Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053239 Escherichia coli strain SCU-106 plasmid pSCU-106-5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053238 Escherichia coli strain SCU-106 plasmid pSCU-106-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053234 Escherichia coli strain SCU-106 chromosome, complete genome 8 crisprs DEDDh,DinG,cas3,csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 2 15 12 0
NZ_CP053241 Escherichia coli strain SCU-106 plasmid pSCU-106-7, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053243 Escherichia coli strain SCU-106 plasmid pSCU-106-9, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053242 Escherichia coli strain SCU-106 plasmid pSCU-106-8, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053244 Escherichia coli strain SCU-106 plasmid pSCU-106-10, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053240 Escherichia coli strain SCU-106 plasmid pSCU-106-6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP053236 Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 0 crisprs RT 0 0 3 0
NZ_CP053237 Escherichia coli strain SCU-106 plasmid pSCU-106-3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP053234
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_1 1340188-1340311 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_2 1776516-1776651 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_3 2116623-2116707 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_4 2119418-2119502 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_5 3359305-3359422 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_6 3836418-3837300 TypeI-E I-E
14 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_7 3852802-3853319 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053234_8 3898812-3898954 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053234_4 4.1|2119442|37|NZ_CP053234|CRISPRCasFinder 2119442-2119478 37 NZ_CP053234.1 2146698-2146734 1 0.973
NZ_CP053234_3 3.1|2116647|37|NZ_CP053234|CRISPRCasFinder 2116647-2116683 37 NZ_CP053234.1 2146698-2146734 2 0.946

1. spacer 4.1|2119442|37|NZ_CP053234|CRISPRCasFinder matches to position: 2146698-2146734, mismatch: 1, identity: 0.973

tcatatggagcattggtggtcgccggagcgacatggg	CRISPR spacer
tcatatggaacattggtggtcgccggagcgacatggg	Protospacer
*********.***************************

2. spacer 3.1|2116647|37|NZ_CP053234|CRISPRCasFinder matches to position: 2146698-2146734, mismatch: 2, identity: 0.946

tcatatggagcattggtggtcgccggagcgacgtggg	CRISPR spacer
tcatatggaacattggtggtcgccggagcgacatggg	Protospacer
*********.**********************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053234_2 2.1|1776536|43|NZ_CP053234|PILER-CR 1776536-1776578 43 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141126 1 0.977
NZ_CP053234_1 1.1|1340231|38|NZ_CP053234|CRISPRCasFinder 1340231-1340268 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP053234_2 2.2|1776599|37|NZ_CP053234|PILER-CR 1776599-1776635 37 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141031-141067 2 0.946
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
NZ_CP053234_6 6.19|3836691|32|NZ_CP053234|CRISPRCasFinder,CRT 3836691-3836722 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 207611-207642 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 222835-222866 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 131047-131078 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 349369-349400 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 116770-116801 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 349371-349402 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 141808-141839 7 0.781
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 348980-349011 7 0.781
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 207610-207642 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 222835-222867 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 131047-131079 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 349369-349401 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 116770-116802 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 349371-349403 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 141807-141839 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 348980-349012 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 MN434096 Klebsiella phage JIPh_Kp127, complete genome 8414-8446 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 MK630230 Klebsiella phage Spivey, complete genome 1814-1846 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 MN434094 Klebsiella phage AmPh_EK80, complete genome 8419-8451 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 MG459987 Klebsiella phage Sugarland, complete genome 8643-8675 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 MT380195 Klebsiella phage KP_LZD_B01, complete genome 3481-3513 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 8404-8436 8 0.758
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 121617-121649 8 0.758
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 MN434096 Klebsiella phage JIPh_Kp127, complete genome 8414-8445 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 MK630230 Klebsiella phage Spivey, complete genome 1815-1846 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 MN434094 Klebsiella phage AmPh_EK80, complete genome 8419-8450 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 MG459987 Klebsiella phage Sugarland, complete genome 8643-8674 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 MT380195 Klebsiella phage KP_LZD_B01, complete genome 3481-3512 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 8404-8435 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 121617-121648 8 0.75
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_CP038236 Leisingera sp. NJS201 plasmid unnamed2, complete sequence 2813-2844 8 0.75
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 353558-353589 8 0.75
NZ_CP053234_6 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT 3836874-3836905 32 HQ615693 Synechococcus phage S-CRM01, complete genome 2748-2779 9 0.719
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036450-1036481 9 0.719
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555010-1555041 9 0.719
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 619383-619414 9 0.719
NZ_CP053234_6 6.26|3837118|32|NZ_CP053234|CRISPRCasFinder,CRT 3837118-3837149 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP053234_6 6.28|3837240|32|NZ_CP053234|CRISPRCasFinder,CRT 3837240-3837271 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
NZ_CP053234_7 7.2|3852892|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852892-3852923 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
NZ_CP053234_6 6.8|3836873|33|NZ_CP053234|PILER-CR 3836873-3836905 33 HQ615693 Synechococcus phage S-CRM01, complete genome 2747-2779 10 0.697
NZ_CP053234_6 6.11|3837056|33|NZ_CP053234|PILER-CR 3837056-3837088 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036449-1036481 10 0.697
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 823434-823465 10 0.688
NZ_CP053234_6 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT 3837057-3837088 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 682589-682620 10 0.688
NZ_CP053234_6 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT 3837179-3837210 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP053234_6 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT 3837179-3837210 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP053234_6 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT 3837179-3837210 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP053234_6 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT 3837179-3837210 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP053234_6 6.28|3837240|32|NZ_CP053234|CRISPRCasFinder,CRT 3837240-3837271 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP053234_7 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT 3852831-3852862 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
NZ_CP053234_4 4.1|2119442|37|NZ_CP053234|CRISPRCasFinder 2119442-2119478 37 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 29562-29598 11 0.703
NZ_CP053234_6 6.17|3836569|32|NZ_CP053234|CRISPRCasFinder,CRT 3836569-3836600 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656

1. spacer 2.1|1776536|43|NZ_CP053234|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.977

tgtcacacgcagataaatccaactttcaatattgttaagtccc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
****************************************.**

2. spacer 1.1|1340231|38|NZ_CP053234|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.2|1776599|37|NZ_CP053234|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.946

catggcgtagcaaaaagaaattttcaatattgtttta	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgcttta	Protospacer
********** *********************.****

4. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*. 

5. spacer 6.19|3836691|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** * 

6. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

7. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

8. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

9. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

10. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

11. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

12. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

13. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

14. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **. 

15. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

16. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

17. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

18. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

19. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

20. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

21. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

22. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ****** 

23. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

24. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

25. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

26. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

27. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

28. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

29. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*. 

30. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

31. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

32. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

33. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

34. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

35. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

36. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

37. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg	Protospacer
.**********.******** ***..* * *.

38. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg	Protospacer
.*** ************ ******   *** .

39. spacer 6.22|3836874|32|NZ_CP053234|CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719

atccggctatatctttgagcattacagaaata	CRISPR spacer
gcctcaatatatcattgagcaatacagaaatt	Protospacer
..*. . ****** ******* ********* 

40. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tgaattaggattatcgacatgagcgatacgga	Protospacer
. .* .  ********.**********.****

41. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *  

42. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *  

43. spacer 6.26|3837118|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

44. spacer 6.28|3837240|32|NZ_CP053234|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

45. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

46. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

47. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

48. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

49. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

50. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

51. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

52. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

53. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

54. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

55. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

56. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

57. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

58. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

59. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

60. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

61. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

62. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

63. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

64. spacer 7.2|3852892|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *  

65. spacer 6.8|3836873|33|NZ_CP053234|PILER-CR matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 10, identity: 0.697

gatccggctatatctttgagcattacagaaata	CRISPR spacer
tgcctcaatatatcattgagcaatacagaaatt	Protospacer
 ..*. . ****** ******* ********* 

66. spacer 6.11|3837056|33|NZ_CP053234|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.697

gccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
ttgaattaggattatcgacatgagcgatacgga	Protospacer
 . .* .  ********.**********.****

67. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

68. spacer 6.25|3837057|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

69. spacer 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

70. spacer 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

71. spacer 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

72. spacer 6.27|3837179|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

73. spacer 6.28|3837240|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

74. spacer 7.1|3852831|32|NZ_CP053234|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..   

75. spacer 4.1|2119442|37|NZ_CP053234|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 11, identity: 0.703

-tcatatggagcattggtggtcgccggagcgacatggg	CRISPR spacer
gctaca-agagcattggtggtcgccagtgcgacagtac	Protospacer
 ..*.* .*****************.* ******  . 

76. spacer 6.17|3836569|32|NZ_CP053234|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 296913 : 368919 89 Enterobacteria_phage(50.75%) tRNA,lysis,portal,protease,capsid,head,terminase,integrase,transposase,tail attL 306599:306615|attR 370430:370446
DBSCAN-SWA_2 705184 : 758766 61 Enterobacteria_phage(50.0%) tRNA,plate,portal,protease,capsid,head,terminase,integrase,tail attL 691929:691943|attR 716998:717012
DBSCAN-SWA_3 761771 : 812040 71 Shigella_phage(51.16%) plate,protease,capsid,head,integrase,transposase,tail attL 762784:762800|attR 792594:792610
DBSCAN-SWA_4 1076110 : 1145238 70 Escherichia_phage(33.33%) protease,capsid,holin,head,terminase,tRNA,transposase,tail NA
DBSCAN-SWA_5 1562720 : 1624912 51 Cronobacter_phage(12.5%) transposase,protease,plate,tRNA NA
DBSCAN-SWA_6 2035557 : 2098598 60 Vibrio_phage(23.08%) tRNA,protease,integrase,transposase,tail attL 2081049:2081064|attR 2101128:2101143
DBSCAN-SWA_7 2147134 : 2158962 14 Salmonella_phage(28.57%) NA NA
DBSCAN-SWA_8 3869674 : 3876814 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_9 3912167 : 4027239 115 Salmonella_phage(67.86%) tRNA,plate,lysis,portal,capsid,head,terminase,integrase,transposase,tail attL 3955961:3956006|attR 3988169:3988214
DBSCAN-SWA_10 4494390 : 4503832 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_11 4766345 : 4847162 101 Escherichia_phage(32.14%) tRNA,lysis,portal,capsid,holin,head,terminase,integrase,tail attL 4830509:4830525|attR 4857954:4857970
DBSCAN-SWA_12 4937046 : 5015330 76 Stx2-converting_phage(25.86%) protease,capsid,holin,head,terminase,integrase,transposase,tail attL 4936868:4936895|attR 4999492:4999519
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053236
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 60738 46 Salmonella_phage(41.18%) tRNA,transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP053235
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14844 : 60657 41 Enterobacteria_phage(16.67%) integrase,transposase attL 50580:50595|attR 55977:55992
DBSCAN-SWA_2 95212 : 105660 8 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_3 137895 : 144428 7 Enterobacteria_phage(33.33%) integrase,transposase attL 129060:129075|attR 140849:140864
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage