Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053435 Spirosoma sp. TS118 chromosome, complete genome 2 crisprs csa3,cas3,DEDDh,WYL,Cas9_archaeal 2 0 4 0
NZ_CP053436 Spirosoma sp. TS118 plasmid pTS, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP053435
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053435_1 726242-726335 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053435_2 726497-726766 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053435_2 2.3|726659|21|NZ_CP053435|CRISPRCasFinder 726659-726679 21 NZ_CP053435.1 726158-726178 0 1.0
NZ_CP053435_2 2.4|726704|39|NZ_CP053435|CRISPRCasFinder 726704-726742 39 NZ_CP053435.1 726203-726241 0 1.0

1. spacer 2.3|726659|21|NZ_CP053435|CRISPRCasFinder matches to position: 726158-726178, mismatch: 0, identity: 1.0

acgtggtcgtgattccgaact	CRISPR spacer
acgtggtcgtgattccgaact	Protospacer
*********************

2. spacer 2.4|726704|39|NZ_CP053435|CRISPRCasFinder matches to position: 726203-726241, mismatch: 0, identity: 1.0

gcgcgggcggtcactgcggtcattgtcacgtgcccctcc	CRISPR spacer
gcgcgggcggtcactgcggtcattgtcacgtgcccctcc	Protospacer
***************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 452194 : 459753 10 Sulfolobus_monocaudavirus(16.67%) NA NA
DBSCAN-SWA_2 1570599 : 1604603 33 Paenibacillus_phage(14.29%) transposase,tail NA
DBSCAN-SWA_3 3834537 : 3890281 48 Shigella_phage(33.33%) transposase,protease,tRNA NA
DBSCAN-SWA_4 4940194 : 5008428 51 Paenibacillus_phage(33.33%) transposase,protease,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage