Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051468 Rhodobacter sphaeroides strain CH10 chromosome 1, complete sequence 2 crisprs cas3,DEDDh,csa3 0 1 8 0
NZ_CP051473 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP051471 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051469 Rhodobacter sphaeroides strain CH10 chromosome 2, complete sequence 0 crisprs csa3 0 0 5 0
NZ_CP051472 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP051468
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051468_1 216860-216962 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051468_2 3139425-3139621 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 95476-95508 5 0.848
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 632715-632747 5 0.848
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 12280-12312 6 0.818
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP051473 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence 56659-56691 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP030276 Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence 56666-56698 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP015289 Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence 143791-143823 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP015212 Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence 55970-56002 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 295562-295594 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 129769-129801 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 259353-259385 7 0.788
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 74495-74527 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 574872-574904 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 386509-386541 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 650861-650893 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 530049-530081 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 187783-187815 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 642177-642209 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 28970-29002 8 0.758
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 85846-85878 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 7565-7597 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 642345-642377 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 226471-226503 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 226777-226809 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 283055-283087 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 71875-71907 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 179960-179992 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 49820-49852 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 376760-376792 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 168166-168198 9 0.727
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 227056-227088 10 0.697
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 274972-275004 10 0.697
NZ_CP051468_2 2.2|3139573|33|NZ_CP051468|PILER-CR 3139573-3139605 33 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 376253-376285 10 0.697

1. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.848

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtcgccggcgccgccggacagg	Protospacer
 * *********** ************.****.

2. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.848

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtcgccggcgccgccggacagg	Protospacer
 * *********** ************.****.

3. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 6, identity: 0.818

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
cgcagcaggtcgtccccggcgccgccgaacagc	Protospacer
   ** ********.***************** 

4. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP051473 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtctccgccgcctccgaaaatg	Protospacer
 * *************** **** ***** * .

5. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP030276 (Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtctccgccgcctccgaaaatg	Protospacer
 * *************** **** ***** * .

6. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP015289 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtctccgccgcctccgaaaatg	Protospacer
 * *************** **** ***** * .

7. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP015212 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagaaggtcgtctccgccgcctccgaaaatg	Protospacer
 * *************** **** ***** * .

8. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagctggtcgtcgccggcgccgccgatcagg	Protospacer
 * **  ******* ************* ***.

9. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagcacatcatcgccggcgccgccgaacaga	Protospacer
 * ** * .**.** ******************

10. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
gcaagatggtcgtcaccggcgccgacccgcagc	Protospacer
****** ******* ********* *  .*** 

11. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tacagcaggtcgtcgccggcgccgccgacgagc	Protospacer
   ** ******** *************  ** 

12. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
accatgacgtcgtcgccggctccgccgaacagc	Protospacer
.* * .* ****** ***** *********** 

13. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
accacgaggtcggctccggcgcggccgaactgc	Protospacer
.* * .****** ********* ******* * 

14. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atcaggacatcgtttccggcgccgccgaagaga	Protospacer
.. **.* .****.*************** ***

15. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
accatgacgtcgtcgccggctccgccgaacagc	Protospacer
.* * .* ****** ***** *********** 

16. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
tccagcacgtcgtctccggcgccgccgtcgagg	Protospacer
 * ** * *******************   **.

17. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atcaggacatcgtttccggcgccgccgaagaga	Protospacer
.. **.* .****.*************** ***

18. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
acgaagatgtcgttgccggcgccgccgaacagc	Protospacer
.*.*..* *****. ***************** 

19. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
cacaacacgtcgtcgccggcaccgccgaacagc	Protospacer
   *. * ****** *****.*********** 

20. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
cacaacacgtcgtcgccggcaccgccgaacagc	Protospacer
   *. * ****** *****.*********** 

21. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
cacaacacgtcgtcgccggcaccgccgaacagc	Protospacer
   *. * ****** *****.*********** 

22. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atgtagacgtcgtcgccggcgccgccgatcaga	Protospacer
... ..* ****** ************* ****

23. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atgtagacgtcgtcgccggcgccgccgatcaga	Protospacer
... ..* ****** ************* ****

24. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atcagcgtgtcgttgccggcgccgccgaacagg	Protospacer
.. ** . *****. *****************.

25. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
aacagcgtgtcgtctccgtcgccgccgaagagg	Protospacer
.  ** . ********** ********** **.

26. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
accaggaggtcgtcgccggcgccgccgttgatc	Protospacer
.* **.******** ************   *  

27. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
aacagcgtgtcgtcgccggcgccgccgatcagc	Protospacer
.  ** . ****** ************* *** 

28. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
cgcagcgtgtcgtttccggcgccgccggacagc	Protospacer
   ** . *****.*************.**** 

29. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.727

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
aacagcgtgtcgtctccgtcgccgccgaagagg	Protospacer
.  ** . ********** ********** **.

30. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 10, identity: 0.697

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
atgtagacgtcgtcaccggcgccgccgaccagc	Protospacer
... ..* ****** ************* *** 

31. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
aagggcaggtcgcgtccggcgccgccgaacccg	Protospacer
. ..* ******. ****************  .

32. spacer 2.2|3139573|33|NZ_CP051468|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.697

gcaagaaggtcgtctccggcgccgccgaacaga	CRISPR spacer
agcagaaggtcgttgccggcgccgccggcgatg	Protospacer
.  **********. ************.  * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 891106 : 910009 22 Bacillus_phage(40.0%) protease,terminase,integrase,portal,capsid,head attL 876990:877005|attR 893604:893619
DBSCAN-SWA_2 1126283 : 1142098 16 Paracoccus_phage(44.44%) tail,protease,terminase,portal,capsid,head NA
DBSCAN-SWA_3 1693033 : 1714552 22 Paracoccus_phage(40.0%) tail,protease,tRNA,capsid,head NA
DBSCAN-SWA_4 1811285 : 1844002 34 Tupanvirus(10.0%) tail,integrase,portal,capsid,head,holin attL 1815230:1815248|attR 1844950:1844968
DBSCAN-SWA_5 2148778 : 2172343 28 Rhodobacter_phage(23.08%) tail,protease,terminase,integrase,portal,capsid,head attL 2138502:2138519|attR 2168673:2168690
DBSCAN-SWA_6 2438126 : 2447173 8 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 2569000 : 2588747 28 Paracoccus_phage(26.67%) tail,terminase,integrase,portal,capsid,head attL 2567395:2567409|attR 2572098:2572112
DBSCAN-SWA_8 2595418 : 2603995 11 Pseudomonas_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP051469
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 52605 : 62291 17 Rhodobacter_phage(44.44%) integrase attL 51504:51519|attR 67354:67369
DBSCAN-SWA_2 66939 : 76537 12 Acidithiobacillus_phage(42.86%) capsid,terminase,portal,head NA
DBSCAN-SWA_3 85051 : 90581 7 Rhodobacter_phage(16.67%) NA NA
DBSCAN-SWA_4 229781 : 236952 11 EBPR_siphovirus(16.67%) NA NA
DBSCAN-SWA_5 547158 : 558161 14 Vibrio_phage(30.0%) tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP051470
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051470_1 19453-19531 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 67220-67252 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 60898-60930 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 21550-21582 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 60874-60906 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 104690-104722 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 19476-19508 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 3847-3879 0 1.0
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NC_011960 Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence 72598-72630 2 0.939
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 CP036421 Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence 28105-28137 2 0.939
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 291403-291435 7 0.788
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1573927-1573959 7 0.788
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 558458-558490 7 0.788
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK864266 Gordonia phage Arri, complete genome 8692-8724 9 0.727
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MN284907 Gordonia phage Fireball, complete genome 8624-8656 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK864264 Gordonia phage VanDeWege, complete genome 8812-8844 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MH479910 Gordonia phage Danyall, complete genome 8520-8552 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MT639651 Gordonia phage Portcullis, complete genome 8580-8612 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MH479917 Gordonia phage KimmyK, complete genome 8648-8680 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MH669015 Gordonia phage TillyBobJoe, complete genome 8335-8367 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK814761 Gordonia phage SmokingBunny, complete genome 8499-8531 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 KX557286 Gordonia phage Twister6, complete genome 8431-8463 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK864267 Gordonia phage Valary, complete genome 8884-8916 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK967381 Gordonia phage RogerDodger, complete genome 8884-8916 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MT310872 Gordonia phage Evamon, complete genome 8501-8533 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MT521998 Gordonia phage Jambalaya, complete genome 8332-8364 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK864265 Gordonia phage Barb, complete genome 8648-8680 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 NC_030913 Gordonia phage Wizard, complete genome 8624-8656 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MK305889 Gordonia phage Mutzi, complete genome 8520-8552 10 0.697
NZ_CP051470_1 1.1|19476|33|NZ_CP051470|CRISPRCasFinder 19476-19508 33 MN010760 Gordonia phage Nubi, complete genome 8521-8553 10 0.697

1. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

2. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

3. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

4. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

5. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

6. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

7. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 0, identity: 1.0

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccgacccccc	Protospacer
*********************************

8. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 2, identity: 0.939

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccggcccccg	Protospacer
**************************.***** 

9. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to CP036421 (Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tttgcccccgccgtgccgccctgccggcccccg	Protospacer
**************************.***** 

10. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tgttcgcccgccttgccgccctggcgacccggc	Protospacer
* * * ****** ********** ******  *

11. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.788

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tgttcgcccgccttgccgccctggcgacccggc	Protospacer
* * * ****** ********** ******  *

12. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
tgttcgcccgccttgccgccctggcgacccggc	Protospacer
* * * ****** ********** ******  *

13. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 9, identity: 0.727

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaaggatct	Protospacer
 ************ .**********.*   .*.

14. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MN284907 (Gordonia phage Fireball, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

15. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK864264 (Gordonia phage VanDeWege, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

16. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MH479910 (Gordonia phage Danyall, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

17. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

18. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MH479917 (Gordonia phage KimmyK, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

19. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MH669015 (Gordonia phage TillyBobJoe, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

20. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK814761 (Gordonia phage SmokingBunny, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

21. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to KX557286 (Gordonia phage Twister6, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

22. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

23. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

24. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MT310872 (Gordonia phage Evamon, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

25. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MT521998 (Gordonia phage Jambalaya, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

26. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK864265 (Gordonia phage Barb, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

27. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to NC_030913 (Gordonia phage Wizard, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

28. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MK305889 (Gordonia phage Mutzi, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

29. spacer 1.1|19476|33|NZ_CP051470|CRISPRCasFinder matches to MN010760 (Gordonia phage Nubi, complete genome) position: , mismatch: 10, identity: 0.697

tttgcccccgccgtgccgccctgccgacccccc	CRISPR spacer
gttgcccccgccggaccgccctgccaggagtct	Protospacer
 ************ .**********..   .*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19546 : 29936 10 Enterobacteria_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage