Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP052036 Klebsiella pneumoniae strain KPN41053 chromosome, complete genome 1 crisprs DEDDh,cas3,csa3,DinG,WYL 0 1 7 0
NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP052036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052036_1 3986412-3986506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP052036_1 1.1|3986441|37|NZ_CP052036|CRISPRCasFinder 3986441-3986477 37 MH178096 Aeromonas phage AsXd-1, complete genome 10850-10886 5 0.865

1. spacer 1.1|3986441|37|NZ_CP052036|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 5, identity: 0.865

caggtagtgaatctgttgcaccaggtagtgaacgatt	CRISPR spacer
tacggggtgaatctgctgcaccaggtagtgaacgatt	Protospacer
.* * .*********.*********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 296195 : 306220 7 Liberibacter_phage(50.0%) integrase,transposase attL 301883:301896|attR 315002:315015
DBSCAN-SWA_2 2448569 : 2546170 99 Enterobacteria_phage(14.04%) capsid,head,tail,protease,terminase,holin,transposase,portal NA
DBSCAN-SWA_3 3720460 : 3731348 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_4 3897368 : 3933654 32 Escherichia_phage(28.57%) plate,tRNA,transposase NA
DBSCAN-SWA_5 3953064 : 3998380 60 Klebsiella_phage(43.75%) tail,integrase,holin,terminase attL 3958192:3958206|attR 4004715:4004729
DBSCAN-SWA_6 4453223 : 4462687 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_7 4946607 : 4953466 8 Moraxella_phage(16.67%) integrase,tRNA attL 4945234:4945249|attR 4960768:4960783
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP052037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13776 : 70265 46 Bacillus_phage(21.43%) transposase,integrase attL 55084:55143|attR 69265:70321
DBSCAN-SWA_2 90353 : 169571 60 Salmonella_phage(19.05%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage