Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053307 Spiroplasma citri strain C5 plasmid pScpC5-3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP053305 Spiroplasma citri strain C5 plasmid pScpC5-1, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP053306 Spiroplasma citri strain C5 plasmid pScpC5-2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053304 Spiroplasma citri strain C5 chromosome, complete genome 0 crisprs cas4 0 0 12 0
NZ_CP053309 Spiroplasma citri strain C5 plasmid pScpC5-5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053311 Spiroplasma citri strain C5 plasmid pScpC5-7, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP053310 Spiroplasma citri strain C5 plasmid pScpC5-6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053308 Spiroplasma citri strain C5 plasmid pScpC5-4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP053304
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 107292 : 113342 9 Spiroplasma_virus(85.71%) transposase NA
DBSCAN-SWA_2 484911 : 493081 10 Staphylococcus_phage(28.57%) transposase NA
DBSCAN-SWA_3 744943 : 752764 11 Spiroplasma_virus(88.89%) transposase NA
DBSCAN-SWA_4 894252 : 901993 11 Spiroplasma_virus(88.89%) NA NA
DBSCAN-SWA_5 943823 : 957773 25 Spiroplasma_virus(66.67%) NA NA
DBSCAN-SWA_6 1078446 : 1086248 11 Lactobacillus_phage(28.57%) NA NA
DBSCAN-SWA_7 1103743 : 1115663 15 Spiroplasma_virus(91.67%) transposase NA
DBSCAN-SWA_8 1178417 : 1187777 12 Spiroplasma_virus(88.89%) NA NA
DBSCAN-SWA_9 1192193 : 1225789 55 Spiroplasma_phage(100.0%) protease,head NA
DBSCAN-SWA_10 1230628 : 1236208 10 Spiroplasma_phage(100.0%) NA NA
DBSCAN-SWA_11 1370455 : 1423868 47 Spiroplasma_virus(42.86%) transposase,terminase,portal,head,tRNA,capsid,tail NA
DBSCAN-SWA_12 1489157 : 1498335 9 Spiroplasma_virus(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053307
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1211 : 8656 12 Spiroplasma_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP053305
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053305_1 2657-2771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053305_1 1.1|2691|47|NZ_CP053305|CRISPRCasFinder 2691-2737 47 NC_007386 Spiroplasma citri plasmid pSciA strain GII3 3570-3616 0 1.0
NZ_CP053305_1 1.1|2691|47|NZ_CP053305|CRISPRCasFinder 2691-2737 47 NZ_CP047436 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-8 1737-1783 0 1.0
NZ_CP053305_1 1.1|2691|47|NZ_CP053305|CRISPRCasFinder 2691-2737 47 NZ_CP053305 Spiroplasma citri strain C5 plasmid pScpC5-1, complete sequence 2691-2737 0 1.0
NZ_CP053305_1 1.1|2691|47|NZ_CP053305|CRISPRCasFinder 2691-2737 47 NZ_CP047443 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-6, complete sequence 4542-4588 2 0.957
NZ_CP053305_1 1.1|2691|47|NZ_CP053305|CRISPRCasFinder 2691-2737 47 NZ_CP047442 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-5, complete sequence 4528-4574 2 0.957

1. spacer 1.1|2691|47|NZ_CP053305|CRISPRCasFinder matches to NC_007386 (Spiroplasma citri plasmid pSciA strain GII3) position: , mismatch: 0, identity: 1.0

caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	CRISPR spacer
caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	Protospacer
***********************************************

2. spacer 1.1|2691|47|NZ_CP053305|CRISPRCasFinder matches to NZ_CP047436 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-8) position: , mismatch: 0, identity: 1.0

caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	CRISPR spacer
caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	Protospacer
***********************************************

3. spacer 1.1|2691|47|NZ_CP053305|CRISPRCasFinder matches to NZ_CP053305 (Spiroplasma citri strain C5 plasmid pScpC5-1, complete sequence) position: , mismatch: 0, identity: 1.0

caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	CRISPR spacer
caaacaagaacaaagcaaaatattaattataaaaaatttattttctt	Protospacer
***********************************************

4. spacer 1.1|2691|47|NZ_CP053305|CRISPRCasFinder matches to NZ_CP047443 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-6, complete sequence) position: , mismatch: 2, identity: 0.957

caaacaagaacaaagcaaaatattaattataaaaaatttattttctt-	CRISPR spacer
ccaacaagaacaaagcaaaatattaattataaaaaa-ttattttctta	Protospacer
* ********************************** ********** 

5. spacer 1.1|2691|47|NZ_CP053305|CRISPRCasFinder matches to NZ_CP047442 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-5, complete sequence) position: , mismatch: 2, identity: 0.957

caaacaagaac-aaagcaaaatattaattataaaaaatttattttctt	CRISPR spacer
-caacaagaacaaaagcaaaatattaattataaaaaatttattttctt	Protospacer
  ********* ************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP053311
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053311_1 37349-37452 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053311_1 1.1|37375|52|NZ_CP053311|CRISPRCasFinder 37375-37426 52 NZ_CP053311 Spiroplasma citri strain C5 plasmid pScpC5-7, complete sequence 37375-37426 0 1.0
NZ_CP053311_1 1.1|37375|52|NZ_CP053311|CRISPRCasFinder 37375-37426 52 NZ_CP053311 Spiroplasma citri strain C5 plasmid pScpC5-7, complete sequence 275-326 1 0.981
NZ_CP053311_1 1.1|37375|52|NZ_CP053311|CRISPRCasFinder 37375-37426 52 NZ_CP042473 Spiroplasma citri strain CC-2 plasmid pScpCC2-1, complete sequence 28256-28307 1 0.981

1. spacer 1.1|37375|52|NZ_CP053311|CRISPRCasFinder matches to NZ_CP053311 (Spiroplasma citri strain C5 plasmid pScpC5-7, complete sequence) position: , mismatch: 0, identity: 1.0

catatttatattttttaaaaaaccacttgaaaatatgggtttttatattatc	CRISPR spacer
catatttatattttttaaaaaaccacttgaaaatatgggtttttatattatc	Protospacer
****************************************************

2. spacer 1.1|37375|52|NZ_CP053311|CRISPRCasFinder matches to NZ_CP053311 (Spiroplasma citri strain C5 plasmid pScpC5-7, complete sequence) position: , mismatch: 1, identity: 0.981

catatttata-ttttttaaaaaaccacttgaaaatatgggtttttatattatc	CRISPR spacer
-atatttatatttttttaaaaaaccacttgaaaatatgggtttttatattatc	Protospacer
 ********* ******************************************

3. spacer 1.1|37375|52|NZ_CP053311|CRISPRCasFinder matches to NZ_CP042473 (Spiroplasma citri strain CC-2 plasmid pScpCC2-1, complete sequence) position: , mismatch: 1, identity: 0.981

catatttata-ttttttaaaaaaccacttgaaaatatgggtttttatattatc	CRISPR spacer
-atatttatatttttttaaaaaaccacttgaaaatatgggtttttatattatc	Protospacer
 ********* ******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage