Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP038362 Escherichia coli O157:H7 strain F7386 plasmid pF7386-1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP038360 Escherichia coli O157:H7 strain F7386 chromosome, complete genome 9 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,c2c9_V-U4,DEDDh,DinG,PrimPol 2 12 15 1
NZ_CP038361 Escherichia coli O157:H7 strain F7386 plasmid pF7386-2 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP038362
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 40807 35 Macacine_betaherpesvirus(45.45%) transposase,integrase attL 16525:16539|attR 40532:40546
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP038360
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_1 1093858-1093946 Unclear I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_2 1119638-1119850 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_3 1707975-1708080 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_4 2243544-2243693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_5 2443465-2443588 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_6 3095217-3095330 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_7 4581955-4582089 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_8 4606841-4606977 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038360_9 4810498-4810647 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP038360_6 6.2|3095287|25|NZ_CP038360|PILER-CR 3095287-3095311 25 NZ_CP038360.1 1848594-1848618 0 1.0
NZ_CP038360_6 6.1|3095240|24|NZ_CP038360|PILER-CR 3095240-3095263 24 NZ_CP038360.1 1848642-1848665 1 0.958

1. spacer 6.2|3095287|25|NZ_CP038360|PILER-CR matches to position: 1848594-1848618, mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

2. spacer 6.1|3095240|24|NZ_CP038360|PILER-CR matches to position: 1848642-1848665, mismatch: 1, identity: 0.958

cgcctttacctgatttgggtaaac	CRISPR spacer
cgtctttacctgatttgggtaaac	Protospacer
**.*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP038360_6 6.1|3095240|24|NZ_CP038360|PILER-CR 3095240-3095263 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
NZ_CP038360_6 6.1|3095240|24|NZ_CP038360|PILER-CR 3095240-3095263 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
NZ_CP038360_6 6.2|3095287|25|NZ_CP038360|PILER-CR 3095287-3095311 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP038360_6 6.2|3095287|25|NZ_CP038360|PILER-CR 3095287-3095311 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP038360_8 8.1|4606862|42|NZ_CP038360|PILER-CR 4606862-4606903 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141125 0 1.0
NZ_CP038360_2 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT 1119668-1119698 31 MK047640 Phage NV18, complete genome 15646-15676 1 0.968
NZ_CP038360_2 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder 1119668-1119699 32 MK047640 Phage NV18, complete genome 15645-15676 1 0.969
NZ_CP038360_6 6.1|3095240|24|NZ_CP038360|PILER-CR 3095240-3095263 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
NZ_CP038360_6 6.2|3095287|25|NZ_CP038360|PILER-CR 3095287-3095311 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP038360_2 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT 1119668-1119698 31 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2748 2 0.935
NZ_CP038360_2 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder 1119668-1119699 32 MF417881 Uncultured Caudovirales phage clone 7AX_3, partial genome 2718-2749 2 0.938
NZ_CP038360_5 5.1|2443508|38|NZ_CP038360|CRISPRCasFinder 2443508-2443545 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101196-101230 2 0.943
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165464-165498 3 0.914
NZ_CP038360_8 8.2|4606925|36|NZ_CP038360|PILER-CR 4606925-4606960 36 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141031-141066 3 0.917
NZ_CP038360_6 6.2|3095287|25|NZ_CP038360|PILER-CR 3095287-3095311 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14239-14273 5 0.857
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56080-56114 5 0.857
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6804-6838 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208981-209015 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219475-219509 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210309-210343 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191264-191298 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30177-30211 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 170-204 6 0.829
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 88-122 6 0.829
NZ_CP038360_2 2.3|1119790|31|NZ_CP038360|CRT 1119790-1119820 31 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90230 7 0.774
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87137-87171 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 138033-138067 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-77 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3372-3406 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208887-208921 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-76 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3371-3405 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219381-219415 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-76 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3371-3405 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210215-210249 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-76 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3371-3405 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191170-191204 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27246-27280 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18350-18384 7 0.8
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15018-15052 7 0.8
NZ_CP038360_2 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT 1119668-1119698 31 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102901-102931 8 0.742
NZ_CP038360_2 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT 1119668-1119698 31 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313484-313514 8 0.742
NZ_CP038360_2 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT 1119668-1119698 31 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984473-984503 8 0.742
NZ_CP038360_2 2.6|1119790|32|NZ_CP038360|CRISPRCasFinder 1119790-1119821 32 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90231 8 0.75
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 262-315 8 0.852
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12103-12156 8 0.852
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41406-41459 8 0.852
NZ_CP038360_4 4.1|2243597|44|NZ_CP038360|CRISPRCasFinder 2243597-2243640 44 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 210148-210191 8 0.818
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61916-61950 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4148 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229148-229182 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229249-229283 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229350-229384 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229451-229485 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 203852-203886 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204038-204072 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 204131-204165 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4147 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239642-239676 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239743-239777 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239844-239878 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239945-239979 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214346-214380 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214532-214566 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 214625-214659 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4147 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230554-230588 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230655-230689 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230756-230790 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230857-230891 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205180-205214 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205366-205400 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 205459-205493 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4147 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211524-211558 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211625-211659 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211726-211760 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211827-211861 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186135-186169 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186321-186355 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 186414-186448 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 14272-14306 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6744-6778 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7426 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83590-83624 8 0.771
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84250 8 0.771
NZ_CP038360_2 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder 1119668-1119699 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 102900-102931 9 0.719
NZ_CP038360_2 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder 1119668-1119699 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 313483-313514 9 0.719
NZ_CP038360_2 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder 1119668-1119699 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 984472-984503 9 0.719
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386558-386592 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4013-4047 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4012-4046 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4012-4046 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4012-4046 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 13988-14022 9 0.743
NZ_CP038360_7 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder 4582005-4582039 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41415-41449 9 0.743
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229441-229494 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239935-239988 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7383-7436 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84207-84260 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87127-87180 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230847-230900 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211817-211870 10 0.815
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4105-4158 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3363-3416 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4104-4157 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3362-3415 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4104-4157 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3362-3415 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4104-4157 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3362-3415 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31242-31295 11 0.796
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 34-87 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4004-4057 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229239-229292 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229340-229393 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 33-86 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4003-4056 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239733-239786 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239834-239887 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 33-86 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4003-4056 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230645-230698 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230746-230799 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 33-86 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4003-4056 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211615-211668 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211716-211769 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15008-15061 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18340-18393 12 0.778
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30167-30220 13 0.759
NZ_CP038360_3 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder 1708001-1708054 54 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 160-213 14 0.741

1. spacer 6.1|3095240|24|NZ_CP038360|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

2. spacer 6.1|3095240|24|NZ_CP038360|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 6.2|3095287|25|NZ_CP038360|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 6.2|3095287|25|NZ_CP038360|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 8.1|4606862|42|NZ_CP038360|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacgcagataaatccaactttcaatattgttaagttcc	CRISPR spacer
gtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
******************************************

6. spacer 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.968

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaa	Protospacer
********************* *********

7. spacer 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 1, identity: 0.969

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgacaaaaagtgtcaccaaa	Protospacer
********************* **********

8. spacer 6.1|3095240|24|NZ_CP038360|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

9. spacer 6.2|3095287|25|NZ_CP038360|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

10. spacer 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.935

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaa	Protospacer
******** ************ *********

11. spacer 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder matches to MF417881 (Uncultured Caudovirales phage clone 7AX_3, partial genome) position: , mismatch: 2, identity: 0.938

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaatcagtgacaaaaagtgtcaccaaa	Protospacer
******** ************ **********

12. spacer 5.1|2443508|38|NZ_CP038360|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

13. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.943

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ttcagcgcctgatgcgacgctggcgcgtcttatca	Protospacer
**********************.*********** 

14. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.914

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgtaacgcctgatgcgacgctgacgcgtcttatct	Protospacer
* .*.******************************

15. spacer 8.2|4606925|36|NZ_CP038360|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.917

acggcgtagcaaaaagaaattttcaatattgtttta	CRISPR spacer
atggcgtagaaaaaagaaattttcaatattgcttta	Protospacer
*.******* *********************.****

16. spacer 6.2|3095287|25|NZ_CP038360|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

17. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accagcgcctgatgcgccgctgtcgcgtcttatca	Protospacer
 .************** ***** *********** 

18. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ctcaacgcctgatgcgacgctggcgcgtcttagcg	Protospacer
.***.*****************.********* * 

19. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gtttatgccagatgcgacgctgacgcgtcttatct	Protospacer
 *. ..*** *************************

20. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

21. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

22. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

23. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tcagatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*. ...**************************** 

24. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
*.....**************************** 

25. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
attgaagcctgatgcgacgctgacgcgtcttatca	Protospacer
 *... **************************** 

26. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 6, identity: 0.829

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .*...**************************** 

27. spacer 2.3|1119790|31|NZ_CP038360|CRT matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 7, identity: 0.774

gcccaggg---atttgttcaatccagcgtgccgc	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgc	Protospacer
   **..*   **********.*** ********

28. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatca	Protospacer
. *...**************** *********** 

29. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgcgctgcctgatgcgacgctaatgcgtcttatca	Protospacer
* *. .***************.*.********** 

30. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

31. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

32. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

33. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

34. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

35. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

36. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

37. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

38. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

39. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

40. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . .*.****************.*********** 

41. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgacgctgacgcgttttatca	Protospacer
 .*...**********************.***** 

42. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accggtgccagatgcgacgcagacgcgtcttatca	Protospacer
 .*.*.*** ********** ************* 

43. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatca	Protospacer
 .....**************************** 

44. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.8

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccaggtgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. .*.****************.*********** 

45. spacer 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

46. spacer 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactg	Protospacer
************** ****.*** *.. * .

47. spacer 2.1|1119668|31|NZ_CP038360|PILER-CR,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

tcaccaaaacagtgacaaaaactgtcaccaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactg	Protospacer
**********.*** ******** *.. * .

48. spacer 2.6|1119790|32|NZ_CP038360|CRISPRCasFinder matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 8, identity: 0.75

gcccaggg---atttgttcaatccagcgtgccgct	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgca	Protospacer
   **..*   **********.*** ******** 

49. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggcaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa	Protospacer
**. * *** .* .***************** **********************

50. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccg-catcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gctccgacgttcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgag	Protospacer
 .* *** *.*.* **************************************.*.

51. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-aggcaccgtgctgatgtctgatgcgacgctggcgcgtcttatcagacctacaaa	Protospacer
 * **  *.* *** **.****************************.********

52. spacer 4.1|2243597|44|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.818

ttggcagtgtgcctgatgcgacgctgttcgcgtcttaccaggcc	CRISPR spacer
tgcacaagatgcctgatgcgacgctgtccgcgtcttatcaggcc	Protospacer
*  .**. .******************.*********.******

53. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgccagatgcgacgctggcgcgtcttatct	Protospacer
 . ...*** ************.************

54. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

55. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

56. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

57. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

58. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

59. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

60. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

61. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

62. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

63. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

64. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

65. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

66. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

67. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

68. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

69. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

70. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

71. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

72. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

73. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

74. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

75. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

76. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

77. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

78. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatca	Protospacer
 . ...****************.*********** 

79. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

80. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

81. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

82. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatca	Protospacer
 . ...***************.************ 

83. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gccgatgcctgatgcgtcgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

84. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

85. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
accgatgcctgatgcgccgctgacgcgacttatca	Protospacer
 .*...********** ********** ****** 

86. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
tgaattacctgatgcgacgctggcgcatcttatca	Protospacer
*  * ..***************.***.******* 

87. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

88. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

89. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatacgacgctgacgcgtcttatca	Protospacer
 . ...*******.******************** 

90. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.771

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatca	Protospacer
.. ...****************.*********** 

91. spacer 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgt	Protospacer
************** ****.*** *.. * . 

92. spacer 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacagtgccaaagactcttgactgc	Protospacer
************** ****.*** *.. * . 

93. spacer 2.4|1119668|32|NZ_CP038360|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccaaaacagtgacaaaaactgtcaccaaa	CRISPR spacer
tcaccaaaacggtgccaaaaactcttgactgc	Protospacer
**********.*** ******** *.. * . 

94. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgcctgatgcgatgctaacgcgtcttatca	Protospacer
 .....***********.***.************ 

95. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

96. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

97. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

98. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gcagatgcctgatgcgacgctagcgcgtcttatca	Protospacer
 . ...***************..*********** 

99. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
acggatgcccgatgcgacgctggcgcgtcttatcg	Protospacer
 . ...***.************.*********** 

100. spacer 7.1|4582005|35|NZ_CP038360|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttcagcgcctgatgcgacgctgacgcgtcttatct	CRISPR spacer
gctgatgtctgatgcgacgctggcgcgtcttatca	Protospacer
 .....*.**************.*********** 

101. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

102. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

103. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

104. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

105. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cattcggtgcacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaa	Protospacer
**. * *... * .***************** **********************

106. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

107. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

108. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

109. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

110. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

111. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

112. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

113. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

114. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

115. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

116. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.796

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggtaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacagc	Protospacer
**. * *.* .* .***************** ********************. 

117. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

118. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

119. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

120. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

121. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

122. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

123. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

124. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

125. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

126. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

127. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

128. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

129. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

130. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

131. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

132. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

133. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
caacaattaccaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
**     .*.*  ******************************* ******.*.

134. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

135. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 13, identity: 0.759

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgctctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaat	Protospacer
**. .    **. .*****************.************ ******** 

136. spacer 3.1|1708001|54|NZ_CP038360|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 14, identity: 0.741

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
tctccggcaattgaagcctgatgcgacgctgacgcgtcttatcaggcctacnag	Protospacer
. . * *** .. . ****************.******************* *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1219816 : 1243381 27 Enterobacteria_phage(33.33%) holin,tail,integrase,transposase attL 1211462:1211476|attR 1244252:1244266
DBSCAN-SWA_2 1520958 : 1579044 92 Escherichia_phage(46.74%) holin,capsid,integrase,protease,lysis,portal,tail,transposase,terminase attL 1525353:1525377|attR 1587611:1587635
DBSCAN-SWA_3 1834757 : 1943518 121 Enterobacteria_phage(48.19%) holin,integrase,tRNA,protease,portal,tail,transposase,terminase attL 1920714:1920728|attR 1945581:1945595
DBSCAN-SWA_4 1947614 : 1973836 35 Escherichia_phage(73.53%) holin,capsid,lysis,tRNA,plate,head,portal,tail,terminase NA
DBSCAN-SWA_5 2072922 : 2140155 68 Escherichia_phage(35.56%) holin,capsid,integrase,head,portal,tail,transposase,terminase attL 2068563:2068578|attR 2124342:2124357
DBSCAN-SWA_6 2517158 : 2626326 130 Stx2-converting_phage(40.59%) holin,capsid,protease,head,portal,tail,transposase,terminase NA
DBSCAN-SWA_7 2897934 : 2971571 84 Enterobacteria_phage(32.73%) holin,capsid,integrase,lysis,protease,head,portal,tail,transposase,terminase attL 2913436:2913463|attR 2971708:2971735
DBSCAN-SWA_8 3018267 : 3108933 99 Enterobacteria_phage(48.15%) holin,capsid,integrase,tRNA,lysis,protease,head,portal,tail,transposase,terminase attL 3035803:3035818|attR 3102836:3102851
DBSCAN-SWA_9 3115024 : 3169693 67 Stx2-converting_phage(28.85%) holin,capsid,integrase,head,portal,tail,terminase attL 3136670:3136685|attR 3176436:3176451
DBSCAN-SWA_10 3299140 : 3366070 59 Stx2-converting_phage(35.71%) transposase,integrase,protease attL 3325623:3325638|attR 3344836:3344851
DBSCAN-SWA_11 3432729 : 3488343 61 Escherichia_phage(26.19%) holin,capsid,protease,head,portal,tail,transposase NA
DBSCAN-SWA_12 3719270 : 3757371 50 Enterobacteria_phage(48.84%) holin,integrase,protease,lysis,portal,tail,terminase attL 3718855:3718869|attR 3757445:3757459
DBSCAN-SWA_13 4337060 : 4378310 44 Escherichia_phage(35.0%) tail,transposase NA
DBSCAN-SWA_14 4835664 : 4894675 60 Klosneuvirus(12.5%) transposase,protease NA
DBSCAN-SWA_15 5031554 : 5046219 19 Enterobacteria_phage(43.75%) tRNA,integrase,tail attL 5027395:5027410|attR 5044924:5044939
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP038360.1|WP_000556581.1|1838882_1839017_-|hypothetical-protein 1838882_1839017_- 44 aa aa NA NA NA 1834757-1943518 yes