

109. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

110. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

111. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013230 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

112. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030325 (Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

113. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018956 (Staphylococcus aureus plasmid p18806-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

114. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018767 (Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

115. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030383 (Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

116. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030587 (Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

117. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030607 (Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

118. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030663 (Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

119. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039449 (Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

120. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030385 (Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

121. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030530 (Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

122. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014408 (Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

123. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014411 (Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

124. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014367 (Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

125. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054441 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

126. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to LC383633 (Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

127. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031889 (Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

128. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030387 (Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

129. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030513 (Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

130. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030666 (Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

131. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014386 (Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

132. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030397 (Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

133. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030414 (Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

134. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011527 (Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

135. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

136. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013956 (Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

137. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_003140 (Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

138. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016862 (Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

139. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_010419 (Staphylococcus aureus plasmid pTZ2162, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

140. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013954 (Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

141. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030416 (Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

142. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030477 (Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

143. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030521 (Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

144. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

145. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR130519 (Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

146. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020323 (Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

147. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030444 (Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

148. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030533 (Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

149. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014434 (Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

150. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_010077 (Staphylococcus aureus plasmid EDINA, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

151. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030466 (Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

152. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030555 (Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

153. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011529 (Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

154. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013289 (Staphylococcus aureus plasmid SAP015A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

155. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013292 (Staphylococcus aureus plasmid pWBG752, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

156. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013294 (Staphylococcus aureus plasmid SAP046A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

157. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013296 (Staphylococcus aureus plasmid SAP049A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

158. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013298 (Staphylococcus aureus plasmid SAP050A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

159. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013299 (Staphylococcus aureus plasmid SAP051A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

160. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018952 (Staphylococcus aureus plasmid pWBG747, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

161. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029677 (Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

162. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035102 (Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

163. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029199 (Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

164. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030523 (Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

165. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030616 (Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

166. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to LC377540 (Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

167. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_019150 (Staphylococcus aureus plasmid p18805-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

168. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_019148 (Staphylococcus aureus PM1 plasmid pPM1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

169. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030442 (Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

170. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030494 (Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

171. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030698 (Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

172. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014063 (Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

173. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007679 (Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

174. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030324 (Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

175. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933272 (Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

176. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933273 (Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

177. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933274 (Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

178. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933275 (Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

179. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933276 (Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

180. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017095 (Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

181. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_005127 (Staphylococcus aureus plasmid pUB101, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

182. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933268 (Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

183. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933269 (Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

184. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933270 (Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

185. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MK933271 (Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

186. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020314 (Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

187. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012118 (Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

188. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030571 (Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

189. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030567 (Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

190. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030461 (Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

191. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030535 (Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

192. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030643 (Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

193. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030669 (Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

194. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030623 (Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

195. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013322 (Staphylococcus aureus plasmid SAP019A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

196. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013324 (Staphylococcus aureus plasmid SAP027A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

197. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013326 (Staphylococcus aureus plasmid pWBG746, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

198. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013330 (Staphylococcus aureus plasmid pWBG759, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

199. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013332 (Staphylococcus aureus plasmid SAP052A, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

200. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013348 (Staphylococcus aureus plasmid pSK156, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

201. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030463 (Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

202. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030697 (Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

203. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_023278 (Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

204. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP040802 (Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

205. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030446 (Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

206. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030536 (Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

207. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030660 (Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

208. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025250 (Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

209. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030539 (Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

210. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030690 (Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

211. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

212. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047848 (Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

213. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009362 (Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

214. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007177 (Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

215. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029079 (Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

216. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_007931 (Staphylococcus aureus plasmid pSA1379, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

217. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018957 (Staphylococcus aureus plasmid p18807-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

218. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018959 (Staphylococcus aureus plasmid p18808-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

219. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018961 (Staphylococcus aureus plasmid p18809-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

220. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018963 (Staphylococcus aureus plasmid p18810-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

221. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018974 (Staphylococcus aureus plasmid p18811-P03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

222. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030700 (Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

223. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014394 (Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

224. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020325 (Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

225. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020319 (Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

226. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014414 (Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

227. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

228. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

229. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030672 (Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

230. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030433 (Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

231. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030528 (Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

232. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030625 (Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

233. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030644 (Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

234. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047831 (Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

235. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

236. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048646 (Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

237. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030436 (Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

238. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019544 (Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

239. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019546 (Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

240. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

241. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030629 (Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

242. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030597 (Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

243. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030662 (Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

244. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

245. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

246. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

247. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

248. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053635 (Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

249. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030676 (Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

250. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020021 (Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

251. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MN909556 (Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

252. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030425 (Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

253. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030602 (Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

254. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030598 (Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

255. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020312 (Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

256. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP020321 (Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

257. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030427 (Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

258. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

259. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014943 (Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

260. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030576 (Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

261. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030649 (Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

262. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

263. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053637 (Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

264. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031887 (Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

265. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030408 (Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

266. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030578 (Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

267. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030694 (Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

268. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040999 (Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

269. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047842 (Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

270. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014922 (Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

271. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030560 (Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

272. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030714 (Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

273. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029666 (Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

274. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014404 (Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

275. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030485 (Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

276. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021906 (Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

277. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029665 (Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

278. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016854 (Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

279. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030376 (Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

280. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030563 (Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

281. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030680 (Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

282. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_017345 (Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

283. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030509 (Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

284. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030584 (Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

285. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_009619 (Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

286. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044105 (Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

287. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030401 (Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

288. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030409 (Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

289. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030473 (Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

290. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030549 (Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

291. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043303 (Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

292. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039996 (Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

293. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014364 (Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

294. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054445 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

295. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040621 (Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

296. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053638 (Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

297. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030593 (Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

298. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030511 (Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

299. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_010063 (Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

300. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH068822 (Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

301. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

302. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH785258 (Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

303. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042047 (Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

304. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030405 (Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

305. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030565 (Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

306. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022608 (Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

307. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_021552 (Staphylococcus aureus CA-347 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

308. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031891 (Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

309. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_009477 (Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

310. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030519 (Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

311. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to CP030657 (Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataatcatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

312. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045473 (Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
ataattatattttaataaataattagttagtt	Protospacer
. *** ******.************    . *

313. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MG757166 (Gordonia phage SuperSulley, complete genome) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
atgatgatatttgaatgaataattatgtgaga	Protospacer
. .********* ***.*********.  *. 

314. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MF919510 (Gordonia phage Kabluna, complete genome) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
atgatgatatttgaatgaataattatgtgaga	Protospacer
. .********* ***.*********.  *. 

315. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
aaaaagatacttcaataaataattaagaacgc	Protospacer
..** ****.*************** .*  ..

316. spacer 5.3|3252825|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to MH779499 (Gordonia phage Buggaboo, complete genome) position: , mismatch: 10, identity: 0.688

ggaatgatatttcaataaataattataacaat	CRISPR spacer
atgatgatatttgaatgaataattatgtgaga	Protospacer
. .********* ***.*********.  *. 

317. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

318. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

319. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

320. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

321. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

322. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

323. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

324. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

325. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

326. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

327. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

328. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

329. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

330. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

331. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

332. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

333. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

334. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

335. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

336. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

337. spacer 5.4|3252886|32|NZ_CP053736|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

ccctcacaccgattcgccaaacggtggagaag	CRISPR spacer
tcgggcaaccgattcccgaaacggtggagatt	Protospacer
.*     ******** * ************  

338. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaa	Protospacer
 ..   .*** ************.******* 

339. spacer 6.3|3271392|32|NZ_CP053736|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688

gaaatgctggtgagcgttaatgccgcaaacac	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaa	Protospacer
 ..   .*** ************.******* 

340. spacer 2.1|763209|59|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

341. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

342. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

343. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

344. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

345. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

346. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

347. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

348. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

349. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

350. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

351. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

352. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

353. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

354. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

355. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

356. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

357. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

358. spacer 6.7|3271392|33|NZ_CP053736|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

gaaatgctggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

359. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

360. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

361. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

362. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

363. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

364. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

365. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

366. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

367. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

368. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

369. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

370. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

371. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

372. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

373. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

374. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

375. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

376. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

377. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

378. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

379. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

380. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

381. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

382. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

383. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

384. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

385. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

386. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

387. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

388. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

389. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

390. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

391. spacer 4.1|2693415|49|NZ_CP053736|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8399 9 Escherichia_phage(60.0%) integrase,tRNA attL 215:226|attR 3256:3267
DBSCAN-SWA_2 12586 : 16199 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_3 20016 : 21366 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_4 26949 : 28908 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 38418 : 40566 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_6 45811 : 52180 5 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_7 58414 : 59964 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_8 65576 : 66365 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_9 71401 : 72904 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_10 94100 : 97312 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_11 111588 : 113572 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_12 118089 : 118623 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_13 123543 : 124521 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_14 132504 : 133050 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_15 136965 : 149996 11 Vibrio_phage(20.0%) tRNA,protease NA
DBSCAN-SWA_16 153928 : 155092 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_17 169044 : 169741 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_18 197408 : 203896 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_19 208212 : 210973 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_20 214611 : 220708 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_21 229011 : 241126 8 Klosneuvirus(20.0%) integrase,tRNA attL 236261:236274|attR 242160:242173
DBSCAN-SWA_22 249221 : 250898 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_23 260025 : 261486 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_24 268054 : 268609 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_25 293169 : 298534 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_26 301761 : 303041 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_27 310980 : 312570 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_28 319895 : 321218 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_29 327960 : 333315 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_30 336657 : 338771 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_31 350540 : 360958 10 Cyanophage(20.0%) transposase NA
DBSCAN-SWA_32 367989 : 370806 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_33 375249 : 376398 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_34 381992 : 387653 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_35 395545 : 396945 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_36 406081 : 411504 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_37 417952 : 418651 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_38 431353 : 433078 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_39 459167 : 460211 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_40 464456 : 465008 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_41 473634 : 475059 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_42 482805 : 489428 5 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_43 492690 : 493593 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_44 499956 : 506762 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_45 512005 : 512803 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_46 518837 : 519182 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_47 523111 : 524536 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_48 537133 : 537892 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_49 546720 : 550836 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_50 563841 : 564873 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_51 571384 : 579016 8 Indivirus(25.0%) NA NA
DBSCAN-SWA_52 584343 : 592612 5 uncultured_Caudovirales_phage(100.0%) transposase NA
DBSCAN-SWA_53 598714 : 602633 6 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_54 616610 : 619568 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_55 649022 : 656604 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_56 673595 : 674921 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_57 680496 : 686416 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_58 697772 : 698822 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_59 707594 : 709481 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 712679 : 713579 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_61 718119 : 722399 2 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_62 727809 : 729770 2 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_63 733148 : 734258 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_64 739558 : 740326 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_65 747220 : 748378 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_66 755792 : 756908 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_67 761197 : 771274 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_68 778226 : 787207 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_69 808766 : 813813 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_70 816941 : 817637 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_71 820960 : 824507 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_72 833343 : 836493 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_73 843501 : 852063 8 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_74 860307 : 863469 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_75 868008 : 868686 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 871822 : 879630 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_77 886003 : 887785 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_78 893975 : 895121 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_79 906698 : 909829 4 Moumouvirus(50.0%) tRNA NA
DBSCAN-SWA_80 924129 : 926245 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_81 929390 : 932534 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_82 944833 : 950875 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_83 965422 : 967245 2 uncultured_marine_virus(50.0%) NA NA
DBSCAN-SWA_84 970428 : 972543 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_85 987967 : 988614 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_86 993427 : 995866 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_87 1002876 : 1005459 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_88 1012398 : 1015931 3 Bathycoccus_sp._RCC1105_virus(50.0%) NA NA
DBSCAN-SWA_89 1021814 : 1022855 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_90 1026989 : 1028654 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_91 1033420 : 1037234 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_92 1050532 : 1063259 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_93 1066732 : 1069782 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_94 1073160 : 1073952 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_95 1110482 : 1114002 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_96 1118355 : 1124929 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_97 1135284 : 1136574 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_98 1143055 : 1143964 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_99 1154561 : 1169373 13 Anomala_cuprea_entomopoxvirus(14.29%) NA NA
DBSCAN-SWA_100 1173057 : 1178282 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_101 1183279 : 1191621 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_102 1194836 : 1196708 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_103 1208043 : 1209246 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_104 1215754 : 1303680 93 Salmonella_phage(55.56%) head,terminase,capsid,lysis,protease,tail,integrase,portal,tRNA,plate attL 1212795:1212810|attR 1307392:1307407
DBSCAN-SWA_105 1309988 : 1313203 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_106 1317301 : 1318390 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_107 1323476 : 1328018 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_108 1342723 : 1353856 8 Rhodobacter_phage(20.0%) tRNA NA
DBSCAN-SWA_109 1369778 : 1371686 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_110 1384296 : 1386351 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_111 1390584 : 1391244 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_112 1409354 : 1424025 16 Acinetobacter_phage(16.67%) transposase NA
DBSCAN-SWA_113 1428330 : 1430430 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_114 1445542 : 1446331 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_115 1453147 : 1454515 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_116 1458088 : 1458922 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_117 1463833 : 1464367 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_118 1473675 : 1474596 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_119 1479256 : 1479502 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_120 1495385 : 1496327 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_121 1508684 : 1509866 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_122 1513138 : 1514781 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_123 1527087 : 1527345 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_124 1534633 : 1538374 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_125 1541631 : 1543609 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_126 1548630 : 1550001 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_127 1553137 : 1556870 5 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_128 1573576 : 1575264 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_129 1601933 : 1604685 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_130 1607821 : 1616072 10 Pseudomonas_phage(25.0%) transposase NA
DBSCAN-SWA_131 1627327 : 1637691 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_132 1646101 : 1648116 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_133 1659774 : 1662732 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_134 1669701 : 1674993 4 Chrysochromulina_ericina_virus(33.33%) protease NA
DBSCAN-SWA_135 1679917 : 1680508 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_136 1688325 : 1693982 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_137 1706897 : 1708163 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_138 1722167 : 1723250 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_139 1739869 : 1740385 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_140 1746711 : 1753982 6 Bacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_141 1758942 : 1759932 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_142 1797590 : 1801493 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_143 1804945 : 1805894 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_144 1817700 : 1827874 10 Escherichia_phage(20.0%) transposase NA
DBSCAN-SWA_145 1835006 : 1837109 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_146 1842015 : 1848065 3 Ralstonia_phage(50.0%) transposase NA
DBSCAN-SWA_147 1852128 : 1853673 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_148 1860557 : 1860848 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_149 1867039 : 1868480 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_150 1871753 : 1873659 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_151 1877975 : 1881764 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_152 1908073 : 1909609 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 1926250 : 1926634 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_154 1929636 : 1930527 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_155 1936562 : 1956308 20 Escherichia_phage(30.77%) tail NA
DBSCAN-SWA_156 1974069 : 1975371 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 1985447 : 1987259 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_158 2007135 : 2008410 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_159 2015321 : 2016820 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_160 2025622 : 2034503 9 Streptomyces_phage(20.0%) NA NA
DBSCAN-SWA_161 2040007 : 2042274 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_162 2050563 : 2055647 5 environmental_halophage(33.33%) NA NA
DBSCAN-SWA_163 2074291 : 2093831 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_164 2105127 : 2107389 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_165 2113718 : 2114546 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_166 2122022 : 2123243 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_167 2130007 : 2130661 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_168 2136259 : 2138221 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_169 2143147 : 2147232 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_170 2160215 : 2164792 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_171 2179320 : 2187426 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_172 2191288 : 2192845 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_173 2198485 : 2198695 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_174 2204027 : 2206076 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_175 2213572 : 2218042 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_176 2226098 : 2227574 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_177 2231572 : 2238636 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_178 2242654 : 2244705 3 Escherichia_coli_phage(50.0%) NA NA
DBSCAN-SWA_179 2251321 : 2253055 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_180 2258307 : 2263951 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_181 2274033 : 2275548 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_182 2293680 : 2296965 1 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_183 2310483 : 2311236 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_184 2323455 : 2324127 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_185 2339311 : 2351745 12 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_186 2356067 : 2393505 20 Pseudomonas_phage(37.5%) integrase,transposase attL 2386682:2386741|attR 2394468:2395236
DBSCAN-SWA_187 2400101 : 2400911 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_188 2418404 : 2419571 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_189 2427215 : 2428115 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_190 2435468 : 2440632 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_191 2446397 : 2455437 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_192 2461026 : 2467820 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_193 2472064 : 2482455 9 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_194 2487119 : 2488472 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_195 2502320 : 2509185 8 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_196 2518404 : 2521961 4 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_197 2532647 : 2534681 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_198 2550244 : 2559688 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_199 2580109 : 2581630 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_200 2585324 : 2589110 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_201 2593180 : 2594038 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_202 2608566 : 2612867 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_203 2618621 : 2626269 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_204 2638143 : 2638761 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2647868 : 2653646 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_206 2657923 : 2662766 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_207 2682967 : 2685595 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 2691039 : 2697186 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_209 2703078 : 2707589 5 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_210 2711192 : 2716196 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_211 2755035 : 2758263 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_212 2768822 : 2770683 2 Sodalis_phage(50.0%) NA NA
DBSCAN-SWA_213 2774894 : 2776412 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_214 2782888 : 2784025 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_215 2792561 : 2793647 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_216 2812809 : 2813742 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_217 2821667 : 2829244 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_218 2832938 : 2833859 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_219 2837676 : 2838411 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_220 2865298 : 2877952 12 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_221 2880969 : 2881761 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_222 2885239 : 2890359 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_223 2909013 : 2909964 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_224 2927252 : 2927966 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_225 2950567 : 2954569 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_226 2960816 : 3007896 58 Escherichia_phage(50.91%) tail,integrase,holin,terminase attL 2962653:2962669|attR 3003250:3003266
DBSCAN-SWA_227 3016726 : 3017158 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_228 3027368 : 3033825 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_229 3049052 : 3050564 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_230 3056456 : 3067746 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_231 3071865 : 3072126 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_232 3075585 : 3079327 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_233 3085098 : 3091357 7 Cafeteria_roenbergensis_virus(25.0%) tRNA NA
DBSCAN-SWA_234 3096650 : 3097949 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_235 3103803 : 3106377 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_236 3112283 : 3113354 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_237 3127099 : 3140065 15 Shigella_phage(53.33%) transposase NA
DBSCAN-SWA_238 3145107 : 3149159 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_239 3153095 : 3158390 5 Oenococcus_phage(20.0%) NA NA
DBSCAN-SWA_240 3171340 : 3176726 5 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_241 3182192 : 3183158 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_242 3190633 : 3191644 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_243 3209766 : 3220594 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_244 3229201 : 3245247 15 Escherichia_phage(41.67%) NA NA
DBSCAN-SWA_245 3248359 : 3250392 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_246 3266715 : 3267501 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_247 3271852 : 3276772 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_248 3280804 : 3284919 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_249 3292453 : 3293302 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_250 3298160 : 3298916 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_251 3310442 : 3325990 9 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_252 3331466 : 3338239 6 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_253 3347869 : 3350364 2 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_254 3373114 : 3373870 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_255 3378789 : 3379487 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_256 3387398 : 3406374 14 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_257 3410298 : 3415672 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_258 3423808 : 3425041 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_259 3454112 : 3455267 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_260 3501771 : 3502944 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_261 3525154 : 3526039 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_262 3532115 : 3541466 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_263 3544776 : 3545169 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_264 3548996 : 3559959 12 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_265 3565470 : 3633137 58 Staphylococcus_phage(12.5%) tRNA,transposase NA
DBSCAN-SWA_266 3639218 : 3651555 9 Salmonella_phage(40.0%) integrase,tRNA attL 3628087:3628102|attR 3652771:3652786
DBSCAN-SWA_267 3664409 : 3665375 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_268 3685953 : 3688248 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_269 3696454 : 3697600 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_270 3720609 : 3728403 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_271 3734105 : 3735995 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_272 3741476 : 3748115 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_273 3752197 : 3755070 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_274 3761844 : 3763322 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_275 3767390 : 3782185 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_276 3794762 : 3799510 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_277 3803214 : 3803712 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_278 3807678 : 3810203 2 uncultured_Mediterranean_phage(50.0%) protease NA
DBSCAN-SWA_279 3826979 : 3828023 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_280 3838588 : 3839473 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_281 3845977 : 3850131 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_282 3860624 : 3862096 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_283 3883311 : 3885264 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_284 3897079 : 3902653 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_285 3908223 : 3917764 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_286 3942011 : 3942848 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_287 3959752 : 3963519 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_288 3970101 : 3970980 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_289 3977014 : 3979408 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_290 3982767 : 3984546 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_291 3990601 : 3993049 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_292 4013059 : 4014870 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_293 4018413 : 4019896 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_294 4025618 : 4028437 3 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_295 4031440 : 4035572 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_296 4043465 : 4049117 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_297 4053269 : 4056005 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_298 4069606 : 4071649 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_299 4074994 : 4077129 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_300 4080522 : 4081170 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_301 4123014 : 4124999 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_302 4135064 : 4137398 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_303 4141052 : 4143052 3 Morganella_phage(50.0%) transposase NA
DBSCAN-SWA_304 4146890 : 4147886 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_305 4153204 : 4154746 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_306 4179020 : 4180865 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_307 4186178 : 4187117 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_308 4203142 : 4212697 9 Rhizobium_phage(16.67%) NA NA
DBSCAN-SWA_309 4227862 : 4232425 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_310 4235753 : 4250861 17 Morganella_phage(25.0%) integrase attL 4231641:4231654|attR 4252036:4252049
DBSCAN-SWA_311 4255294 : 4256686 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_312 4268804 : 4270139 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_313 4277445 : 4286466 10 Micromonas_sp._RCC1109_virus(25.0%) NA NA
DBSCAN-SWA_314 4292818 : 4293772 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_315 4298199 : 4299348 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_316 4304054 : 4311423 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_317 4321621 : 4322959 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_318 4333942 : 4341550 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_319 4353504 : 4354497 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_320 4357665 : 4363518 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_321 4376909 : 4378556 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_322 4387028 : 4392442 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_323 4396484 : 4402628 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_324 4410703 : 4412359 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_325 4422656 : 4426515 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_326 4432233 : 4434063 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_327 4446595 : 4449882 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_328 4458763 : 4459378 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_329 4473226 : 4476013 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_330 4480129 : 4482600 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_331 4498935 : 4501715 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_332 4509032 : 4512083 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_333 4527069 : 4531930 5 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_334 4543504 : 4548007 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_335 4565305 : 4572552 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_336 4589898 : 4591743 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_337 4600335 : 4603388 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_338 4607504 : 4615833 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_339 4625049 : 4626813 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_340 4632202 : 4633792 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_341 4650184 : 4653868 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_342 4673140 : 4674256 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_343 4683471 : 4684080 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_344 4688025 : 4725618 59 Shigella_phage(54.39%) holin,head,terminase,capsid,protease,tail,portal,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP053739
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053739_1 17247-17381 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP053738.1 3118-3144 2 0.926
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053738.1 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053738.1 3225-3248 1 0.958

1. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to position: 3118-3144, mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

2. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to position: 3173-3196, mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

3. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to position: 3225-3248, mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 55096-55122 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP029493 Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence 78336-78362 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 69340-69366 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 36593-36619 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021943 Klebsiella pneumoniae strain AR_0145 plasmid tig00000219, complete sequence 31813-31839 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MG780294 Escherichia coli plasmid pHN8, complete sequence 36774-36800 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP017989 Klebsiella pneumoniae strain 825795-1 plasmid unnamed4, complete sequence 24553-24579 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP010174 Escherichia coli strain H8 plasmid B, complete sequence 15168-15194 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 6306-6332 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP010396 Klebsiella pneumoniae strain 34618 plasmid p34618-71.572kb, complete sequence 15215-15241 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP053739 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence 17275-17301 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018718 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-4, complete sequence 17797-17823 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018705 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-4, complete sequence 10242-10268 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 47891-47917 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020500 Klebsiella pneumoniae strain BWHC1 plasmid unnamed2, complete sequence 838-864 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_018994 Escherichia coli plasmid pNDM-1_Dok01, complete sequence 142348-142374 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 LC155908 Klebsiella pneumoniae plasmid pKUN4843_1 DNA, complete sequence, strain: KUN4843 11106-11132 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044309 Escherichia coli strain C27A plasmid pC27A-4, complete sequence 29562-29588 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 46648-46674 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP025944 Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence 9176-9202 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP019017 Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence 64581-64607 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040177 Klebsiella pneumoniae strain 2e plasmid unnamed2, complete sequence 6643-6669 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 100684-100710 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018354 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence 35754-35780 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 43718-43744 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP027047 Klebsiella pneumoniae strain 1_GR_13 plasmid IncR IncN, complete sequence 40179-40205 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP010149 Escherichia coli strain D6 plasmid A, complete sequence 162573-162599 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020073 Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence 33767-33793 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020110 Klebsiella pneumoniae strain AR_0098 plasmid tig00000002, complete sequence 52480-52506 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP015991 Klebsiella pneumoniae strain BR plasmid pWSZBR, complete sequence 49778-49804 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP042971 Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence 22715-22741 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP045065 Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence 51094-51120 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 177018-177044 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021858 Klebsiella pneumoniae strain AR_0125 plasmid tig00000005_pilon, complete sequence 2381-2407 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021881 Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence 46250-46276 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 91693-91719 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP039605 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.2, complete sequence 2497-2523 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021948 Klebsiella pneumoniae strain AR_0152 plasmid tig00000214, complete sequence 21623-21649 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP014299 Klebsiella pneumoniae strain KP38731 plasmid unnamed3, complete sequence 14012-14038 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 23298-23324 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035209 Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence 71783-71809 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 146241-146267 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP043936 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence 57303-57329 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018699 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence 47311-47337 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 26373-26399 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018711 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-4, complete sequence 3577-3603 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MN268581 Klebsiella pneumoniae strain KP18-50 plasmid pKP18-50-tet(A), complete sequence 7446-7472 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG825383 Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence 178292-178318 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG252895 Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence 136788-136814 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG836696 Escherichia coli strain 2248 plasmid pCTXM-2248, complete sequence 49831-49857 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 113509-113535 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MF510424 Klebsiella pneumoniae strain JAB-1 plasmid pKp-CTX-M, complete sequence 49940-49966 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 21972-21998 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KY296104 Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence 16098-16124 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KY751925 Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence 61925-61951 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KU665641 Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence 32911-32937 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 32953-32979 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021755 Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence 22748-22774 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 2234-2260 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018724 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence 15853-15879 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 3595-3621 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_021576 Klebsiella pneumoniae plasmid pKP1780, complete sequence 21724-21750 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_023314 Klebsiella pneumoniae plasmid pKPS30, complete sequence 11202-11228 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044204 Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence 50978-51004 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP023841 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence 23346-23372 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 98975-99001 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 86309-86335 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP029586 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence 8983-9009 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 53777-53803 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 12417-12443 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 27056-27082 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 19607-19633 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021547 Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence 6664-6690 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 1182-1208 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP047338 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence 47277-47303 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 46359-46385 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP008798 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence 76113-76139 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP043753 Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence 47783-47809 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 59724-59750 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040731 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2 17626-17652 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP039328 Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence 12132-12158 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 51692-51718 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 75221-75247 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP019074 Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence 31949-31975 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 18439-18465 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018316 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence 37901-37927 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP027150 Klebsiella pneumoniae strain AR_0363 plasmid unnamed3 28411-28437 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 36808-36834 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP014758 Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence 23301-23327 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP011644 Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence 19440-19466 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP027162 Klebsiella pneumoniae strain AR_0361 plasmid unnamed3 19743-19769 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP034789 Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence 41648-41674 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018691 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence 38228-38254 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035212 Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence 19460-19486 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 38830-38856 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052366 Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence 16611-16637 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 16989-17015 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018105 Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence 13189-13215 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 67819-67845 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044371 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence 10219-10245 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 22593-22619 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 74037-74063 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT994837 Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence 11054-11080 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT994839 Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence 10897-10923 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT994834 Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence 4530-4556 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT994836 Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence 10951-10977 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 KX863570 Uncultured bacterium plasmid pTRE-1611 clone TRE-1611, complete sequence 11350-11376 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_LT985322 Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence 35471-35497 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 71339-71365 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 87193-87219 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 189692-189718 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MK248692 Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence 61409-61435 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH341574 Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence 94989-95015 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 11241-11267 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 49207-49233 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG557997 Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 23440-23466 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 64186-64212 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH919378 Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence 11883-11909 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032227 Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence 20613-20639 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 48736-48762 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 79076-79102 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MF497780 Citrobacter freundii strain Cfr-31816cz plasmid pCfr-31816cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG557996 Citrobacter freundii strain Cfr-33038cz plasmid pCfr-33038cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG557994 Citrobacter freundii strain Cfr-27569cz plasmid pCfr-27569cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MG557995 Citrobacter freundii strain Cfr-31260cz plasmid pCfr-31260cz, complete sequence 13890-13916 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_023330 Klebsiella pneumoniae strain KPS77 plasmid pKPS77, complete sequence 11349-11375 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 35670-35696 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 9068-9094 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052333 Klebsiella pneumoniae strain D17KP0022 plasmid pD17KP0022-1, complete sequence 36581-36607 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 55162-55185 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KY296104 Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence 16046-16069 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP034757 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence 19953-19976 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP050835 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence 143143-143166 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KU665641 Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence 32859-32882 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 69395-69418 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 36648-36671 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021943 Klebsiella pneumoniae strain AR_0145 plasmid tig00000219, complete sequence 31868-31891 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_014368 Klebsiella pneumoniae plasmid pNL194, complete sequence 32900-32923 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MG780294 Escherichia coli plasmid pHN8, complete sequence 36829-36852 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP017989 Klebsiella pneumoniae strain 825795-1 plasmid unnamed4, complete sequence 24608-24631 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 KY486279 Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence 2182-2205 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052410 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence 36529-36552 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 20488-20511 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024194 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence 74702-74725 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP010174 Escherichia coli strain H8 plasmid B, complete sequence 15223-15246 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 6361-6384 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 71236-71259 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053739 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence 17330-17353 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 70636-70659 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018718 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-4, complete sequence 17852-17875 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018724 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence 15801-15824 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018705 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-4, complete sequence 10297-10320 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 47946-47969 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_021576 Klebsiella pneumoniae plasmid pKP1780, complete sequence 21672-21695 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 51923-51946 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 53364-53387 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP044204 Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence 50926-50949 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020531 Enterobacter cloacae strain 174 plasmid unnamed3, complete sequence 25533-25556 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_018994 Escherichia coli plasmid pNDM-1_Dok01, complete sequence 142403-142426 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020856 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence 63149-63172 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 LC549808 Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence 104629-104652 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 LC155908 Klebsiella pneumoniae plasmid pKUN4843_1 DNA, complete sequence, strain: KUN4843 11161-11184 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP035381 Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence 25731-25754 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032878 Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence 19969-19992 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP044309 Escherichia coli strain C27A plasmid pC27A-4, complete sequence 29617-29640 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018819 Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence 53534-53557 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP023841 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence 23294-23317 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 46703-46726 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 98923-98946 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP025944 Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence 9231-9254 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP022443 Klebsiella sp. LY plasmid unnamed2, complete sequence 3484-3507 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052417 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence 16768-16791 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP025213 Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence 86257-86280 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 64054-64077 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP029135 Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence 16209-16232 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP029586 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence 8931-8954 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052554 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence 36521-36544 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 28632-28655 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP014125 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed3 1366-1389 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026753 Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence 68113-68136 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021168 Enterobacter hormaechei strain 388 plasmid p388, complete sequence 53156-53179 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_024960 Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence 12365-12388 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 26993-27016 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 19555-19578 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP043751 Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence 1130-1153 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP031581 Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence 32635-32658 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 43773-43796 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP027047 Klebsiella pneumoniae strain 1_GR_13 plasmid IncR IncN, complete sequence 40234-40257 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021688 Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence 27999-28022 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 46307-46330 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP036311 Enterobacter hormaechei strain WCHEH090011 plasmid pCTXM65_090011, complete sequence 42015-42038 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021163 Enterobacter hormaechei strain 234 plasmid p234, complete sequence 14620-14643 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 18682-18705 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 80099-80122 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 12492-12515 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 13855-13878 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP043753 Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence 47731-47754 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP009116 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence 60837-60860 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 59672-59695 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040697 Citrobacter freundii strain R47 plasmid pR47-54, complete sequence 34009-34032 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP010149 Escherichia coli strain D6 plasmid A, complete sequence 162628-162651 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP039328 Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence 12080-12103 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052289 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence 16114-16137 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 20567-20590 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 384009-384032 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP015991 Klebsiella pneumoniae strain BR plasmid pWSZBR, complete sequence 49833-49856 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 45544-45567 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028931 Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence 5045-5068 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 18387-18410 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP025517 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_B, complete sequence 35988-36011 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP042971 Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence 22770-22793 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP043758 Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence 21970-21993 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP016919 Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence 35784-35807 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 60570-60593 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 12259-12282 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024524 Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence 74702-74725 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 204424-204447 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP045065 Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence 51149-51172 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018451 Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence 50794-50817 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 177073-177096 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040362 Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence 45155-45178 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 19961-19984 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021881 Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence 46305-46328 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 91748-91771 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP039605 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.2, complete sequence 2552-2575 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 156260-156283 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018316 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence 37849-37872 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032212 Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence 72916-72939 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence 27942-27965 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 100716-100739 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021712 Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence 66448-66471 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP027606 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence 20408-20431 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 12259-12282 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP014758 Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence 23249-23272 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021948 Klebsiella pneumoniae strain AR_0152 plasmid tig00000214, complete sequence 21678-21701 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP035201 Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence 5847-5870 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP025578 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence 24997-25020 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 16574-16597 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 12259-12282 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP006801 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence 49915-49938 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 23353-23376 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018691 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence 38176-38199 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 29004-29027 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP035209 Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence 71838-71861 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 395679-395702 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP035212 Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence 19408-19431 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024573 Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence 75530-75553 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 AP022352 Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence 59152-59175 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 38778-38801 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021698 Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence 16937-16960 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024566 Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence 74702-74725 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026852 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence 40033-40056 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence 27942-27965 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018105 Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence 13137-13160 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP043936 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence 57358-57381 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 67767-67790 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021952 Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence 67033-67056 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052479 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence 36521-36544 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026018 Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence 39268-39291 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP044371 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence 10167-10190 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032176 Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence 2169-2192 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP006662 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence 15560-15583 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 22541-22564 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 73985-74008 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052471 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence 65582-65605 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018989 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence 49767-49790 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018699 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence 47366-47389 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 KX863570 Uncultured bacterium plasmid pTRE-1611 clone TRE-1611, complete sequence 11298-11321 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT985322 Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence 35419-35442 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 26428-26451 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018711 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-4, complete sequence 3632-3655 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MN268581 Klebsiella pneumoniae strain KP18-50 plasmid pKP18-50-tet(A), complete sequence 7501-7524 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041086 Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence 15910-15933 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP044120 Raoultella planticola strain S25 plasmid pS25-68, complete sequence 19430-19453 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH909332 Klebsiella pneumoniae strain A1731 plasmid pA1731-KPC, complete sequence 11751-11774 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH909338 Klebsiella pneumoniae strain A1759 plasmid pA1759-KPC, complete sequence 53313-53336 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MK036885 Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence 13492-13515 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH341574 Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence 94937-94960 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020091 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence 40611-40634 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MN657243 Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence 37508-37531 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 112892-112915 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 49155-49178 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG252895 Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence 136843-136866 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH477637 Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence 54415-54438 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG836696 Escherichia coli strain 2248 plasmid pCTXM-2248, complete sequence 49886-49909 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH919378 Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence 11779-11802 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH919378 Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence 11831-11854 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032227 Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence 20561-20584 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 48684-48707 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 113564-113587 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 79024-79047 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018448 Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence 12022-12045 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP035538 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-3, complete sequence 36838-36861 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MF510424 Klebsiella pneumoniae strain JAB-1 plasmid pKp-CTX-M, complete sequence 49995-50018 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_023330 Klebsiella pneumoniae strain KPS77 plasmid pKPS77, complete sequence 11297-11320 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 9016-9039 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 93867-93890 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018737 Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1 72449-72472 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP033776 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence 1696-1719 0 1.0
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP033776 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence 38569-38592 0 1.0
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP043758 Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence 22011-22037 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 100757-100783 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP034757 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence 19898-19924 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 20433-20459 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 71181-71207 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020531 Enterobacter cloacae strain 174 plasmid unnamed3, complete sequence 25478-25504 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020856 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence 63094-63120 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035381 Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence 25676-25702 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032878 Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence 19914-19940 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052417 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence 16713-16739 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 63999-64025 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP029135 Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence 16154-16180 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021168 Enterobacter hormaechei strain 388 plasmid p388, complete sequence 53101-53127 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021163 Enterobacter hormaechei strain 234 plasmid p234, complete sequence 14565-14591 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052289 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence 16059-16085 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 20512-20538 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028931 Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence 4990-5016 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP016919 Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence 35729-35755 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 60515-60541 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040362 Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence 45100-45126 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 19906-19932 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 49675-49701 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence 27887-27913 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP027606 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence 20353-20379 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP025578 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence 24942-24968 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP006801 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence 49860-49886 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 28949-28975 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 AP022352 Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence 59097-59123 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence 27887-27913 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026018 Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence 39213-39239 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP006662 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence 15505-15531 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018989 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence 49712-49738 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MN657243 Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence 37453-37479 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 112837-112863 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH477637 Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence 54360-54386 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018448 Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence 11967-11993 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 93812-93838 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018737 Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1 72394-72420 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP050835 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence 143195-143221 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KJ958927 Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence 53997-54023 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052410 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence 36581-36607 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024194 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence 74754-74780 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 70688-70714 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 51975-52001 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 53416-53442 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 LC549808 Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence 104681-104707 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018819 Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence 53586-53612 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052554 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence 36573-36599 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 28695-28721 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP014125 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed3 1429-1455 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026753 Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence 68165-68191 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021688 Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence 28051-28077 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP036311 Enterobacter hormaechei strain WCHEH090011 plasmid pCTXM65_090011, complete sequence 42067-42093 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 12555-12581 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 13907-13933 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP009116 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence 60889-60915 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040697 Citrobacter freundii strain R47 plasmid pR47-54, complete sequence 34061-34087 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 384061-384087 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 45596-45622 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP025517 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_B, complete sequence 36040-36066 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024524 Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence 74754-74780 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 204476-204502 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP018451 Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence 50846-50872 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 156312-156338 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032212 Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence 72968-72994 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021712 Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence 66500-66526 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 395731-395757 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024573 Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence 75582-75608 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024566 Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence 74754-74780 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP021952 Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence 67085-67111 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052479 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence 36573-36599 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032176 Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence 2221-2247 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 CP052471 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence 65634-65660 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041086 Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence 15962-15988 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044120 Raoultella planticola strain S25 plasmid pS25-68, complete sequence 19482-19508 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MN218814 Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence 24356-24382 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP020091 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence 40663-40689 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035538 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-3, complete sequence 36890-36916 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP033776 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence 1748-1774 1 0.963
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP033776 Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence 38621-38647 1 0.963
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 70353-70376 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 70405-70428 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 37382-37405 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 37434-37457 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 108544-108567 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 108596-108619 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP029493 Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence 78391-78414 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 56940-56963 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 56992-57015 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP047092 Salmonella sp. S13 plasmid pS13-3, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 99785-99808 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 99837-99860 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 7838-7861 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 7890-7913 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 68698-68721 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 68750-68773 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP044301 Escherichia coli strain P59A plasmid pP59A-3, complete sequence 72244-72267 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 100739-100762 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 97868-97891 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 97920-97943 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 70468-70491 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 70520-70543 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 28102-28125 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 28154-28177 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 3180-3203 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 3232-3255 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 49730-49753 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP034789 Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence 41596-41619 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 3173-3196 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 3225-3248 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 63617-63640 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MN218814 Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence 24302-24325 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG825383 Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence 178347-178370 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 17935-17958 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 17987-18010 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 25329-25352 1 0.958
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 25381-25404 1 0.958
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 70457-70483 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 20037-20063 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 108489-108515 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 56885-56911 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP053738 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP047092 Salmonella sp. S13 plasmid pS13-3, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 68643-68669 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044301 Escherichia coli strain P59A plasmid pP59A-3, complete sequence 72189-72215 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 18627-18653 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 80151-80177 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP044037 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed3, complete sequence 2899-2925 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 97813-97839 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 31448-31474 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024130 Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence 28047-28073 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 12204-12230 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 3125-3151 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 120883-120909 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 12204-12230 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 12204-12230 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041629 Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP026852 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence 39978-40004 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 3118-3144 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MK036885 Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence 13437-13463 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 25274-25300 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 37486-37512 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 KX023259 Escherichia coli plasmid pSCE516-4, complete sequence 99889-99915 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 7942-7968 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP022443 Klebsiella sp. LY plasmid unnamed2, complete sequence 3537-3563 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP031581 Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence 32687-32713 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 70572-70598 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP032834 Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence 11654-11680 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP035201 Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence 5899-5925 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 16626-16652 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 63669-63695 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH909332 Klebsiella pneumoniae strain A1731 plasmid pA1731-KPC, complete sequence 11803-11829 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 NZ_MH909338 Klebsiella pneumoniae strain A1759 plasmid pA1759-KPC, complete sequence 53365-53391 2 0.926
NZ_CP053739_1 1.1|17275|27|NZ_CP053739|CRISPRCasFinder 17275-17301 27 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 18039-18065 2 0.926
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP022443 Klebsiella sp. LY plasmid unnamed2, complete sequence 25587-25610 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018350 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence 21919-21942 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KY751925 Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence 61872-61895 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_KJ958927 Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence 53944-53967 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021755 Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence 22695-22718 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP010396 Klebsiella pneumoniae strain 34618 plasmid p34618-71.572kb, complete sequence 15271-15294 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 3542-3565 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_023314 Klebsiella pneumoniae plasmid pKPS30, complete sequence 11149-11172 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020500 Klebsiella pneumoniae strain BWHC1 plasmid unnamed2, complete sequence 894-917 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP019017 Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence 64637-64660 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040177 Klebsiella pneumoniae strain 2e plasmid unnamed2, complete sequence 6699-6722 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052376 Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence 53724-53747 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018354 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence 35810-35833 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021547 Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence 6611-6634 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP047338 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence 47224-47247 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP008798 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence 76060-76083 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052547 Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence 51639-51662 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 75168-75191 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020073 Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence 33823-33846 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP020110 Klebsiella pneumoniae strain AR_0098 plasmid tig00000002, complete sequence 52536-52559 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP019074 Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence 31896-31919 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP021858 Klebsiella pneumoniae strain AR_0125 plasmid tig00000005_pilon, complete sequence 2437-2460 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP027150 Klebsiella pneumoniae strain AR_0363 plasmid unnamed3 28358-28381 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 36755-36778 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP011644 Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence 19387-19410 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP027162 Klebsiella pneumoniae strain AR_0361 plasmid unnamed3 19690-19713 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP014299 Klebsiella pneumoniae strain KP38731 plasmid unnamed3, complete sequence 14068-14091 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052366 Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence 16558-16581 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP028781 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence 146297-146320 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT994837 Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence 11001-11024 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT994839 Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence 10844-10867 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT994834 Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence 4477-4500 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_LT994836 Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence 10898-10921 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 71286-71309 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 87140-87163 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 189639-189662 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MK248692 Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence 61356-61379 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 11188-11211 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG557997 Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 23387-23410 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 64133-64156 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MF497780 Citrobacter freundii strain Cfr-31816cz plasmid pCfr-31816cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG557996 Citrobacter freundii strain Cfr-33038cz plasmid pCfr-33038cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG557994 Citrobacter freundii strain Cfr-27569cz plasmid pCfr-27569cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_MG557995 Citrobacter freundii strain Cfr-31260cz plasmid pCfr-31260cz, complete sequence 13837-13860 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 CP052333 Klebsiella pneumoniae strain D17KP0022 plasmid pD17KP0022-1, complete sequence 36528-36551 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_020086 Escherichia coli plasmid pE66An, complete sequence 258-281 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NC_005015 Klebsiella pneumoniae BM4493 plasmid pIP843, complete sequence 194-217 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 31503-31526 2 0.917
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040730 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1 19985-20008 3 0.875
NZ_CP053739_1 1.2|17330|24|NZ_CP053739|CRISPRCasFinder 17330-17353 24 NZ_CP040731 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2 17575-17598 3 0.875

1. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

2. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029493 (Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

3. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

4. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

5. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021943 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000219, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

6. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MG780294 (Escherichia coli plasmid pHN8, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

7. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP017989 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

8. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010174 (Escherichia coli strain H8 plasmid B, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

9. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

10. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010396 (Klebsiella pneumoniae strain 34618 plasmid p34618-71.572kb, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

11. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053739 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

12. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018718 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

13. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018705 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

14. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

15. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020500 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

16. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

17. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to LC155908 (Klebsiella pneumoniae plasmid pKUN4843_1 DNA, complete sequence, strain: KUN4843) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

18. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044309 (Escherichia coli strain C27A plasmid pC27A-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

19. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

20. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025944 (Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

21. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP019017 (Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

22. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040177 (Klebsiella pneumoniae strain 2e plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

23. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

24. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018354 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

25. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

26. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027047 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncR IncN, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

27. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

28. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020073 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

29. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020110 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000002, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

30. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP015991 (Klebsiella pneumoniae strain BR plasmid pWSZBR, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

31. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP042971 (Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

32. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP045065 (Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

33. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

34. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021858 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000005_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

35. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021881 (Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

36. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

37. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP039605 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

38. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021948 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000214, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

39. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014299 (Klebsiella pneumoniae strain KP38731 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

40. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

41. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

42. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

43. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

44. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018699 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

45. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

46. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018711 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

47. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MN268581 (Klebsiella pneumoniae strain KP18-50 plasmid pKP18-50-tet(A), complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

48. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG825383 (Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

49. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG252895 (Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

50. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG836696 (Escherichia coli strain 2248 plasmid pCTXM-2248, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

51. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

52. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MF510424 (Klebsiella pneumoniae strain JAB-1 plasmid pKp-CTX-M, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

53. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

54. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KY296104 (Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

55. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KY751925 (Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

56. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KU665641 (Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

57. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

58. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021755 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

59. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

60. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018724 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

61. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

62. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_021576 (Klebsiella pneumoniae plasmid pKP1780, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

63. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_023314 (Klebsiella pneumoniae plasmid pKPS30, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

64. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044204 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

65. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP023841 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

66. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

67. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

68. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029586 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

69. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

70. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

71. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

72. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

73. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021547 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

74. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

75. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047338 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

76. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

77. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP008798 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

78. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP043753 (Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

79. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

80. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040731 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

81. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP039328 (Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

82. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

83. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP036447 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

84. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP019074 (Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

85. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

86. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018316 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

87. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027150 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

88. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

89. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014758 (Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

90. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011644 (Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

91. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027162 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

92. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034789 (Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

93. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018691 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

94. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035212 (Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

95. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

96. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052366 (Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

97. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

98. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018105 (Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

99. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

100. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044371 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

101. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

102. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

103. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994837 (Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

104. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994839 (Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

105. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994834 (Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

106. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994836 (Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

107. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to KX863570 (Uncultured bacterium plasmid pTRE-1611 clone TRE-1611, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

108. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_LT985322 (Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

109. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

110. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

111. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

112. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

113. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH341574 (Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

114. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

115. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

116. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557997 (Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

117. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

118. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

119. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

120. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH919378 (Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

121. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032227 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

122. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

123. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

124. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

125. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MF497780 (Citrobacter freundii strain Cfr-31816cz plasmid pCfr-31816cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

126. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557996 (Citrobacter freundii strain Cfr-33038cz plasmid pCfr-33038cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

127. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557994 (Citrobacter freundii strain Cfr-27569cz plasmid pCfr-27569cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

128. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557995 (Citrobacter freundii strain Cfr-31260cz plasmid pCfr-31260cz, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

129. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_023330 (Klebsiella pneumoniae strain KPS77 plasmid pKPS77, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

130. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

131. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

132. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052333 (Klebsiella pneumoniae strain D17KP0022 plasmid pD17KP0022-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaaa	Protospacer
***************************

133. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

134. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KY296104 (Enterobacter cloacae strain 13E169 plasmid pHN84KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

135. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034757 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

136. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050835 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

137. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KU665641 (Klebsiella pneumoniae strain AO-15200 plasmid pG06-VIM-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

138. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

139. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

140. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021943 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000219, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

141. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_014368 (Klebsiella pneumoniae plasmid pNL194, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

142. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MG780294 (Escherichia coli plasmid pHN8, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

143. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP017989 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

144. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

145. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052410 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

146. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

147. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024194 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

148. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010174 (Escherichia coli strain H8 plasmid B, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

149. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

150. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

151. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053739 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

152. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

153. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018718 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

154. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018724 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

155. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018705 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

156. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

157. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_021576 (Klebsiella pneumoniae plasmid pKP1780, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

158. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

159. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

160. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044204 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR-0405 plasmid pAR-0405, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

161. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020531 (Enterobacter cloacae strain 174 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

162. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

163. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020856 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

164. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to LC549808 (Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

165. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to LC155908 (Klebsiella pneumoniae plasmid pKUN4843_1 DNA, complete sequence, strain: KUN4843) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

166. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035381 (Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

167. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

168. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044309 (Escherichia coli strain C27A plasmid pC27A-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

169. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018819 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

170. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP023841 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

171. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

172. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

173. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025944 (Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

174. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022443 (Klebsiella sp. LY plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

175. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052417 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

176. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025213 (Klebsiella pneumoniae strain HZW25 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

177. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

178. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029135 (Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

179. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029586 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-96, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

180. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

181. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

182. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014125 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

183. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026753 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

184. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021168 (Enterobacter hormaechei strain 388 plasmid p388, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

185. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

186. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

187. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

188. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

189. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

190. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

191. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027047 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncR IncN, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

192. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021688 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

193. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

194. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP036311 (Enterobacter hormaechei strain WCHEH090011 plasmid pCTXM65_090011, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

195. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021163 (Enterobacter hormaechei strain 234 plasmid p234, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

196. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

197. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

198. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

199. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

200. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP043753 (Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

201. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP009116 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

202. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

203. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040697 (Citrobacter freundii strain R47 plasmid pR47-54, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

204. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

205. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP039328 (Citrobacter portucalensis strain Effluent_1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

206. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

207. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

208. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

209. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP015991 (Klebsiella pneumoniae strain BR plasmid pWSZBR, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

210. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

211. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028931 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

212. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

213. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025517 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_B, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

214. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP042971 (Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

215. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP043758 (Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

216. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP016919 (Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

217. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

218. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

219. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024524 (Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

220. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

221. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP045065 (Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

222. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018451 (Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

223. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

224. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040362 (Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

225. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

226. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021881 (Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

227. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

228. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP039605 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

229. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

230. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018316 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

231. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

232. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

233. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

234. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021712 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

235. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027606 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

236. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

237. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014758 (Klebsiella pneumoniae strain AATZP plasmid pKPN-041, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

238. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021948 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000214, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

239. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035201 (Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

240. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025578 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

241. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

242. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

243. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP006801 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

244. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

245. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018691 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

246. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

247. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

248. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

249. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035212 (Klebsiella pneumoniae strain TH164 plasmid pTH164-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

250. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024573 (Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

251. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to AP022352 (Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

252. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

253. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

254. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024566 (Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

255. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

256. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

257. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018105 (Escherichia coli strain MRSN352231 plasmid pMR0716_PSE, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

258. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

259. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

260. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021952 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

261. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052479 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

262. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026018 (Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

263. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044371 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

264. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032176 (Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

265. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP006662 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

266. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

267. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

268. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052471 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

269. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018989 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

270. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018699 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

271. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to KX863570 (Uncultured bacterium plasmid pTRE-1611 clone TRE-1611, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

272. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT985322 (Escherichia coli strain 727 plasmid RCS55TR727_p, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

273. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

274. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018711 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

275. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MN268581 (Klebsiella pneumoniae strain KP18-50 plasmid pKP18-50-tet(A), complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

276. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041086 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

277. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044120 (Raoultella planticola strain S25 plasmid pS25-68, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

278. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909332 (Klebsiella pneumoniae strain A1731 plasmid pA1731-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

279. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909338 (Klebsiella pneumoniae strain A1759 plasmid pA1759-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

280. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MK036885 (Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

281. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH341574 (Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

282. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020091 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

283. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

284. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

285. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

286. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG252895 (Escherichia coli strain Esco-36073cz plasmid pEsco-36073cz, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

287. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH477637 (Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

288. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG836696 (Escherichia coli strain 2248 plasmid pCTXM-2248, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

289. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH919378 (Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

290. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH919378 (Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

291. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032227 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

292. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

293. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

294. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

295. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018448 (Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

296. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035538 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

297. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MF510424 (Klebsiella pneumoniae strain JAB-1 plasmid pKp-CTX-M, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

298. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_023330 (Klebsiella pneumoniae strain KPS77 plasmid pKPS77, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

299. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

300. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

301. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018737 (Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

302. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033776 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

303. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033776 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacagactacaaa	Protospacer
************************

304. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP043758 (Escherichia coli strain CVM N55972 plasmid pN55972-2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaat	Protospacer
************************** 

305. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactacaat	Protospacer
************************** 

306. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034757 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

307. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

308. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

309. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020531 (Enterobacter cloacae strain 174 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

310. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020856 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

311. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035381 (Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

312. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

313. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052417 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

314. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

315. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029135 (Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

316. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021168 (Enterobacter hormaechei strain 388 plasmid p388, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

317. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021163 (Enterobacter hormaechei strain 234 plasmid p234, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

318. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

319. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

320. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028931 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

321. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP016919 (Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

322. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

323. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040362 (Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

324. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

325. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

326. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

327. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027606 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

328. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025578 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

329. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP006801 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

330. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

331. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to AP022352 (Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

332. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

333. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026018 (Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

334. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP006662 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

335. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018989 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_KPC, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

336. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

337. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

338. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH477637 (Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

339. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018448 (Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

340. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

341. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018737 (Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

342. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050835 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

343. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KJ958927 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

344. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052410 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

345. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024194 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

346. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

347. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

348. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

349. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to LC549808 (Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

350. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018819 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

351. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

352. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

353. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014125 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed3) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

354. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026753 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

355. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021688 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

356. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP036311 (Enterobacter hormaechei strain WCHEH090011 plasmid pCTXM65_090011, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

357. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

358. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

359. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP009116 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

360. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040697 (Citrobacter freundii strain R47 plasmid pR47-54, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

361. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

362. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

363. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP025517 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_B, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

364. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024524 (Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

365. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

366. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018451 (Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

367. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

368. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

369. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021712 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

370. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

371. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024573 (Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

372. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024566 (Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

373. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021952 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

374. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052479 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

375. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032176 (Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

376. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to CP052471 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

377. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041086 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

378. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044120 (Raoultella planticola strain S25 plasmid pS25-68, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

379. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MN218814 (Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

380. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020091 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

381. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035538 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

382. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033776 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

383. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP033776 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.963

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggaagactacaaa	Protospacer
*************** ***********

384. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

385. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

386. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

387. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

388. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

389. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

390. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

391. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

392. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

393. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

394. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

395. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

396. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

397. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

398. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP029493 (Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacaggctacaaa	Protospacer
****************.*******

399. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

400. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

401. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

402. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

403. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

404. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

405. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

406. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

407. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

408. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

409. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

410. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

411. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

412. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

413. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtggcagactacaaa	Protospacer
************.***********

414. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

415. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

416. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

417. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

418. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

419. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

420. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

421. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

422. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacatgacagactacaaa	Protospacer
*********.**************

423. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

424. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

425. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP034789 (Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacaggctacaaa	Protospacer
****************.*******

426. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

427. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

428. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

429. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

430. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

431. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MN218814 (Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
aaaaaaaacgtgacagactacaaa	Protospacer
* **********************

432. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG825383 (Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtgacaggctacaaa	Protospacer
****************.*******

433. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

434. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

435. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

436. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 1, identity: 0.958

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtgacagactacaaa	Protospacer
******* ****************

437. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

438. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

439. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttgtaagactgccaa	Protospacer
**********************.* **

440. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

441. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

442. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

443. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

444. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

445. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

446. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

447. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

448. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

449. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

450. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

451. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

452. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP044037 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

453. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

454. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

455. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

456. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

457. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

458. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

459. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

460. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

461. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

462. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

463. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

464. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

465. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MK036885 (Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

466. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

467. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

468. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

469. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

470. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022443 (Klebsiella sp. LY plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

471. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

472. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

473. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP032834 (Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

474. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP035201 (Klebsiella pneumoniae strain LH375 plasmid pLH375-5, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

475. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

476. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

477. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909332 (Klebsiella pneumoniae strain A1731 plasmid pA1731-KPC, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

478. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909338 (Klebsiella pneumoniae strain A1759 plasmid pA1759-KPC, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggtagactacaaa	Protospacer
***************  **********

479. spacer 1.1|17275|27|NZ_CP053739|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 2, identity: 0.926

tttgccttagtgttgtaagactacaaa	CRISPR spacer
tttgccttagtgttggcagactacaaa	Protospacer
***************  **********

480. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP022443 (Klebsiella sp. LY plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtggcagactactaa	Protospacer
************.******** **

481. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018350 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

482. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KY751925 (Klebsiella pneumoniae strain M16-13 plasmid pM16-13, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

483. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_KJ958927 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pS-3002cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

484. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021755 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_4, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

485. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP010396 (Klebsiella pneumoniae strain 34618 plasmid p34618-71.572kb, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

486. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

487. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_023314 (Klebsiella pneumoniae plasmid pKPS30, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

488. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020500 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

489. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP019017 (Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

490. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040177 (Klebsiella pneumoniae strain 2e plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

491. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

492. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018354 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

493. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021547 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000003, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

494. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP047338 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-50kb, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

495. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP008798 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

496. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

497. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP036447 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

498. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020073 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

499. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP020110 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000002, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

500. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP019074 (Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

501. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP021858 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000005_pilon, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

502. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027150 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed3) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

503. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

504. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP011644 (Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

505. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP027162 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed3) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

506. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP014299 (Klebsiella pneumoniae strain KP38731 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

507. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052366 (Klebsiella pneumoniae strain D16KP0109 plasmid pD16KP0109-1, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

508. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

509. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994837 (Klebsiella pneumoniae isolate CNR132 plasmid CNR132, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

510. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994839 (Klebsiella pneumoniae isolate CNR95 plasmid CNR95, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

511. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994834 (Klebsiella pneumoniae isolate CNR3 plasmid CNR3, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

512. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_LT994836 (Klebsiella pneumoniae isolate CNR339 plasmid CNR339, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

513. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

514. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

515. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

516. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MK248692 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29tetA, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

517. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

518. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557997 (Citrobacter freundii strain Cfr-36808cz plasmid pCfr-36808cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

519. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

520. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

521. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

522. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

523. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MF497780 (Citrobacter freundii strain Cfr-31816cz plasmid pCfr-31816cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

524. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557996 (Citrobacter freundii strain Cfr-33038cz plasmid pCfr-33038cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

525. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557994 (Citrobacter freundii strain Cfr-27569cz plasmid pCfr-27569cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

526. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_MG557995 (Citrobacter freundii strain Cfr-31260cz plasmid pCfr-31260cz, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

527. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to CP052333 (Klebsiella pneumoniae strain D17KP0022 plasmid pD17KP0022-1, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
caaaaaaacgtgacagactacaaa	Protospacer
  **********************

528. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtggcagactactaa	Protospacer
************.******** **

529. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NC_005015 (Klebsiella pneumoniae BM4493 plasmid pIP843, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaacgtggcagactactaa	Protospacer
************.******** **

530. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 2, identity: 0.917

acaaaaaacgtgacagactacaaa	CRISPR spacer
acaaaaaccgtaacagactacaaa	Protospacer
******* ***.************

531. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040730 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed1) position: , mismatch: 3, identity: 0.875

acaaaaaacgtgacagactacaaa	CRISPR spacer
tacaaaaacgtgacagactacaaa	Protospacer
   *********************

532. spacer 1.2|17330|24|NZ_CP053739|CRISPRCasFinder matches to NZ_CP040731 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid unnamed2) position: , mismatch: 3, identity: 0.875

acaaaaaacgtgacagactacaaa	CRISPR spacer
tacaaaaacgtgacagactacaaa	Protospacer
   *********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP053738
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1204 : 61459 58 Salmonella_phage(18.18%) integrase,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP053738.1|WP_000079938.1|7096_7366_+|hypothetical-protein 7096_7366_+ 89 aa aa NA NA NA 1204-61459 yes
5. NZ_CP053740
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053740_1 9928-10047 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP053740_1 1.1|9971|34|NZ_CP053740|CRISPRCasFinder 9971-10004 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

3. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

4. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

5. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

6. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

7. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

8. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

9. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

10. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

11. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

12. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

13. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

14. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

15. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

16. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

17. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

18. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

19. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

20. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

21. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

22. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

23. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

24. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

25. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

26. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

27. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

28. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

29. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

30. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

31. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

32. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

33. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

34. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

35. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

36. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

37. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

38. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

39. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

40. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

41. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

42. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

43. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

44. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

45. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

46. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

47. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

48. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

49. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

50. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

51. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

52. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

53. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

54. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

55. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

56. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

57. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

58. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

59. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

60. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

61. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

62. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

63. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

64. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

65. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

66. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

67. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

68. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

69. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

70. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

71. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

72. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

73. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

74. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

75. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

76. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

77. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

78. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

79. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

80. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

81. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

82. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

83. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

84. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

85. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

86. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

87. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

88. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

89. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

90. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

91. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

92. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

93. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

94. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

95. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

96. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

97. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

98. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

99. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

100. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

101. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

102. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

103. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

104. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

105. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

106. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

107. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

108. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

109. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

110. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

111. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

112. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

113. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

114. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

115. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

116. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

117. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

118. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

119. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

120. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

121. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

122. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

123. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

124. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

125. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

126. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

127. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

128. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

129. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

130. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

131. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

132. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

133. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

134. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

135. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

136. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

137. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

138. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

139. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

140. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

141. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

142. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

143. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

144. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

145. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

146. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

147. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

148. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

149. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

150. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

151. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

152. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

153. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

154. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

155. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

156. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

157. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

158. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

159. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

160. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

161. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

162. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

163. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

164. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

165. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

166. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

167. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

169. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

170. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

171. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

172. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

173. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

174. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

175. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

176. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

177. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

178. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

179. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

180. spacer 1.1|9971|34|NZ_CP053740|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
*****************************. *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage