Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051879 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051878 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051876 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_1, complete sequence 1 crisprs NA 1 1 0 0
NZ_CP051875 Acinetobacter baumannii strain Ab-B004d-c chromosome, complete genome 4 crisprs RT,cas3,DEDDh,WYL,csa3 0 0 16 0
NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP051875
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051875_1 1542542-1542630 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051875_2 1799813-1799960 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051875_3 2472174-2472271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051875_4 2479109-2479194 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 717557 : 733895 34 Acinetobacter_phage(57.89%) tail,head NA
DBSCAN-SWA_2 741429 : 751354 9 Acinetobacter_phage(42.86%) integrase,terminase attL 747053:747066|attR 758456:758469
DBSCAN-SWA_3 1159829 : 1195624 48 Acinetobacter_phage(84.62%) capsid,terminase NA
DBSCAN-SWA_4 1199874 : 1218620 15 Acinetobacter_phage(64.29%) tail,integrase attL 1202851:1202864|attR 1214906:1214919
DBSCAN-SWA_5 1259526 : 1279330 34 Acinetobacter_phage(50.0%) integrase,head,tail attL 1261003:1261018|attR 1289421:1289436
DBSCAN-SWA_6 1286864 : 1300247 13 Acinetobacter_phage(37.5%) terminase NA
DBSCAN-SWA_7 1626555 : 1634304 14 Acinetobacter_phage(80.0%) integrase attL 1615774:1615788|attR 1634455:1634469
DBSCAN-SWA_8 2248660 : 2272301 36 Acinetobacter_phage(40.91%) tail,head,terminase,integrase attL 2268594:2268609|attR 2277470:2277485
DBSCAN-SWA_9 2803976 : 2840621 42 Acinetobacter_phage(66.67%) capsid,integrase,terminase,tail attL 2797650:2797664|attR 2810547:2810561
DBSCAN-SWA_10 2844108 : 2854553 19 Acinetobacter_phage(87.5%) NA NA
DBSCAN-SWA_11 3074083 : 3081653 10 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_12 3086409 : 3094506 14 Acinetobacter_phage(57.14%) integrase attL 3092878:3092891|attR 3100382:3100395
DBSCAN-SWA_13 3163022 : 3172323 9 Acinetobacter_phage(37.5%) integrase,holin attL 3150672:3150684|attR 3166387:3166399
DBSCAN-SWA_14 3179761 : 3202528 41 Acinetobacter_phage(58.06%) terminase NA
DBSCAN-SWA_15 3827765 : 3837008 12 uncultured_Caudovirales_phage(75.0%) transposase NA
DBSCAN-SWA_16 4016618 : 4084621 58 Escherichia_phage(21.43%) transposase,protease,tRNA,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP051876
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051876_1 31297-31373 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP051876.1 31410-31440 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP051876.1 31500-31530 0 1.0

1. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to position: 31410-31440, mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

2. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to position: 31500-31530, mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 KT325596 Uncultured bacterium plasmid pFK2-7, complete sequence 2646-2676 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 KT325596 Uncultured bacterium plasmid pFK2-7, complete sequence 2736-2766 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 KT325596 Uncultured bacterium plasmid pFK2-7, complete sequence 2826-2856 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP038024 Acinetobacter radioresistens strain DD78 plasmid pAR2, complete sequence 29770-29800 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP010903 Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence 25434-25464 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP010903 Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence 25524-25554 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP010903 Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence 25614-25644 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 MK978162 Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence 29881-29911 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019217 Uncultured bacterium HHV216 plasmid pHHV216, complete sequence 2757-2787 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019218 Uncultured bacterium HHV35 plasmid pHHV35, complete sequence 2637-2667 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019218 Uncultured bacterium HHV35 plasmid pHHV35, complete sequence 2763-2793 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019218 Uncultured bacterium HHV35 plasmid pHHV35, complete sequence 2925-2955 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019299 Uncultured bacterium HH1107 plasmid pHH1107, complete sequence 2757-2787 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044465 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence 6229-6259 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044465 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence 6373-6403 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42002-42032 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42092-42122 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42182-42212 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42272-42302 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42362-42392 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 42452-42482 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 16888-16918 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 16978-17008 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 17068-17098 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 17158-17188 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 17248-17278 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 17338-17368 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP051870 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence 31320-31350 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP051870 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence 31410-31440 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP051870 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence 31500-31530 0 1.0
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 MK978162 Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence 29791-29821 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 MK978162 Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence 29611-29641 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 MK978162 Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence 29701-29731 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019217 Uncultured bacterium HHV216 plasmid pHHV216, complete sequence 2847-2877 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_019299 Uncultured bacterium HH1107 plasmid pHH1107, complete sequence 2847-2877 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044465 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence 6319-6349 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 17428-17458 1 0.968
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 113155-113185 9 0.71
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 114069-114099 9 0.71
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 26991-27021 9 0.71
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 148892-148922 9 0.71
NZ_CP051876_1 1.1|31320|31|NZ_CP051876|CRISPRCasFinder 31320-31350 31 NC_021795 Cellulophaga phage phi17:1, complete genome 3565-3595 10 0.677

1. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to KT325596 (Uncultured bacterium plasmid pFK2-7, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

2. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to KT325596 (Uncultured bacterium plasmid pFK2-7, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

3. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to KT325596 (Uncultured bacterium plasmid pFK2-7, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

4. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP038024 (Acinetobacter radioresistens strain DD78 plasmid pAR2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

5. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP010903 (Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

6. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP010903 (Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

7. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP010903 (Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

8. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

9. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019217 (Uncultured bacterium HHV216 plasmid pHHV216, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

10. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019218 (Uncultured bacterium HHV35 plasmid pHHV35, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

11. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019218 (Uncultured bacterium HHV35 plasmid pHHV35, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

12. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019218 (Uncultured bacterium HHV35 plasmid pHHV35, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

13. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019299 (Uncultured bacterium HH1107 plasmid pHH1107, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

14. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044465 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

15. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044465 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

16. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

17. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

18. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

19. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

20. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

21. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

22. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

23. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

24. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

25. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

26. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

27. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

28. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP051870 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

29. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP051870 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

30. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP051870 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence) position: , mismatch: 0, identity: 1.0

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaat	Protospacer
*******************************

31. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
acctctggccatgattgcagaaatggaaaat	Protospacer
 ******************************

32. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctttggccatgattgcagaaatggaaaat	Protospacer
****.**************************

33. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctttggccatgattgcagaaatggaaaat	Protospacer
****.**************************

34. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019217 (Uncultured bacterium HHV216 plasmid pHHV216, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatgaaaaat	Protospacer
*************************.*****

35. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_019299 (Uncultured bacterium HH1107 plasmid pHH1107, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatgaaaaat	Protospacer
*************************.*****

36. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044465 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggccatgattgcagaaatggaaaac	Protospacer
******************************.

37. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 1, identity: 0.968

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
tcctctggctatgattgcagaaatggaaaat	Protospacer
*********.*********************

38. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 9, identity: 0.71

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
gatcttggccatgattgcagaacaggaacgt	Protospacer
  ...*****************  **** .*

39. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 9, identity: 0.71

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
gatcttggccatgattgcagaacaggaacgt	Protospacer
  ...*****************  **** .*

40. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 9, identity: 0.71

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
gatcttggccatgattgcagaacaggaacgt	Protospacer
  ...*****************  **** .*

41. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.71

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
gatcttggccatgattgcagaacaggaacgt	Protospacer
  ...*****************  **** .*

42. spacer 1.1|31320|31|NZ_CP051876|CRISPRCasFinder matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 10, identity: 0.677

tcctctggccatgattgcagaaatggaaaat	CRISPR spacer
gaggactgcaatgattgcagaaatggataag	Protospacer
     . ** ***************** ** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP051877
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051877_1 1357-1453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6019-6049 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6040-6070 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14314-14344 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14335-14365 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2706-2736 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2727-2757 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1572-1602 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1593-1623 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15134-15164 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15155-15185 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4058-4088 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4079-4109 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6032-6062 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6053-6083 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13480-13510 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13501-13531 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3685-3715 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3706-3736 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2308-2338 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2329-2359 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3598-3628 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3619-3649 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 228-258 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 249-279 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 59-89 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 80-110 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1818-1848 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1839-1869 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6655-6685 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6676-6706 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8645-8675 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8666-8696 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9523-9553 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9544-9574 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8103-8133 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8124-8154 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9414-9444 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9435-9465 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6928-6958 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6949-6979 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3638-3668 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3659-3689 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2719-2749 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2740-2770 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8319-8349 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8340-8370 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8319-8349 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8340-8370 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2123-2153 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2144-2174 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8538-8568 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8559-8589 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2818-2848 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2839-2869 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7752-7782 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7773-7803 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8144-8174 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8165-8195 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10198-10228 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10219-10249 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4129-4159 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4150-4180 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10479-10509 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10500-10530 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7569-7599 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7590-7620 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 247-277 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 268-298 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1390-1420 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1411-1441 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 759-789 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 780-810 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6953-6983 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6974-7004 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 17984-18014 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 18005-18035 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2196-2226 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2217-2247 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7687-7717 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7708-7738 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7703-7733 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7724-7754 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2972-3002 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2993-3023 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4251-4281 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4272-4302 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18027-18057 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18048-18078 0 1.0
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7418-7448 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7439-7469 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4788-4818 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4809-4839 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8559-8589 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8580-8610 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9451-9481 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9472-9502 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3221-3251 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3242-3272 1 0.968
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4767-4797 8 0.742
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9493-9523 8 0.742
NZ_CP051877_1 1.1|1390|31|NZ_CP051877|CRISPRCasFinder 1390-1420 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3200-3230 8 0.742

1. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

2. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

3. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

4. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

5. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

6. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

7. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

8. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

9. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

10. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

11. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

12. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

13. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

14. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

15. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

16. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

17. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

18. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

19. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

20. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

21. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

22. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

23. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

24. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

25. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

26. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

27. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

28. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

29. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

30. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

31. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

32. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

33. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

34. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

35. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

36. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

37. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

38. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

39. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

40. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

41. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

42. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

43. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

44. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

45. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

46. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

47. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

48. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

49. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

50. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

51. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

52. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

53. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

54. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

55. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

56. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

57. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

58. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

59. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

60. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

61. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

62. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

63. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

64. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

65. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

66. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

67. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

68. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

69. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

70. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

71. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

72. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

73. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

74. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

75. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

76. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

77. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

78. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

79. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

80. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

81. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

82. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

83. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

84. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

85. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

86. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

87. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

88. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttagtagtcaatcc	Protospacer
*******************************

89. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttggtagtcaatcc	Protospacer
*******************.***********

90. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccgtcatagttggtagtcaatcc	Protospacer
*******************.***********

91. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

92. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

93. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

94. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

95. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

96. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

97. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

98. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.968

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttagtagtcaatcc	Protospacer
********** ********************

99. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 8, identity: 0.742

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttaggagctgaaag	Protospacer
********** ********** **...*   

100. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 8, identity: 0.742

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttaggagctgaaag	Protospacer
********** ********** **...*   

101. spacer 1.1|1390|31|NZ_CP051877|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 8, identity: 0.742

tagtcaatccgtcatagttagtagtcaatcc	CRISPR spacer
tagtcaatccctcatagttaggagctgaaag	Protospacer
********** ********** **...*   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage