Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051132 Enterobacter hormaechei strain AMS-38 chromosome, complete genome 3 crisprs DEDDh,DinG,PD-DExK,cas3,csa3,WYL,cas1,cas3f,cas8f,cas5f,cas7f,cas6f 1 10 373 0
NZ_CP051136 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38d, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP051133 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP051135 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38c, complete sequence 0 crisprs csa3 0 0 15 0
NZ_CP051134 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38b, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP051132
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051132_1 3791461-3791848 Unclear I-F
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051132_2 3809098-3809967 TypeI-F I-F
14 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051132_3 3819445-3820135 TypeI-F I-F
11 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP051132_3 3.7|3819835|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819835-3819866 32 NZ_CP051132.1 2412355-2412386 1 0.969

1. spacer 3.7|3819835|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to position: 2412355-2412386, mismatch: 1, identity: 0.969

tagtcacccagcgtttgatgcattacggtgcg	CRISPR spacer
taatcacccagcgtttgatgcattacggtgcg	Protospacer
**.*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972693 Salmonella phage SI23, complete genome 6397-6428 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK770415 Salmonella phage SF11, complete genome 15201-15232 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972694 Salmonella phage SE22, complete genome 27485-27516 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK770414 Salmonella phage SE16, complete genome 19097-19128 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 NC_013059 Salmonella phage c341, complete genome 37505-37536 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972686 Salmonella phage SF3, complete genome 38551-38582 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972685 Salmonella phage SE10, complete genome 39770-39801 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972687 Salmonella phage SE1 (in:P22virus), complete genome 30044-30075 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 FJ000341 Salmonella phage g341c, complete genome 37505-37536 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 EU570103 Salmonella phage epsilon34, complete genome 39546-39577 2 0.938
NZ_CP051132_1 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT 3791789-3791820 32 MK972692 Salmonella phage SE21, complete genome 26621-26652 2 0.938
NZ_CP051132_3 3.1|3819473|34|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819473-3819506 34 NC_047875 Salmonella phage UPF_BP1, complete genome 9721-9754 3 0.912
NZ_CP051132_2 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809608-3809639 32 MT251347 Klebsiella phage LASTA, complete genome 60146-60177 5 0.844
NZ_CP051132_2 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809608-3809639 32 MT251348 Klebsiella phage SJM3, complete genome 60146-60177 5 0.844
NZ_CP051132_3 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819715-3819746 32 NZ_CP035421 Leisingera sp. NJS204 plasmid unnamed4, complete sequence 25247-25278 5 0.844
NZ_CP051132_2 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809668-3809699 32 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 45842-45873 6 0.812
NZ_CP051132_2 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809668-3809699 32 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 45832-45863 6 0.812
NZ_CP051132_2 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809668-3809699 32 MH460460 Dickeya phage vB_DsoM_JA13, complete genome 46037-46068 6 0.812
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21036-21067 7 0.781
NZ_CP051132_3 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819715-3819746 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 440509-440540 7 0.781
NZ_CP051132_3 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819715-3819746 32 NZ_CP009572 Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence 74501-74532 7 0.781
NZ_CP051132_1 1.4|3791669|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791669-3791700 32 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36335-36366 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534696 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26630-26661 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26630-26661 8 0.75
NZ_CP051132_2 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809487-3809518 32 LR794146 Bacteriophage APSE-7 strain HaCipinimaritimae-2836 genome assembly, chromosome: 1 8386-8417 8 0.75
NZ_CP051132_2 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809487-3809518 32 LR794149 Bacteriophage APSE-7 strain HaCicuneomaculata-2628 genome assembly, chromosome: 1 9304-9335 8 0.75
NZ_CP051132_2 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809487-3809518 32 NZ_CP012644 Rufibacter tibetensis strain 1351 plasmid 1, complete sequence 160605-160636 8 0.75
NZ_CP051132_3 3.4|3819655|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819655-3819686 32 MN694752 Marine virus AFVG_250M643, complete genome 8433-8464 8 0.75
NZ_CP051132_3 3.7|3819835|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819835-3819866 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 552157-552188 8 0.75
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62533-62564 9 0.719
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475130 9 0.719
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283177 9 0.719
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22327-22358 9 0.719
NZ_CP051132_2 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3809608-3809639 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 961364-961395 9 0.719
NZ_CP051132_3 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819715-3819746 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 199651-199682 9 0.719
NZ_CP051132_3 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3819715-3819746 32 NZ_CP049252 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence 17144-17175 9 0.719
NZ_CP051132_1 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT 3791729-3791760 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714217 11 0.656

1. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972693 (Salmonella phage SI23, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

2. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK770415 (Salmonella phage SF11, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

3. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972694 (Salmonella phage SE22, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

4. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK770414 (Salmonella phage SE16, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

5. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to NC_013059 (Salmonella phage c341, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

6. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972686 (Salmonella phage SF3, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

7. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972685 (Salmonella phage SE10, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

8. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972687 (Salmonella phage SE1 (in:P22virus), complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

9. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to FJ000341 (Salmonella phage g341c, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

10. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

11. spacer 1.6|3791789|32|NZ_CP051132|CRISPRCasFinder,CRT matches to MK972692 (Salmonella phage SE21, complete genome) position: , mismatch: 2, identity: 0.938

tcttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
tcctgcctgatttgctcatgccattagtcacg	Protospacer
**.******************* *********

12. spacer 3.1|3819473|34|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 3, identity: 0.912

ctgcatgactggatatccattccggttactgcac	CRISPR spacer
ctgcacgactggatatccattccggtgactgcat	Protospacer
*****.******************** ******.

13. spacer 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MT251347 (Klebsiella phage LASTA, complete genome) position: , mismatch: 5, identity: 0.844

ttgcggggtggcgggattccgagcacccgcat	CRISPR spacer
tgcgggggtggcggggttccgagtacccgcat	Protospacer
*   ***********.*******.********

14. spacer 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MT251348 (Klebsiella phage SJM3, complete genome) position: , mismatch: 5, identity: 0.844

ttgcggggtggcgggattccgagcacccgcat	CRISPR spacer
tgcgggggtggcggggttccgagtacccgcat	Protospacer
*   ***********.*******.********

15. spacer 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035421 (Leisingera sp. NJS204 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

cgtcggaac--ggcgcatcgctgctgcggcggct	CRISPR spacer
--ccggaacagggcgcagcgctgcggcggcggct	Protospacer
  .******  ****** ****** *********

16. spacer 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812

catgc-cgcggagtaactaacgtgatatccctt	CRISPR spacer
-atgcaagcggagtacctaacgtgaaatccatc	Protospacer
 ****  ******** ********* **** *.

17. spacer 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812

catgc-cgcggagtaactaacgtgatatccctt	CRISPR spacer
-atgcaagcggagtacctaacgtgaaatccatc	Protospacer
 ****  ******** ********* **** *.

18. spacer 2.10|3809668|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 6, identity: 0.812

catgc-cgcggagtaactaacgtgatatccctt	CRISPR spacer
-atgcaagcggagtacctaacgtgaaatccatc	Protospacer
 ****  ******** ********* **** *.

19. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 7, identity: 0.781

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcattgt	Protospacer
 **********.** ********* *..** *

20. spacer 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781

cgtcggaacggcgcatcgctgctgcggcggct	CRISPR spacer
gcccgcgacgccgcatcgctgctgcgccggct	Protospacer
  .** .*** *************** *****

21. spacer 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 7, identity: 0.781

-cgtcggaacggcgcatcgctgctgcggcggct	CRISPR spacer
tcgtt-gcacgccgcatcgttgctgcggcggtc	Protospacer
 ***. * *** *******.***********..

22. spacer 1.4|3791669|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

tctaactgccagacttcctggctttctccctc	CRISPR spacer
ttttgctgcccgacttcctggccttctcgccg	Protospacer
*.* .***** ***********.***** *. 

23. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccag----cgtgtttt	CRISPR spacer
aacggcgagaccgtcacgcgccaggtgccggg----	Protospacer
 ******* **** **********    ** *    

24. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

25. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

26. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

27. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

28. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

29. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

30. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

31. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

32. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 8, identity: 0.75

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
aacggcgacactgaaacgcgccagagcatagt	Protospacer
 **********.** ********* *..*  *

33. spacer 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to LR794146 (Bacteriophage APSE-7 strain HaCipinimaritimae-2836 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

tcgtcagcatcatcaggcgcttctgagggctt	CRISPR spacer
atgccagcatcttcaagcgcttctgaggcttg	Protospacer
 .*.******* ***.************ .* 

34. spacer 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to LR794149 (Bacteriophage APSE-7 strain HaCicuneomaculata-2628 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

tcgtcagcatcatcaggcgcttctgagggctt	CRISPR spacer
atgccagcatcttcaagcgcttctgaggcttg	Protospacer
 .*.******* ***.************ .* 

35. spacer 2.7|3809487|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012644 (Rufibacter tibetensis strain 1351 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgtcagcatcatcaggcgcttctgagggctt	CRISPR spacer
tccccagcatcaccaggcgcttctcagctgct	Protospacer
** .********.*********** **   .*

36. spacer 3.4|3819655|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to MN694752 (Marine virus AFVG_250M643, complete genome) position: , mismatch: 8, identity: 0.75

ttgca-aatcgaaaatgcgggactgttcaatat	CRISPR spacer
-tacatcatcgaaaatgcggtgctgttcaacga	Protospacer
 *.**  ************* .********.. 

37. spacer 3.7|3819835|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tagtcacccagcgtttgatgcattacggtgcg	CRISPR spacer
ctttcccgaagcgtttaatgctttacggtgcg	Protospacer
.  ** *  *******.**** **********

38. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.719

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ggcggcgacaccgacactcgcccgcgatctca	Protospacer
 .*************** **** ***  .*. 

39. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.719

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tccggcgacaccgacacccggcagcccaggat	Protospacer
* *************** ** **** ..   *

40. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 9, identity: 0.719

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ctcggcgatgccgacacgcgccagcagttcta	Protospacer
. ******..***************.  *.* 

41. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tccggcgacatcgacacgcggcagcccaggat	Protospacer
* ********.********* **** ..   *

42. spacer 2.9|3809608|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.719

ttgcggggtggcgggattccgagcacccgcat	CRISPR spacer
ttcgcgggtgccgggattccgagcagccctgc	Protospacer
**   ***** ************** ** ...

43. spacer 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcggaacggcgcatcgctgctgcggcggct	CRISPR spacer
tggcggcacggcgcatcgctgcttcgcccagc	Protospacer
.* *** **************** ** * . .

44. spacer 3.5|3819715|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049252 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcggaa----cggcgcatcgctgctgcggcggct	CRISPR spacer
----gcgatttgcggcgcatcgctgctggcgcggcc	Protospacer
    * .*    ****************  *****.

45. spacer 1.5|3791729|32|NZ_CP051132|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.656

tacggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
gggggcgactccgacccgcgccagcgccgcag	Protospacer
 . ****** ***** **********.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 41012 60 Cronobacter_phage(40.0%) lysis,capsid,tail,holin,terminase,integrase attL 17059:17076|attR 42189:42206
DBSCAN-SWA_2 54784 : 111060 67 Enterobacteria_phage(23.4%) capsid,tail,head,holin,terminase,tRNA NA
DBSCAN-SWA_3 118499 : 119956 2 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_4 141243 : 142758 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_5 159070 : 159787 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_6 166857 : 167610 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 195513 : 199612 4 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_8 204018 : 206799 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 213166 : 214468 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_10 227077 : 227780 2 Klebsiella_phage(50.0%) holin NA
DBSCAN-SWA_11 238872 : 246665 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_12 255693 : 256866 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_13 262408 : 263308 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_14 268818 : 278064 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_15 288198 : 293759 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_16 299287 : 305999 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_17 311207 : 320515 7 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_18 335500 : 342215 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_19 348094 : 348757 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_20 367417 : 370019 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_21 377916 : 385763 8 Enterobacteria_phage(60.0%) tRNA NA
DBSCAN-SWA_22 392326 : 392881 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_23 403233 : 404754 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_24 408481 : 413619 4 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_25 417398 : 418256 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_26 426140 : 430449 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_27 436141 : 443659 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_28 448962 : 457562 7 Tupanvirus(40.0%) NA NA
DBSCAN-SWA_29 461757 : 473516 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_30 495288 : 496293 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_31 515329 : 518577 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_32 527720 : 528740 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_33 533424 : 534198 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_34 538433 : 539951 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_35 546358 : 547495 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_36 555848 : 556934 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_37 566101 : 569760 3 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_38 573579 : 574311 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_39 589058 : 608881 22 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_40 612430 : 613381 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_41 617077 : 620161 1 Herpes_simplex_virus(100.0%) NA NA
DBSCAN-SWA_42 640550 : 641264 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_43 650991 : 658892 7 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_44 665335 : 665506 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_45 677624 : 684959 7 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_46 693783 : 699018 5 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_47 712212 : 718511 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_48 725880 : 737065 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_49 743267 : 760323 19 uncultured_Mediterranean_phage(12.5%) tRNA NA
DBSCAN-SWA_50 765621 : 767533 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_51 773073 : 775647 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_52 782445 : 783516 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_53 801537 : 803854 2 Staphylococcus_phage(50.0%) integrase attL 800245:800259|attR 803855:803869
DBSCAN-SWA_54 811887 : 813957 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_55 825609 : 830709 3 Acidithiobacillus_phage(50.0%) transposase NA
DBSCAN-SWA_56 838282 : 839907 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_57 845941 : 851215 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_58 878507 : 878894 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_59 909412 : 913711 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_60 923562 : 924168 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_61 928573 : 933857 5 Lactobacillus_phage(20.0%) NA NA
DBSCAN-SWA_62 947938 : 955873 8 Vibrio_phage(20.0%) tRNA NA
DBSCAN-SWA_63 961477 : 962443 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_64 970772 : 971786 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_65 989647 : 992209 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_66 997802 : 1001477 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_67 1004488 : 1006518 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_68 1020321 : 1020993 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_69 1024357 : 1027376 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_70 1030741 : 1038824 5 Erysipelothrix_phage(25.0%) NA NA
DBSCAN-SWA_71 1043311 : 1044154 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_72 1048971 : 1049727 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_73 1052999 : 1068449 9 environmental_halophage(16.67%) tRNA NA
DBSCAN-SWA_74 1073878 : 1078030 3 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_75 1082748 : 1084908 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_76 1098860 : 1103862 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_77 1121877 : 1124847 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_78 1130714 : 1138303 7 Microcystis_virus(20.0%) tRNA NA
DBSCAN-SWA_79 1142745 : 1144179 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_80 1148631 : 1151505 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_81 1159301 : 1160534 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_82 1183024 : 1184573 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_83 1197421 : 1198576 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_84 1228936 : 1230721 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_85 1240638 : 1244316 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_86 1256906 : 1257734 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_87 1265567 : 1266677 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1271223 : 1276185 3 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_89 1283249 : 1290600 6 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_90 1303586 : 1306365 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_91 1319389 : 1330915 10 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_92 1337898 : 1340755 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_93 1345892 : 1347134 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_94 1356439 : 1361763 4 Moraxella_phage(33.33%) tRNA NA
DBSCAN-SWA_95 1368083 : 1373205 3 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_96 1386901 : 1388389 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_97 1396551 : 1397517 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_98 1414577 : 1416872 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_99 1422556 : 1423702 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_100 1441098 : 1448890 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_101 1454563 : 1456459 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_102 1461899 : 1473562 8 Cafeteria_roenbergensis_virus(25.0%) protease NA
DBSCAN-SWA_103 1477004 : 1478707 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_104 1481838 : 1483327 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_105 1487371 : 1513858 25 Staphylococcus_phage(18.18%) tRNA NA
DBSCAN-SWA_106 1524671 : 1528673 4 Burkholderia_virus(50.0%) protease NA
DBSCAN-SWA_107 1532636 : 1534004 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_108 1552861 : 1553905 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_109 1567161 : 1569246 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_110 1582659 : 1586984 6 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_111 1606869 : 1610238 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_112 1618045 : 1623459 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_113 1629277 : 1635851 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_114 1646159 : 1646972 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_115 1661878 : 1665651 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_116 1671889 : 1672672 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_117 1677847 : 1680241 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_118 1683617 : 1684376 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_119 1687484 : 1689932 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_120 1708025 : 1709833 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_121 1713285 : 1714765 2 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_122 1720386 : 1724610 4 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_123 1727640 : 1730515 2 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_124 1733597 : 1734675 2 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_125 1753864 : 1754890 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_126 1759867 : 1761910 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_127 1808016 : 1808631 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_128 1817301 : 1818297 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_129 1822622 : 1824164 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1844720 : 1850006 5 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_131 1875680 : 1877327 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_132 1887422 : 1889273 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_133 1916579 : 1921548 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_134 1933438 : 1936921 4 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_135 1945132 : 1946635 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_136 1968857 : 1969736 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_137 1976991 : 1979769 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_138 1991473 : 1993947 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_139 1997867 : 2000660 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_140 2012826 : 2020764 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_141 2023928 : 2024921 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_142 2036703 : 2040129 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_143 2045588 : 2052393 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_144 2059263 : 2066652 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_145 2072074 : 2073223 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 2076603 : 2077579 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_147 2089017 : 2094288 6 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_148 2099797 : 2100802 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_149 2111849 : 2113007 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_150 2139397 : 2141494 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_151 2145159 : 2149334 5 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_152 2159091 : 2160129 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_153 2167719 : 2169111 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_154 2173321 : 2178330 4 Bordetella_phage(33.33%) NA NA
DBSCAN-SWA_155 2190792 : 2198391 10 Xanthomonas_phage(20.0%) NA NA
DBSCAN-SWA_156 2208083 : 2211464 3 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_157 2215580 : 2227506 12 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_158 2231567 : 2235766 4 Catovirus(33.33%) NA NA
DBSCAN-SWA_159 2252168 : 2256029 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_160 2260300 : 2262130 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_161 2274474 : 2277765 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_162 2281700 : 2286177 5 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_163 2291378 : 2293748 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_164 2303293 : 2308343 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_165 2312332 : 2323124 5 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_166 2331543 : 2336955 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_167 2349688 : 2355713 4 Brucella_phage(66.67%) NA NA
DBSCAN-SWA_168 2370478 : 2371588 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_169 2378687 : 2379296 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_170 2386356 : 2388865 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_171 2392038 : 2395643 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_172 2414394 : 2415744 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_173 2421811 : 2423770 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_174 2426860 : 2429996 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_175 2434620 : 2436135 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_176 2441139 : 2442672 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_177 2448763 : 2450307 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_178 2455922 : 2456711 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_179 2463192 : 2464695 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_180 2473008 : 2474379 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_181 2480654 : 2484952 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_182 2507766 : 2536814 27 uncultured_Caudovirales_phage(31.25%) transposase,integrase attL 2526260:2526274|attR 2549226:2549240
DBSCAN-SWA_183 2543956 : 2547437 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_184 2552530 : 2557165 4 Bacillus_phage(66.67%) transposase NA
DBSCAN-SWA_185 2560857 : 2568080 6 Caulobacter_phage(25.0%) integrase attL 2557814:2557826|attR 2568526:2568538
DBSCAN-SWA_186 2577809 : 2579790 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_187 2586080 : 2586611 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_188 2592556 : 2593534 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_189 2600816 : 2601362 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_190 2605278 : 2618260 11 Vibrio_phage(20.0%) tRNA,protease NA
DBSCAN-SWA_191 2622235 : 2624167 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_192 2665454 : 2668857 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_193 2672579 : 2673578 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_194 2687004 : 2689735 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_195 2699664 : 2709849 7 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_196 2728192 : 2729446 1 Stenotrophomonas_phage(100.0%) integrase attL 2719331:2719346|attR 2738097:2738112
DBSCAN-SWA_197 2736019 : 2738380 1 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_198 2749514 : 2750102 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_199 2759679 : 2760501 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_200 2766280 : 2773744 4 IC4_retrovirus(50.0%) protease NA
DBSCAN-SWA_201 2815418 : 2816698 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_202 2823966 : 2825031 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_203 2828769 : 2831567 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_204 2837027 : 2838350 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2844840 : 2852126 5 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_206 2865536 : 2879365 12 Cyanophage(20.0%) tRNA NA
DBSCAN-SWA_207 2889792 : 2890941 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_208 2900420 : 2901787 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_209 2909426 : 2914818 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_210 2921075 : 2921774 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_211 2934961 : 2936686 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_212 2962637 : 2963681 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_213 2967873 : 2968437 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_214 2979377 : 2980802 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_215 2989060 : 2997077 6 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_216 3009657 : 3016431 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_217 3026702 : 3027500 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_218 3033785 : 3034130 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_219 3038066 : 3039500 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_220 3050877 : 3051636 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_221 3060462 : 3064580 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_222 3076545 : 3077577 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_223 3084259 : 3085063 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_224 3089119 : 3096729 8 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_225 3105342 : 3105921 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_226 3119122 : 3170841 70 Enterobacteria_phage(30.51%) lysis,head,holin,terminase,integrase attL 3125825:3125840|attR 3175630:3175645
DBSCAN-SWA_227 3189183 : 3190005 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_228 3195725 : 3197510 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_229 3202406 : 3203174 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_230 3211674 : 3212835 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_231 3220748 : 3221852 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_232 3225459 : 3234014 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_233 3245832 : 3250172 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_234 3253754 : 3255416 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_235 3276057 : 3277557 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 3291532 : 3296580 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_237 3299751 : 3300447 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_238 3304826 : 3308355 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_239 3318287 : 3322551 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_240 3326799 : 3333853 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_241 3340622 : 3346167 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_242 3356135 : 3358634 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_243 3361664 : 3362336 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_244 3365468 : 3366155 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_245 3374260 : 3375646 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_246 3379429 : 3380296 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_247 3400165 : 3401137 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_248 3405312 : 3405600 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_249 3413663 : 3416372 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_250 3431366 : 3432071 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_251 3437392 : 3443306 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_252 3446763 : 3447570 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_253 3453773 : 3458521 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_254 3473320 : 3474823 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_255 3484019 : 3490328 6 uncultured_marine_virus(25.0%) NA NA
DBSCAN-SWA_256 3510432 : 3511245 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_257 3516034 : 3518492 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_258 3524881 : 3530004 4 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_259 3535831 : 3536878 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_260 3540804 : 3542469 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_261 3547077 : 3550864 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_262 3559647 : 3560421 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_263 3567107 : 3567785 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_264 3571057 : 3577420 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_265 3580516 : 3581308 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_266 3616117 : 3619588 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_267 3623912 : 3630441 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_268 3638710 : 3642166 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_269 3649389 : 3650298 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_270 3659996 : 3667260 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_271 3674497 : 3675151 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_272 3678681 : 3683821 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_273 3698048 : 3701708 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_274 3704816 : 3709692 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_275 3712981 : 3714577 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_276 3722151 : 3726278 3 Citrobacter_phage(50.0%) NA NA
DBSCAN-SWA_277 3729489 : 3731361 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_278 3738847 : 3740896 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_279 3749108 : 3760328 12 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_280 3763456 : 3764185 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_281 3780531 : 3783234 1 Orgyia_leucostigma_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_282 3801019 : 3806147 4 Planktothrix_phage(25.0%) protease NA
DBSCAN-SWA_283 3810230 : 3817705 5 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_284 3821555 : 3843927 15 Organic_Lake_phycodnavirus(20.0%) tRNA NA
DBSCAN-SWA_285 3847984 : 3849073 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_286 3853249 : 3857799 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_287 3874994 : 3883171 5 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_288 3888606 : 3893843 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_289 3906332 : 3908387 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_290 3912617 : 3917258 4 uncultured_Caudovirales_phage(66.67%) protease NA
DBSCAN-SWA_291 3922888 : 3923638 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_292 3926932 : 3930890 6 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_293 3947548 : 3948340 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_294 3956881 : 3957715 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_295 3961866 : 3962403 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_296 3970064 : 3970991 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_297 3975596 : 3975842 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_298 3990943 : 3991897 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_299 4006158 : 4007284 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_300 4010561 : 4012204 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_301 4024448 : 4024706 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_302 4029908 : 4040021 10 Gordonia_phage(20.0%) NA NA
DBSCAN-SWA_303 4045876 : 4047247 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_304 4050329 : 4055543 9 Phage_21(50.0%) NA NA
DBSCAN-SWA_305 4064736 : 4066020 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_306 4072379 : 4074497 2 Buzura_suppressaria_nuclear_polyhedrosis_virus(50.0%) NA NA
DBSCAN-SWA_307 4079325 : 4085617 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_308 4094697 : 4095318 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_309 4099925 : 4101146 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_310 4108476 : 4109304 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_311 4115502 : 4121209 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_312 4127325 : 4140745 15 Tupanvirus(12.5%) tRNA NA
DBSCAN-SWA_313 4146065 : 4150810 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_314 4172984 : 4179121 6 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_315 4184230 : 4187023 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_316 4190234 : 4191050 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_317 4198709 : 4209870 11 Cyanophage(16.67%) NA NA
DBSCAN-SWA_318 4216727 : 4217246 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_319 4221020 : 4222385 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_320 4225681 : 4226956 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_321 4251942 : 4255205 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_322 4266838 : 4267354 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_323 4276964 : 4282523 3 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_324 4287003 : 4288269 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_325 4302684 : 4303833 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_326 4310717 : 4321872 13 Escherichia_phage(57.14%) NA NA
DBSCAN-SWA_327 4327557 : 4333724 6 Ostreococcus_tauri_virus(25.0%) NA NA
DBSCAN-SWA_328 4340521 : 4340761 1 Enterobacterial_phage(100.0%) NA NA
DBSCAN-SWA_329 4347030 : 4348020 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_330 4355289 : 4357263 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_331 4374365 : 4376342 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_332 4380735 : 4381956 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_333 4387640 : 4393874 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_334 4400816 : 4403213 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_335 4423480 : 4425646 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_336 4433335 : 4434454 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_337 4438883 : 4440389 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_338 4448487 : 4449717 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_339 4456057 : 4461749 6 Phage_TP(50.0%) NA NA
DBSCAN-SWA_340 4465890 : 4467396 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_341 4470730 : 4471111 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_342 4481204 : 4482170 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_343 4489187 : 4494842 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_344 4516176 : 4517061 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_345 4529675 : 4531082 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_346 4544136 : 4545809 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_347 4552605 : 4555522 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_348 4566602 : 4569212 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_349 4575304 : 4576849 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_350 4579873 : 4586945 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_351 4592892 : 4593432 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_352 4598129 : 4600247 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_353 4612834 : 4613593 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_354 4626228 : 4631027 6 Escherichia_phage(50.0%) tRNA,integrase attL 4625269:4625283|attR 4638564:4638578
DBSCAN-SWA_355 4646499 : 4657617 7 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_356 4675109 : 4676192 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_357 4692734 : 4701224 8 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_358 4709881 : 4710472 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_359 4715397 : 4719727 3 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_360 4725674 : 4728632 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_361 4742907 : 4745804 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_362 4754021 : 4763881 11 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_363 4780216 : 4781005 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_364 4788198 : 4793909 7 Mythimna_unipuncta_granulovirus(33.33%) NA NA
DBSCAN-SWA_365 4797011 : 4799763 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_366 4804479 : 4805289 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_367 4808532 : 4822147 8 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_368 4830550 : 4831540 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_369 4869768 : 4877011 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_370 4880869 : 4882429 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_371 4889859 : 4890069 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_372 4895334 : 4897383 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_373 4904601 : 4912976 9 Shigella_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP051133
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3800 : 81511 95 Salmonella_phage(98.91%) tail,portal,terminase NA
DBSCAN-SWA_2 90410 : 108592 21 Salmonella_phage(88.89%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP051135
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 19848 25 uncultured_Caudovirales_phage(40.0%) transposase NA
DBSCAN-SWA_2 29787 : 30321 1 Edwardsiella_phage(100.0%) NA NA
DBSCAN-SWA_3 33441 : 34410 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_4 38612 : 42488 6 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_5 46942 : 50919 6 Salmonella_phage(25.0%) NA NA
DBSCAN-SWA_6 55881 : 56937 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_7 62535 : 71255 8 Salmonella_phage(80.0%) NA NA
DBSCAN-SWA_8 87103 : 88108 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_9 91213 : 93926 3 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_10 107998 : 109783 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_11 129514 : 218984 95 Salmonella_phage(14.29%) protease,transposase,integrase attL 133102:133116|attR 189927:189948
DBSCAN-SWA_12 225509 : 227895 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_13 231578 : 236847 6 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_14 246559 : 247474 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_15 254493 : 256171 2 Cronobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage