Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051857 Pseudomonas sp. SK chromosome, complete genome 9 crisprs RT,DEDDh,cas3,csa3,WYL,DinG 0 1 3 0

Results visualization

1. NZ_CP051857
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_1 254625-254715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_2 806247-806364 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_3 1531359-1531436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_4 1832388-1832528 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_5 2321617-2321730 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_6 2864240-2864329 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_7 3434187-3434298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_8 4974921-4975060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051857_9 5589773-5589846 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051857_3 3.1|1531384|28|NZ_CP051857|CRISPRCasFinder 1531384-1531411 28 MH992219 Apis mellifera associated microvirus 46 isolate INH_SP_298, complete genome 4134-4161 7 0.75

1. spacer 3.1|1531384|28|NZ_CP051857|CRISPRCasFinder matches to MH992219 (Apis mellifera associated microvirus 46 isolate INH_SP_298, complete genome) position: , mismatch: 7, identity: 0.75

atgcccgctcccacaggggtatcactga	CRISPR spacer
caagccgctccctaaggggtatcactgg	Protospacer
  . ********  *************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1064273 : 1072053 10 Thermobifida_phage(16.67%) NA NA
DBSCAN-SWA_2 1279524 : 1355106 75 uncultured_Caudovirales_phage(31.25%) tail,protease,lysis,tRNA,holin,plate NA
DBSCAN-SWA_3 3461238 : 3540847 107 uncultured_Caudovirales_phage(47.76%) tail,protease,bacteriocin,terminase,tRNA,integrase attL 3476495:3476554|attR 3531901:3531965
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage