Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047303 Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 1, complete sequence 1 crisprs cas3,RT,DEDDh,DinG,csx1,WYL,csa3 0 1 5 0
NZ_CP047304 Vibrio cholerae O1 biovar El Tor strain E7946 chromosome 2, complete sequence 0 crisprs PD-DExK,csa3,cas3 0 0 0 0

Results visualization

1. NZ_CP047303
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047303_1 2646761-2647004 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047303_1 1.1|2646810|37|NZ_CP047303|PILER-CR 2646810-2646846 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP047303_1 1.1|2646810|37|NZ_CP047303|PILER-CR 2646810-2646846 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2646810|37|NZ_CP047303|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2646810|37|NZ_CP047303|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 652995 : 659612 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 714411 : 780377 70 Vibrio_phage(89.13%) tail,plate,tRNA,capsid,integrase,terminase,portal,head attL 747952:747975|attR 781062:781085
DBSCAN-SWA_3 1536475 : 1581451 40 Vibrio_phage(42.86%) coat NA
DBSCAN-SWA_4 2319815 : 2327008 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_5 2558636 : 2565860 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage