Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051154 Leifsonia sp. PS1209 chromosome, complete genome 4 crisprs csa3,WYL,DEDDh,cas3 2 0 1 0

Results visualization

1. NZ_CP051154
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051154_1 1822307-1822396 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051154_2 1822670-1822891 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051154_3 1823066-1823154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051154_4 2505656-2505748 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP051154_2 2.1|1822693|43|NZ_CP051154|CRISPRCasFinder 1822693-1822735 43 NZ_CP051154.1 1822594-1822636 2 0.953
NZ_CP051154_2 2.3|1822825|43|NZ_CP051154|CRISPRCasFinder 1822825-1822867 43 NZ_CP051154.1 1822627-1822669 2 0.953

1. spacer 2.1|1822693|43|NZ_CP051154|CRISPRCasFinder matches to position: 1822594-1822636, mismatch: 2, identity: 0.953

ggccgatttcgtctgctcgacctcggcggcgagggccgacttc	CRISPR spacer
ggcggacttcgtctgctcgacctcggcggcgagggccgacttc	Protospacer
*** **.************************************

2. spacer 2.3|1822825|43|NZ_CP051154|CRISPRCasFinder matches to position: 1822627-1822669, mismatch: 2, identity: 0.953

ggccgacttcgtggtggtgacctcggtgtcgagagcggacttc	CRISPR spacer
ggccgacttcgtggtggtgacctcggtgtcgagggccgacttc	Protospacer
*********************************.** ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3363916 : 3375177 11 Pandoravirus(33.33%) tRNA,integrase attL 3364096:3364110|attR 3377211:3377225
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage