Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 0 crisprs csa3 0 0 16 0
NZ_CP048290 Escherichia coli strain CVM N18EC0432 chromosome, complete genome 7 crisprs csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,DEDDh,c2c9_V-U4,DinG,RT 0 9 14 0
NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 0 crisprs DEDDh,cas14j 0 0 0 0
NZ_CP048292 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048291 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048294 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-6, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP048296
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73522 : 121783 36 Escherichia_phage(20.0%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048293
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7967 7 Salmonella_phage(75.0%) NA NA
DBSCAN-SWA_2 13532 : 14621 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_3 19583 : 23560 6 Klebsiella_phage(25.0%) NA NA
DBSCAN-SWA_4 28014 : 31890 6 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_5 36091 : 84796 56 Escherichia_phage(35.0%) transposase,integrase attL 45859:45918|attR 67545:68903
DBSCAN-SWA_6 94409 : 95591 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_7 119300 : 123203 3 Cronobacter_phage(66.67%) transposase NA
DBSCAN-SWA_8 127590 : 132859 6 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_9 136542 : 138928 3 Pacmanvirus(33.33%) NA NA
DBSCAN-SWA_10 145455 : 151040 5 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_11 154439 : 155297 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_12 158947 : 210678 52 Escherichia_phage(21.43%) protease,transposase,integrase attL 189921:189935|attR 207494:207508
DBSCAN-SWA_13 228064 : 229849 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 243922 : 246635 3 Salmonella_phage(50.0%) transposase NA
DBSCAN-SWA_15 249740 : 250745 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_16 266571 : 268373 2 Escherichia_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP048290
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_1 626472-626589 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_2 1075558-1075830 Unclear I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_3 1101548-1102430 TypeI-E I-E
14 spacers
cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_4 2351533-2351656 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_5 3312330-3312474 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_6 3554696-3554792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048290_7 4045038-4045153 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048290_4 4.1|2351576|38|NZ_CP048290|CRISPRCasFinder 2351576-2351613 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP048290_3 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102126-1102157 32 NZ_CP015609 Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence 10946-10977 6 0.812
NZ_CP048290_3 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102126-1102157 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 305380-305411 6 0.812
NZ_CP048290_3 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102309-1102340 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
NZ_CP048290_3 3.14|1102370|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102370-1102401 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP048290_2 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT 1075770-1075801 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 89317-89348 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 149653-149684 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_AP014686 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence 101093-101124 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_AP014686 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence 141992-142023 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_AP014688 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6d, complete sequence 99321-99352 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 142212-142243 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 161765-161796 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 175817-175848 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 140186-140217 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 188728-188759 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 267789-267820 7 0.781
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP049702 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence 70012-70043 7 0.781
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57773 8 0.75
NZ_CP048290_2 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT 1075770-1075801 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1077804-1077835 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1081182-1081213 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1264658-1264689 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1083481-1083512 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1080184-1080215 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 909207-909238 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1059848-1059879 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 KT221034 Streptomyces phage SF3, complete genome 42881-42912 8 0.75
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 149701-149732 8 0.75
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 797644-797675 8 0.75
NZ_CP048290_3 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102309-1102340 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
NZ_CP048290_2 2.1|1075587|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075587-1075618 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52228 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60757-60788 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41217-41248 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-728 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41217-41248 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184797 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54225-54256 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46038-46069 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51662-51693 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26853 9 0.719
NZ_CP048290_2 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1075648-1075679 32 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145953-145984 9 0.719
NZ_CP048290_2 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT 1075770-1075801 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 45733-45764 9 0.719
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP025432 Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence 92571-92602 9 0.719
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 AY526908 Bordetella phage BMP-1, complete genome 4333-4364 9 0.719
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NC_005357 Bordetella phage BPP-1, complete genome 4333-4364 9 0.719
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 AY526909 Bordetella phage BIP-1, complete genome 4333-4364 9 0.719
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 JN698994 Mycobacterium phage DS6A, complete genome 24764-24795 9 0.719
NZ_CP048290_3 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102309-1102340 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
NZ_CP048290_2 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT 1075770-1075801 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP048290_3 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1101760-1101791 32 NZ_CP025433 Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence 97047-97078 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 74612-74643 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 74612-74643 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NC_030916 Tsukamurella phage TPA4, complete genome 18471-18502 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 AB276040 Ralstonia phage RSA1 DNA, complete genome 989-1020 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NC_009382 Ralstonia phage phiRSA1, complete genome 989-1020 10 0.688
NZ_CP048290_3 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102126-1102157 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 74068-74099 10 0.688
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 524692-524723 11 0.656
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 315738-315769 11 0.656
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 522528-522559 11 0.656
NZ_CP048290_3 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT 1102065-1102096 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 357216-357247 11 0.656

1. spacer 4.1|2351576|38|NZ_CP048290|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015609 (Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
gcggcaaccgcgcttcccggcctgaccaatcc	Protospacer
*   ******************* **** * *

3. spacer 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
gcggcaaccgcgcttcccggcctgaccaatcc	Protospacer
*   ******************* **** * *

4. spacer 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812

gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
tcagcttgttgtccgcgatgcggtacgcccgc	Protospacer
 **..************** ******** **.

5. spacer 3.14|1102370|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

6. spacer 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

7. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

8. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

9. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014686 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

10. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014686 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

11. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014688 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6d, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

12. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

13. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

14. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

15. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

16. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

17. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

18. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049702 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence) position: , mismatch: 7, identity: 0.781

acgaaaatcgccgccggtgtcctcgctgatca-	CRISPR spacer
ttgaaaatcgccgcccgtgtcgtcg-agaccac	Protospacer
 .************* ***** ***  **.** 

19. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttc	Protospacer
 *   *. ******** *********** ***

20. spacer 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

21. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

22. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

23. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

24. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

25. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

26. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

27. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

28. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

29. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

30. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

31. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

32. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
gaggatcgggcgccagcctgcacgctgctggt	Protospacer
**. ******.********* ****** . * 

33. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 8, identity: 0.75

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gtacagctcgtcgccggtgtcctcgcggatca	Protospacer
... *. ***.*************** *****

34. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 8, identity: 0.75

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gccgtagccgccgccggtgccctggctgatca	Protospacer
.* . *..***********.*** ********

35. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

----acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
ggccgcga----tgccgtcggtgtccttgctgatca	Protospacer
    .***    .****.*********.********

36. spacer 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75

gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
ccgtgcggttgtccgcgatccggtaggcgcgc	Protospacer
 *.  . ****************** *****.

37. spacer 2.1|1075587|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccgatcacacgctcccacgggccgtaccagtc	CRISPR spacer
ttcggcagccgctcccaccggccggaccagtc	Protospacer
.. . **  ********* ***** *******

38. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

39. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

40. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

41. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

42. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

43. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

44. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

45. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

46. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

47. spacer 2.2|1075648|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

48. spacer 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

49. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 9, identity: 0.719

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
caacatcgggtggcagcctggacgtgtcgcgc	Protospacer
 **.******** ***********.    ** 

50. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 9, identity: 0.719

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
caaaccggggtgccagcctcgatgctggccat	Protospacer
 **  . ************ **.*******. 

51. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to AY526908 (Bordetella phage BMP-1, complete genome) position: , mismatch: 9, identity: 0.719

----gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
tccacgat----ggtgccagccttgatgctggccgt	Protospacer
     .**    *********** **.******** 

52. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_005357 (Bordetella phage BPP-1, complete genome) position: , mismatch: 9, identity: 0.719

----gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
tccacgat----ggtgccagccttgatgctggccgt	Protospacer
     .**    *********** **.******** 

53. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to AY526909 (Bordetella phage BIP-1, complete genome) position: , mismatch: 9, identity: 0.719

----gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
tccacgat----ggtgccagccttgatgctggccgt	Protospacer
     .**    *********** **.******** 

54. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to JN698994 (Mycobacterium phage DS6A, complete genome) position: , mismatch: 9, identity: 0.719

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
cccgtagccgccgccggtggcctcgctggtcc	Protospacer
 * . *..*********** ********.** 

55. spacer 3.13|1102309|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

------gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
cgcggggc------ttggccgcgatccggtccgcgcga	Protospacer
      **      *** ************ ****** 

56. spacer 2.4|1075770|32|NZ_CP048290|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

57. spacer 3.4|1101760|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 10, identity: 0.688

gaatatcgggtgccagcctggacgctggccga	CRISPR spacer
cagaccggggtgccagcctcgatgctggccat	Protospacer
 *.  . ************ **.*******. 

58. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 10, identity: 0.688

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
ctacacgctgccgccggtggccgcgctgatca	Protospacer
 .. * ...********** ** *********

59. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 10, identity: 0.688

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
ctacacgctgccgccggtggccgcgctgatca	Protospacer
 .. * ...********** ** *********

60. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_030916 (Tsukamurella phage TPA4, complete genome) position: , mismatch: 10, identity: 0.688

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gatcaggccgacgccggtgtcctcgccgatcg	Protospacer
.   *...** ***************.****.

61. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gacatgggcgccggcggtgtcctggctgatcg	Protospacer
.  * .. ***** ********* *******.

62. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 10, identity: 0.688

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gacatgggcgccggcggtgtcctggctgatcg	Protospacer
.  * .. ***** ********* *******.

63. spacer 3.10|1102126|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 10, identity: 0.688

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
tgcgacaccgcgcttcccgggcgcaccacgca	Protospacer
 .*   ************** * ******   

64. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gtactcgctgccgccggtggccgcgctgatca	Protospacer
...   ...********** ** *********

65. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
ctcgcgccagcggccggggtcctcgctgatca	Protospacer
 . . . . ** ***** **************

66. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
gtactcgctgccgccggtggccgcgctgatca	Protospacer
...   ...********** ** *********

67. spacer 3.9|1102065|32|NZ_CP048290|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 11, identity: 0.656

acgaaaatcgccgccggtgtcctcgctgatca	CRISPR spacer
cgtctgatcggcgccgatgtcctcgctgacgg	Protospacer
     .**** *****.************. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 48057 : 58418 11 Enterobacteria_phage(100.0%) integrase attL 48115:48128|attR 63188:63201
DBSCAN-SWA_2 826546 : 889987 56 Enterobacteria_phage(20.0%) integrase,transposase,protease,tRNA attL 862026:862041|attR 900226:900241
DBSCAN-SWA_3 1118786 : 1125926 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_4 1330928 : 1337142 7 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_5 1494679 : 1549901 35 Shigella_phage(28.57%) integrase,transposase attL 1489694:1489712|attR 1531526:1531544
DBSCAN-SWA_6 1769986 : 1779427 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_7 1791330 : 1863028 77 Escherichia_phage(31.82%) plate,portal,integrase,tRNA,head,capsid,holin,terminase,lysis,tail,transposase attL 1806645:1806660|attR 1830512:1830527
DBSCAN-SWA_8 2258846 : 2305430 60 Enterobacteria_phage(73.91%) plate,portal,integrase,tRNA,holin,head,capsid,terminase,tail attL 2266182:2266206|attR 2303004:2303028
DBSCAN-SWA_9 2664380 : 2673081 10 Enterobacteria_phage(55.56%) lysis NA
DBSCAN-SWA_10 2676249 : 2693409 24 Escherichia_phage(75.0%) tRNA NA
DBSCAN-SWA_11 3139059 : 3225869 92 Salmonella_phage(59.32%) plate,portal,integrase,protease,tRNA,head,capsid,terminase,lysis,tail attL 3132020:3132035|attR 3228814:3228829
DBSCAN-SWA_12 3526924 : 3541328 21 Enterobacteria_phage(55.0%) portal,integrase,terminase,lysis,tail attL 3528118:3528131|attR 3542020:3542033
DBSCAN-SWA_13 3813376 : 3825435 13 Enterobacteria_phage(88.89%) integrase attL 3808957:3808976|attR 3825599:3825618
DBSCAN-SWA_14 4142869 : 4165000 25 Shigella_phage(36.36%) tail,transposase,integrase attL 4162070:4162083|attR 4165714:4165727
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage