Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051705 Escherichia coli strain SCU-125 plasmid pSCU-125-5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051702 Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP051700 Escherichia coli strain SCU-125 chromosome, complete genome 6 crisprs DEDDh,DinG,cas3,cas14j,RT,c2c9_V-U4,WYL,csa3 0 4 356 0
NZ_CP051704 Escherichia coli strain SCU-125 plasmid pSCU-125-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051701 Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence 0 crisprs RT 0 0 2 0

Results visualization

1. NZ_CP051702
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5825 : 16685 13 Stx2-converting_phage(30.0%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP051700
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_1 585208-585331 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_2 1304151-1304242 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_3 1948352-1948487 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_4 2261406-2261538 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_5 2473909-2474058 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051700_6 4898378-4898491 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051700_2 2.1|1304177|40|NZ_CP051700|CRISPRCasFinder 1304177-1304216 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP051700_4 4.1|2261423|42|NZ_CP051700|PILER-CR 2261423-2261464 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP051700_4 4.2|2261482|40|NZ_CP051700|PILER-CR 2261482-2261521 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP051700_1 1.1|585251|38|NZ_CP051700|CRISPRCasFinder 585251-585288 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP051700_4 4.2|2261482|40|NZ_CP051700|PILER-CR 2261482-2261521 40 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 143235-143274 11 0.725

1. spacer 2.1|1304177|40|NZ_CP051700|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 4.1|2261423|42|NZ_CP051700|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

3. spacer 4.2|2261482|40|NZ_CP051700|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagaaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********************************.*******

4. spacer 1.1|585251|38|NZ_CP051700|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 4.2|2261482|40|NZ_CP051700|PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 11, identity: 0.725

catggcgtagaaaaaagaaattttcaatattgttttatgg-	CRISPR spacer
aacacaatagaaaaaagaaattttcaaccttg-tttatact	Protospacer
 *..  .********************. *** *****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 44057 33 Enterobacteria_phage(38.46%) head,tRNA,terminase,tail,capsid NA
DBSCAN-SWA_2 54706 : 58263 4 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 67404 : 70898 3 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_4 76737 : 78860 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 91967 : 93320 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_6 98046 : 108614 9 Catovirus(20.0%) NA NA
DBSCAN-SWA_7 112858 : 119652 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_8 125653 : 141900 15 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_9 149255 : 150155 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_10 156352 : 157519 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_11 175006 : 175816 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_12 200726 : 301163 103 Escherichia_phage(31.88%) head,terminase,holin,integrase,tail,capsid,lysis attL 236398:236413|attR 302545:302560
DBSCAN-SWA_13 305214 : 315298 10 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_14 331616 : 332699 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_15 346039 : 346792 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 358784 : 360299 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 370386 : 374655 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_18 379178 : 380912 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_19 387528 : 389579 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_20 393472 : 400534 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_21 404532 : 406008 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_22 414064 : 418533 7 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_23 426025 : 428074 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_24 433406 : 433616 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_25 439257 : 440814 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_26 444672 : 452778 8 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_27 461745 : 466322 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_28 469640 : 470495 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_29 479308 : 483394 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_30 488320 : 490276 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_31 494666 : 495320 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 502083 : 503304 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_33 510780 : 511608 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_34 517735 : 519997 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_35 529373 : 548912 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_36 567384 : 572468 5 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_37 580759 : 583026 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_38 588530 : 597334 9 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_39 601750 : 603249 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_40 610159 : 611434 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_41 631224 : 633036 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_42 642931 : 644233 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_43 654333 : 725360 85 Escherichia_phage(42.37%) protease,head,terminase,holin,portal,transposase,tail,capsid,lysis NA
DBSCAN-SWA_44 729746 : 730637 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_45 738139 : 740269 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_46 748119 : 749538 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_47 771175 : 778111 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_48 783588 : 785988 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_49 789395 : 791154 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_50 802578 : 804123 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_51 811590 : 813996 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_52 818668 : 820741 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_53 826237 : 827251 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_54 830880 : 832842 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_55 844692 : 845641 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_56 849581 : 853484 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_57 872137 : 873127 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_58 878086 : 887507 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_59 892248 : 892764 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 909988 : 911071 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_61 930412 : 932430 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_62 941363 : 943298 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_63 951110 : 951701 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_64 956611 : 1080144 150 Escherichia_phage(43.93%) protease,head,terminase,holin,portal,integrase,tail,capsid,lysis attL 964593:964608|attR 1087512:1087527
DBSCAN-SWA_65 1088078 : 1090093 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_66 1099659 : 1109667 10 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_67 1120799 : 1127068 8 Spodoptera_litura_granulovirus(33.33%) NA NA
DBSCAN-SWA_68 1130204 : 1132956 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_69 1145398 : 1146157 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_70 1162185 : 1163873 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_71 1178077 : 1180946 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_72 1184082 : 1185453 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_73 1190475 : 1192453 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_74 1195725 : 1199448 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_75 1206735 : 1206993 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_76 1219316 : 1220959 2 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_77 1224231 : 1225413 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_78 1237767 : 1238709 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 1254589 : 1254835 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_80 1259497 : 1260418 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_81 1269725 : 1270259 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_82 1274396 : 1278195 5 Pelagibacter_phage(50.0%) NA NA
DBSCAN-SWA_83 1286806 : 1287595 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_84 1302708 : 1304293 2 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_85 1307323 : 1319841 13 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_86 1330834 : 1331494 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_87 1335728 : 1337783 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_88 1350382 : 1352290 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_89 1361045 : 1371848 8 Bacillus_virus(20.0%) tRNA NA
DBSCAN-SWA_90 1386553 : 1391093 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_91 1396180 : 1397269 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_92 1401367 : 1404582 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_93 1407667 : 1431391 16 Escherichia_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_94 1440687 : 1442406 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_95 1445993 : 1448731 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_96 1451856 : 1460996 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_97 1469563 : 1470766 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_98 1482100 : 1483972 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_99 1487187 : 1494071 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_100 1499068 : 1504295 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_101 1510858 : 1522521 10 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_102 1533119 : 1534028 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_103 1540355 : 1542885 2 Klosneuvirus(50.0%) transposase NA
DBSCAN-SWA_104 1553196 : 1559772 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_105 1564135 : 1567655 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_106 1595147 : 1595939 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_107 1599317 : 1611150 10 Hokovirus(40.0%) NA NA
DBSCAN-SWA_108 1617805 : 1618570 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_109 1622714 : 1625360 2 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_110 1629853 : 1630612 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_111 1633666 : 1635613 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_112 1640238 : 1641903 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_113 1646040 : 1647081 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_114 1655025 : 1660148 4 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_115 1667158 : 1669598 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_116 1674014 : 1674661 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_117 1688750 : 1690865 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_118 1693971 : 1695794 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_119 1710084 : 1716127 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_120 1727160 : 1730304 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_121 1733449 : 1735565 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_122 1744357 : 1748835 6 Enterobacteria_phage(33.33%) tRNA,tail NA
DBSCAN-SWA_123 1760770 : 1761916 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_124 1768106 : 1769888 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_125 1776223 : 1776910 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_126 1780046 : 1780724 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_127 1786605 : 1789847 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_128 1799409 : 1807854 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_129 1814862 : 1818012 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_130 1826848 : 1830395 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1833718 : 1834414 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_132 1837554 : 1842601 4 Burkholderia_virus(25.0%) protease NA
DBSCAN-SWA_133 1864034 : 1872877 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_134 1879828 : 1889927 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_135 1894213 : 1895329 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_136 1902743 : 1903901 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_137 1910809 : 1911577 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_138 1916869 : 1924152 5 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_139 1929009 : 1930896 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_140 1939391 : 1943929 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_141 1956758 : 1964327 5 Vibrio_phage(33.33%) integrase,holin attL 1950272:1950285|attR 1965354:1965367
DBSCAN-SWA_142 1974252 : 1977557 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_143 1983602 : 1984454 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_144 2001679 : 2048395 40 Acinetobacter_phage(18.18%) transposase,plate NA
DBSCAN-SWA_145 2052340 : 2055103 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_146 2064368 : 2072222 9 Bradyrhizobium_phage(25.0%) NA NA
DBSCAN-SWA_147 2078742 : 2079774 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_148 2092731 : 2096847 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_149 2105675 : 2106434 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_150 2118021 : 2119446 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_151 2123375 : 2123720 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_152 2129631 : 2130429 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_153 2135564 : 2142370 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_154 2152260 : 2153145 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_155 2156407 : 2158682 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_156 2170817 : 2172242 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_157 2184659 : 2185211 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_158 2189457 : 2190501 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_159 2229790 : 2230489 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_160 2238765 : 2244187 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_161 2251932 : 2253893 4 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_162 2261787 : 2267447 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_163 2272950 : 2274099 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_164 2278907 : 2293431 12 Tupanvirus(16.67%) tRNA NA
DBSCAN-SWA_165 2296567 : 2297521 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_166 2309290 : 2311404 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_167 2314681 : 2320491 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_168 2328254 : 2329577 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_169 2335081 : 2337957 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_170 2345781 : 2347061 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_171 2350288 : 2355644 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_172 2375353 : 2376814 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_173 2387017 : 2388693 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_174 2392053 : 2393034 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_175 2396662 : 2398797 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_176 2414290 : 2416459 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_177 2420078 : 2427512 8 Stx2-converting_phage(40.0%) transposase NA
DBSCAN-SWA_178 2438806 : 2440315 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_179 2455748 : 2461118 2 Acanthamoeba_polyphaga_moumouvirus(50.0%) NA NA
DBSCAN-SWA_180 2465430 : 2477524 8 Stenotrophomonas_phage(20.0%) integrase,tRNA attL 2458173:2458187|attR 2470513:2470527
DBSCAN-SWA_181 2485835 : 2491932 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_182 2495570 : 2558840 58 Vibrio_phage(18.18%) protease,lysis,integrase,transposase attL 2533352:2533366|attR 2540132:2540146
DBSCAN-SWA_183 2569381 : 2579387 8 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_184 2583953 : 2584940 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_185 2595321 : 2654975 55 Escherichia_phage(12.5%) protease,tRNA,transposase NA
DBSCAN-SWA_186 2658890 : 2659436 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_187 2667432 : 2668410 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_188 2673330 : 2673864 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_189 2678068 : 2680052 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_190 2688386 : 2689652 1 Enterobacteria_phage(100.0%) integrase attL 2678654:2678667|attR 2691414:2691427
DBSCAN-SWA_191 2696267 : 2697197 1 Virus_Rctr41k(100.0%) NA NA
DBSCAN-SWA_192 2701754 : 2704664 4 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_193 2708998 : 2712385 1 Serratia_phage(100.0%) holin NA
DBSCAN-SWA_194 2718257 : 2718836 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_195 2739621 : 2741793 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_196 2750596 : 2753808 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_197 2773371 : 2774874 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_198 2779714 : 2780503 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_199 2786107 : 2787657 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_200 2793779 : 2800148 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_201 2805393 : 2807541 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_202 2811458 : 2812986 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_203 2822469 : 2824428 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 2830554 : 2831904 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_205 2835722 : 2839336 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_206 2849279 : 2850698 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_207 2856268 : 2858816 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_208 2871111 : 2871720 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_209 2879071 : 2880187 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_210 2904527 : 2908211 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_211 2921908 : 2923498 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_212 2928860 : 2930624 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_213 2938920 : 2947249 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_214 2951244 : 2954297 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_215 2962638 : 2968460 5 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_216 2973900 : 2975115 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_217 2987259 : 2994506 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_218 3001318 : 3005912 3 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_219 3019122 : 3023625 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_220 3035235 : 3040095 5 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_221 3050880 : 3053931 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_222 3062665 : 3065445 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_223 3079168 : 3081639 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_224 3085760 : 3088547 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_225 3102237 : 3102852 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_226 3111733 : 3115020 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_227 3137014 : 3138523 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_228 3148983 : 3150813 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_229 3158183 : 3166790 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_230 3174949 : 3176605 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_231 3184612 : 3190756 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_232 3194798 : 3200212 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_233 3207809 : 3209456 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_234 3222848 : 3228701 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_235 3231869 : 3232862 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_236 3244816 : 3252331 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_237 3262702 : 3264040 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_238 3274238 : 3281607 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_239 3286312 : 3287461 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_240 3291890 : 3303768 12 Cyanophage(16.67%) NA NA
DBSCAN-SWA_241 3311072 : 3312407 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_242 3317857 : 3318895 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_243 3332156 : 3333548 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_244 3337849 : 3344600 6 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_245 3347974 : 3352537 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_246 3359975 : 3362069 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_247 3365477 : 3374983 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_248 3397828 : 3402442 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_249 3422016 : 3423558 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_250 3428875 : 3429871 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_251 3434101 : 3434314 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_252 3437968 : 3440302 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_253 3456032 : 3458017 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_254 3503818 : 3505288 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_255 3515959 : 3521368 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_256 3531053 : 3536135 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_257 3544028 : 3554129 11 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_258 3559851 : 3561334 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_259 3564875 : 3566686 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_260 3586556 : 3589004 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_261 3604416 : 3605643 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_262 3610033 : 3612427 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_263 3618656 : 3619550 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_264 3626123 : 3629890 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_265 3646868 : 3647705 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_266 3666623 : 3676163 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_267 3681733 : 3690300 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_268 3699130 : 3701083 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_269 3722307 : 3808408 87 uncultured_Caudovirales_phage(58.62%) protease,head,tRNA,terminase,portal,integrase,tail,capsid attL 3745888:3745911|attR 3761225:3761248
DBSCAN-SWA_270 3817111 : 3831905 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_271 3835973 : 3837458 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_272 3844087 : 3846960 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_273 3851040 : 3857679 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_274 3863160 : 3865050 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_275 3870752 : 3878548 10 Peridroma_alphabaculovirus(25.0%) NA NA
DBSCAN-SWA_276 3895232 : 3896378 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_277 3902531 : 3904826 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_278 3924710 : 3925676 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_279 3938007 : 3954076 11 Herpes_simplex_virus(16.67%) tRNA NA
DBSCAN-SWA_280 3960484 : 3961723 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_281 3966860 : 3968294 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_282 3972207 : 3972861 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_283 3984094 : 3985932 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_284 3990279 : 3996540 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_285 4004381 : 4009421 4 Stx_converting_phage(50.0%) NA NA
DBSCAN-SWA_286 4016879 : 4024198 6 Ostreococcus_tauri_virus(33.33%) NA NA
DBSCAN-SWA_287 4030041 : 4030926 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_288 4053150 : 4054323 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_289 4085358 : 4090096 5 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_290 4103682 : 4104666 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_291 4110190 : 4112360 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_292 4141161 : 4142424 1 Pseudomonas_phage(100.0%) integrase attL 4139948:4139961|attR 4151395:4151408
DBSCAN-SWA_293 4165119 : 4166274 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_294 4174427 : 4175336 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_295 4180388 : 4181066 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_296 4194599 : 4195832 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_297 4203967 : 4208440 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_298 4212245 : 4227637 14 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_299 4251916 : 4252672 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_300 4256957 : 4259452 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_301 4269083 : 4275856 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_302 4281333 : 4297948 10 Klosneuvirus(14.29%) NA NA
DBSCAN-SWA_303 4311548 : 4311812 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_304 4316055 : 4321193 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_305 4330023 : 4332529 3 Pandoravirus(50.0%) tRNA NA
DBSCAN-SWA_306 4344105 : 4344861 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_307 4349719 : 4350568 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_308 4358100 : 4362215 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_309 4366248 : 4369272 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_310 4373060 : 4373732 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_311 4377245 : 4378031 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_312 4392669 : 4394702 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_313 4397813 : 4401529 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_314 4405902 : 4413042 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_315 4438042 : 4439008 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_316 4444476 : 4449863 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_317 4462521 : 4467819 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_318 4473625 : 4477676 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_319 4482685 : 4483168 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_320 4496800 : 4497871 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_321 4503776 : 4506350 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_322 4514835 : 4516134 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_323 4521427 : 4527510 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_324 4533281 : 4537018 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_325 4540477 : 4540738 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_326 4544859 : 4556167 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_327 4561925 : 4563437 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_328 4573418 : 4579756 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_329 4589642 : 4590074 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_330 4610554 : 4657577 57 Escherichia_phage(49.06%) integrase,terminase,tail,holin attL 4615191:4615207|attR 4655724:4655740
DBSCAN-SWA_331 4663824 : 4667826 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_332 4675305 : 4676019 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_333 4693260 : 4694211 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_334 4712965 : 4734693 22 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_335 4760232 : 4760967 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_336 4764785 : 4765706 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_337 4769395 : 4776972 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_338 4784901 : 4785834 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_339 4802257 : 4803343 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_340 4811879 : 4813016 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_341 4819765 : 4821283 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_342 4825494 : 4827354 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_343 4837913 : 4841141 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_344 4876109 : 4881113 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_345 4884716 : 4889092 4 Oenococcus_phage(50.0%) transposase NA
DBSCAN-SWA_346 4894985 : 4900829 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_347 4906262 : 4908890 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_348 4923744 : 4928587 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_349 4932864 : 4938666 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_350 4947434 : 4948052 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_351 4958096 : 4965746 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_352 4971500 : 4975801 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_353 4990326 : 4991184 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_354 4995252 : 4999038 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_355 5002732 : 5004253 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_356 5024603 : 5052687 41 Enterobacteria_phage(40.54%) lysis,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP051701
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9300 : 17844 8 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_2 107842 : 113258 8 Escherichia_phage(33.33%) integrase attL 106624:106636|attR 113444:113456
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage