Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053660 Nocardioides sp. zg-579 chromosome, complete genome 10 crisprs cas3,DEDDh,csa3,cas4,WYL,RT 1 1 0 0

Results visualization

1. NZ_CP053660
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_1 54857-54941 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_2 278466-278577 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_3 848435-848589 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_4 1910475-1910573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_5 1987108-1987194 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_6 2065305-2065390 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_7 3663274-3663350 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_8 4028088-4028179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_9 4062612-4062696 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053660_10 4209012-4209074 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053660_8 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder 4028118-4028149 32 NZ_CP053660.1 3809223-3809254 2 0.938

1. spacer 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder matches to position: 3809223-3809254, mismatch: 2, identity: 0.938

actcccctcggtgagctcaccgtgggaagtga	CRISPR spacer
actcccctcggtgagctcaccctggggagtga	Protospacer
********************* ****.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053660_8 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder 4028118-4028149 32 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 238970-239001 8 0.75
NZ_CP053660_8 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder 4028118-4028149 32 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 110508-110539 8 0.75

1. spacer 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.75

actcccctcggtgagctcaccgtgggaagtga	CRISPR spacer
gtgccccgcggtgagctcagcgtgggagagga	Protospacer
.. **** *********** *******.. **

2. spacer 8.1|4028118|32|NZ_CP053660|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 8, identity: 0.75

actcccctcggtgagctcaccgtgggaagtga	CRISPR spacer
gtgccccgcggtgagctcagcgtgggagagga	Protospacer
.. **** *********** *******.. **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage