Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033334 Mesorhizobium loti strain NZP2042 chromosome, complete genome 4 crisprs csa3,DEDDh,WYL,PD-DExK,cas3 0 1 5 0

Results visualization

1. NZ_CP033334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033334_1 382019-382110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033334_2 4957620-4957707 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033334_3 5140356-5140426 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033334_4 5341830-5342044 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NZ_CP011521 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-4, complete sequence 33915-33948 5 0.853
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 MN585989 Mycobacterium phage Superchunk, complete genome 23548-23581 6 0.824
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1245275-1245308 8 0.765
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 72352-72385 8 0.765
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 284629-284662 9 0.735
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 267839-267872 10 0.706
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 129069-129102 10 0.706
NZ_CP033334_1 1.1|382048|34|NZ_CP033334|CRISPRCasFinder 382048-382081 34 KX641264 Mycobacterium phage LindNT, complete genome 56900-56933 11 0.676

1. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NZ_CP011521 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-4, complete sequence) position: , mismatch: 5, identity: 0.853

ggcgatg-cgccgccggccaagccggcgacaccgg	CRISPR spacer
-gcggtgccgctgccggccaagccggcgacacccc	Protospacer
 ***.** ***.*********************  

2. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 6, identity: 0.824

ggcgat-gcgccgccggccaagccggcgacaccgg	CRISPR spacer
-gcgccagcgccgccggccaagccggtgaaaccga	Protospacer
 *** . *******************.** ****.

3. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.765

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
gccgatgcgccgccggccaagctggcgttctacg	Protospacer
* ********************.**** . .  *

4. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.765

ggcga-tgcgccgccggccaagccggcgacaccgg	CRISPR spacer
-tcgaccgcgccgccggcatagccggcgacaaggc	Protospacer
  *** .***********  ***********  * 

5. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
cacgatgcgcggacggccaagccggctgccgcgc	Protospacer
 .******** * ************* .*  ** 

6. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ccggatgcgccgcccgccgagccggcgctgcgtg	Protospacer
   *********** ***.******** ..*  *

7. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ccgcctacaccgccgcccgagccggcgacaccgc	Protospacer
     *.*.****** **.************** 

8. spacer 1.1|382048|34|NZ_CP033334|CRISPRCasFinder matches to KX641264 (Mycobacterium phage LindNT, complete genome) position: , mismatch: 11, identity: 0.676

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ctacctgcgccgacggccaggccggcgacctttg	Protospacer
     ******* ******.********* .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2919580 : 2958344 32 Catovirus(12.5%) integrase,tRNA,transposase attL 2955085:2955112|attR 2958443:2958470
DBSCAN-SWA_2 4176638 : 4184824 9 uncultured_Mediterranean_phage(85.71%) tRNA NA
DBSCAN-SWA_3 4957777 : 5009370 64 Sinorhizobium_phage(26.92%) head,portal,tRNA,tail,terminase,protease,capsid NA
DBSCAN-SWA_4 6382734 : 6445805 48 uncultured_virus(18.18%) integrase,transposase,protease attL 6398234:6398252|attR 6433779:6433797
DBSCAN-SWA_5 6476003 : 6600222 94 Stx2-converting_phage(30.77%) holin,tRNA,transposase,integrase attL 6475329:6475388|attR 6560249:6560336
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage