Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP038405 Escherichia coli O157:H7 strain ATCC 35150 chromosome, complete genome 8 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,c2c9_V-U4,DEDDh,DinG,PrimPol 0 10 13 0
NZ_CP038406 Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP038407 Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP038405
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_1 1095125-1095213 Unclear I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_2 1120905-1121117 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_3 1646270-1646375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_4 2173140-2173289 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_5 2373063-2373186 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_6 4647439-4647573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_7 4672340-4672476 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038405_8 4877519-4877668 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP038405_7 7.1|4672361|42|NZ_CP038405|PILER-CR 4672361-4672402 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141125 0 1.0
NZ_CP038405_2 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT 1120935-1120965 31 MK047640 Phage NV18, complete genome 15646-15676 1 0.968
NZ_CP038405_2 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder 1120935-1120966 32 MK047640 Phage NV18, complete genome 15645-15676 1 0.969
NZ_CP038405_2 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT 1120935-1120965 31 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2748 2 0.935
NZ_CP038405_2 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder 1120935-1120966 32 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2749 2 0.938
NZ_CP038405_5 5.1|2373106|38|NZ_CP038405|CRISPRCasFinder 2373106-2373143 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 2 0.943
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 3 0.914
NZ_CP038405_7 7.2|4672424|36|NZ_CP038405|PILER-CR 4672424-4672459 36 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141031-141066 3 0.917
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14239-14273 5 0.857
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 5 0.857
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 6 0.829
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 6 0.829
NZ_CP038405_2 2.3|1121057|31|NZ_CP038405|CRT 1121057-1121087 31 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90230 7 0.774
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 138033-138067 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27246-27280 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 7 0.8
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 7 0.8
NZ_CP038405_2 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT 1120935-1120965 31 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102901-102931 8 0.742
NZ_CP038405_2 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT 1120935-1120965 31 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313484-313514 8 0.742
NZ_CP038405_2 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT 1120935-1120965 31 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984473-984503 8 0.742
NZ_CP038405_2 2.6|1121057|32|NZ_CP038405|CRISPRCasFinder 1121057-1121088 32 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90231 8 0.75
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 262-315 8 0.852
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12103-12156 8 0.852
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41406-41459 8 0.852
NZ_CP038405_4 4.1|2173193|44|NZ_CP038405|CRISPRCasFinder 2173193-2173236 44 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 210148-210191 8 0.818
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 203852-203886 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204038-204072 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204131-204165 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214346-214380 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214532-214566 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214625-214659 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205180-205214 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205366-205400 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205459-205493 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186135-186169 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186321-186355 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186414-186448 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 8 0.771
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 8 0.771
NZ_CP038405_2 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder 1120935-1120966 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102900-102931 9 0.719
NZ_CP038405_2 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder 1120935-1120966 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313483-313514 9 0.719
NZ_CP038405_2 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder 1120935-1120966 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984472-984503 9 0.719
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386558-386592 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 9 0.743
NZ_CP038405_6 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder 4647489-4647523 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 9 0.743
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229441-229494 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239935-239988 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7383-7436 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84207-84260 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87127-87180 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230847-230900 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211817-211870 10 0.815
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4105-4158 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3363-3416 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4104-4157 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3362-3415 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4104-4157 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3362-3415 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4104-4157 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3362-3415 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31242-31295 11 0.796
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 34-87 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4004-4057 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229239-229292 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229340-229393 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 33-86 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4003-4056 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239733-239786 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239834-239887 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 33-86 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4003-4056 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230645-230698 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230746-230799 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 33-86 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4003-4056 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211615-211668 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211716-211769 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15008-15061 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18340-18393 12 0.778
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30167-30220 13 0.759
NZ_CP038405_3 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder 1646296-1646349 54 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 160-213 14 0.741

1. spacer 7.1|4672361|42|NZ_CP038405|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacgcagataaatccaactttcaatattgttaagttcc	CRISPR spacer
gtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
******************************************

2. spacer 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.968

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaa	Protospacer
********************* *********

3. spacer 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.969

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaaa	Protospacer
********************* **********

4. spacer 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.935

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaa	Protospacer
******** ************ *********

5. spacer 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.938

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaaa	Protospacer
******** ************ **********

6. spacer 5.1|2373106|38|NZ_CP038405|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

7. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.943

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
**********************.*********** 

8. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgtaacgcctgatgcgacgctgacgcgtcttatct	Protospacer
* .*.******************************

9. spacer 7.2|4672424|36|NZ_CP038405|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.917

acggcgtagcaaaaagaaattttcaatattgtttta	CRISPR spacer
atggcgtagaaaaaagaaattttcaatattgcttta	Protospacer
*.******* *********************.****

10. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accagcgcctgatgcgccgctgtcgcgtcttatca	Protospacer
 .************** ***** *********** 

11. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ctcaacgcctgatgcgacgctggcgcgtcttagcg	Protospacer
.***.*****************.********* * 

12. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gtttatgccagatgcgacgctgacgcgtcttatct	Protospacer
 *. ..*** *************************

13. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

14. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

15. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

16. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

17. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*.....**************************** 

18. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
attgaagcctgatgcgacgctgacgcgtcttatca	Protospacer
 *... **************************** 

19. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .*...**************************** 

20. spacer 2.3|1121057|31|NZ_CP038405|CRT matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 7, identity: 0.774

gcccaggg---atttgttcaatccagcgtgccgc	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgc	Protospacer
   **..*   **********.*** ********

21. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatca	Protospacer
. *...**************** *********** 

22. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgcgctgcctgatgcgacgctaatgcgtcttatca	Protospacer
* *. .***************.*.********** 

23. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

24. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

25. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

26. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

27. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

28. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

29. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

30. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

31. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

32. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

33. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

34. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

35. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accggtgccagatgcgacgcagacgcgtcttatca	Protospacer
 .*.*.*** ********** ************* 

36. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

37. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.****************.*********** 

38. spacer 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

39. spacer 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

40. spacer 2.1|1120935|31|NZ_CP038405|PILER-CR,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactg	Protospacer
**********.*** ******** *.. * .

41. spacer 2.6|1121057|32|NZ_CP038405|CRISPRCasFinder matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 8, identity: 0.75

gcccaggg---atttgttcaatccagcgtgccgct	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgca	Protospacer
   **..*   **********.*** ******** 

42. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggcaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa	Protospacer
**. * *** .* .***************** **********************

43. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccg-catcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gctccgacgttcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgag	Protospacer
 .* *** *.*.* **************************************.*.

44. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-aggcaccgtgctgatgtctgatgcgacgctggcgcgtcttatcagacctacaaa	Protospacer
 * **  *.* *** **.****************************.********

45. spacer 4.1|2173193|44|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.818

ttggcagtgtgcctgatgcgacgctgttcgcgtcttaccaggcc	CRISPR spacer
tgcacaagatgcctgatgcgacgctgtccgcgtcttatcaggcc	Protospacer
*  .**. .******************.*********.******

46. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgccagatgcgacgctggcgcgtcttatct	Protospacer
 . ...*** ************.************

47. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

48. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

49. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

50. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

51. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

52. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

53. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

54. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

55. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

56. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

57. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

58. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

59. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

60. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

61. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

62. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

63. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

64. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

65. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

66. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

67. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

68. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

69. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

70. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

71. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

72. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

73. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

74. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

75. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

76. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

77. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

78. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

79. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgaattacctgatgcgacgctggcgcatcttatca	Protospacer
*  * ..***************.***.******* 

80. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

81. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

82. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

83. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

84. spacer 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgt	Protospacer
************** ****.*** *.. * . 

85. spacer 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgc	Protospacer
************** ****.*** *.. * . 

86. spacer 2.4|1120935|32|NZ_CP038405|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactgc	Protospacer
**********.*** ******** *.. * . 

87. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgatgctaacgcgtcttatca	Protospacer
 .....***********.***.************ 

88. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

89. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

90. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

91. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

92. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
acggatgcccgatgcgacgctggcgcgtcttatcg	Protospacer
 . ...***.************.*********** 

93. spacer 6.1|4647489|35|NZ_CP038405|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgtctgatgcgacgctggcgcgtcttatca	Protospacer
 .....*.**************.*********** 

94. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

95. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

96. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

97. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

98. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cattcggtgcacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaa	Protospacer
**. * *... * .***************** **********************

99. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

100. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

101. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

102. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

103. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

104. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

105. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

106. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

107. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

108. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

109. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.796

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggtaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacagc	Protospacer
**. * *.* .* .***************** ********************. 

110. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

111. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

112. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

113. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

114. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

115. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

116. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

117. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

118. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

119. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

120. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

121. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

122. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

123. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

124. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

125. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

126. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
caacaattaccaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
**     .*.*  ******************************* ******.*.

127. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

128. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 13, identity: 0.759

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgctctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaat	Protospacer
**. .    **. .*****************.************ ******** 

129. spacer 3.1|1646296|54|NZ_CP038405|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 14, identity: 0.741

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
tctccggcaattgaagcctgatgcgacgctgacgcgtcttatcaggcctacnag	Protospacer
. . * *** .. . ****************.******************* *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1220927 : 1244422 27 Enterobacteria_phage(33.33%) holin,tail,transposase,integrase attL 1212573:1212587|attR 1245293:1245307
DBSCAN-SWA_2 1522007 : 1527433 6 Enterobacteria_phage(50.0%) integrase attL 1510995:1511011|attR 1529629:1529645
DBSCAN-SWA_3 1773053 : 1876929 119 Enterobacteria_phage(64.29%) terminase,tail,transposase,protease,tRNA,portal,holin NA
DBSCAN-SWA_4 1974942 : 2048647 71 Escherichia_phage(34.69%) integrase,terminase,head,tail,transposase,portal,capsid,holin attL 1974449:1974464|attR 2032835:2032850
DBSCAN-SWA_5 2106227 : 2126210 28 Enterobacteria_phage(75.0%) integrase,transposase,tail attL 2119346:2119359|attR 2129352:2129365
DBSCAN-SWA_6 2446756 : 2561010 140 Enterobacteria_phage(28.18%) terminase,head,tail,protease,transposase,portal,capsid,holin NA
DBSCAN-SWA_7 2742977 : 2800695 69 Escherichia_phage(42.19%) terminase,head,tail,tRNA,capsid,holin NA
DBSCAN-SWA_8 2885641 : 2961097 84 Stx2-converting_phage(37.5%) integrase,terminase,head,protease,transposase,holin,portal,capsid,tail attL 2901143:2901170|attR 2961234:2961261
DBSCAN-SWA_9 3007793 : 3179997 197 Enterobacteria_phage(32.5%) integrase,terminase,head,portal,protease,transposase,lysis,holin,tRNA,capsid,tail attL 3040503:3040518|attR 3186654:3186674
DBSCAN-SWA_10 3407472 : 3559015 176 Escherichia_phage(37.88%) integrase,terminase,head,protease,transposase,bacteriocin,holin,portal,capsid,tail attL 3505562:3505577|attR 3560780:3560795
DBSCAN-SWA_11 3789966 : 3828063 50 Enterobacteria_phage(51.16%) integrase,terminase,protease,lysis,holin,portal,tail attL 3789551:3789565|attR 3828137:3828151
DBSCAN-SWA_12 4371276 : 4422882 56 Enterobacteria_phage(34.78%) tail,transposase,integrase attL 4364433:4364449|attR 4420328:4420344
DBSCAN-SWA_13 4441668 : 4464397 18 uncultured_Caudovirales_phage(66.67%) plate,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP038406
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 49396 : 58188 6 Macacine_betaherpesvirus(66.67%) integrase,transposase attL 45966:45979|attR 52554:52567
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage