Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041293 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041294 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041296 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041298 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-p4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP041295 Acinetobacter indicus strain 80-1-2 chromosome, complete genome 3 crisprs cas14j,DEDDh,csa3,cas3,WYL,c2c9_V-U4 0 1 7 0
NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 1 crisprs NA 0 6 8 0

Results visualization

1. NZ_CP041297
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041297_1 16719-16926 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041297_1 1.1|16748|31|NZ_CP041297|PILER-CR 16748-16778 31 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16747-16777 0 1.0
NZ_CP041297_1 1.2|16808|31|NZ_CP041297|PILER-CR 16808-16838 31 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16807-16837 0 1.0
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16867-16897 0 1.0
NZ_CP041297_1 1.4|16747|32|NZ_CP041297|CRISPRCasFinder 16747-16778 32 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16747-16778 0 1.0
NZ_CP041297_1 1.5|16807|32|NZ_CP041297|CRISPRCasFinder 16807-16838 32 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16807-16838 0 1.0
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP041297 Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence 16867-16898 0 1.0
NZ_CP041297_1 1.1|16748|31|NZ_CP041297|PILER-CR 16748-16778 31 NZ_CP044459 Acinetobacter indicus strain B18 plasmid pB18-4, complete sequence 23187-23217 2 0.935
NZ_CP041297_1 1.1|16748|31|NZ_CP041297|PILER-CR 16748-16778 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 206854-206884 2 0.935
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 58264-58294 2 0.935
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 275948-275978 2 0.935
NZ_CP041297_1 1.4|16747|32|NZ_CP041297|CRISPRCasFinder 16747-16778 32 NZ_CP044459 Acinetobacter indicus strain B18 plasmid pB18-4, complete sequence 23187-23218 2 0.938
NZ_CP041297_1 1.4|16747|32|NZ_CP041297|CRISPRCasFinder 16747-16778 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 206854-206885 2 0.938
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 58263-58294 2 0.938
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 275947-275978 2 0.938
NZ_CP041297_1 1.2|16808|31|NZ_CP041297|PILER-CR 16808-16838 31 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 63467-63497 3 0.903
NZ_CP041297_1 1.2|16808|31|NZ_CP041297|PILER-CR 16808-16838 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 281151-281181 3 0.903
NZ_CP041297_1 1.5|16807|32|NZ_CP041297|CRISPRCasFinder 16807-16838 32 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 63467-63498 3 0.906
NZ_CP041297_1 1.5|16807|32|NZ_CP041297|CRISPRCasFinder 16807-16838 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 281151-281182 3 0.906
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 81800-81830 8 0.742
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 266090-266120 8 0.742
NZ_CP041297_1 1.3|16868|31|NZ_CP041297|PILER-CR 16868-16898 31 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1494719-1494749 8 0.742
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 81800-81831 8 0.75
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 266090-266121 8 0.75
NZ_CP041297_1 1.6|16867|32|NZ_CP041297|CRISPRCasFinder 16867-16898 32 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1494718-1494749 8 0.75

1. spacer 1.1|16748|31|NZ_CP041297|PILER-CR matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

gatacatggaaatcttggattactccagtca	CRISPR spacer
gatacatggaaatcttggattactccagtca	Protospacer
*******************************

2. spacer 1.2|16808|31|NZ_CP041297|PILER-CR matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttccatgaaggaattttattctcttag	CRISPR spacer
agatttccatgaaggaattttattctcttag	Protospacer
*******************************

3. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cgtatcttggcatttgataaatgccgtttga	Protospacer
*******************************

4. spacer 1.4|16747|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

gatacatggaaatcttggattactccagtcaa	CRISPR spacer
gatacatggaaatcttggattactccagtcaa	Protospacer
********************************

5. spacer 1.5|16807|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttccatgaaggaattttattctcttaga	CRISPR spacer
agatttccatgaaggaattttattctcttaga	Protospacer
********************************

6. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 0, identity: 1.0

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cgtatcttggcatttgataaatgccgtttgaa	Protospacer
********************************

7. spacer 1.1|16748|31|NZ_CP041297|PILER-CR matches to NZ_CP044459 (Acinetobacter indicus strain B18 plasmid pB18-4, complete sequence) position: , mismatch: 2, identity: 0.935

gatacatggaaatcttggattactccagtca	CRISPR spacer
gatacatggaaatcttggattactccaatta	Protospacer
***************************.*.*

8. spacer 1.1|16748|31|NZ_CP041297|PILER-CR matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 2, identity: 0.935

gatacatggaaatcttggattactccagtca	CRISPR spacer
gatacatggaaatcttggattactccaatta	Protospacer
***************************.*.*

9. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 2, identity: 0.935

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cgtattctggcatttgataaatgccgtttga	Protospacer
*****..************************

10. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 2, identity: 0.935

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cgtattctggcatttgataaatgccgtttga	Protospacer
*****..************************

11. spacer 1.4|16747|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP044459 (Acinetobacter indicus strain B18 plasmid pB18-4, complete sequence) position: , mismatch: 2, identity: 0.938

gatacatggaaatcttggattactccagtcaa	CRISPR spacer
gatacatggaaatcttggattactccaattaa	Protospacer
***************************.*.**

12. spacer 1.4|16747|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 2, identity: 0.938

gatacatggaaatcttggattactccagtcaa	CRISPR spacer
gatacatggaaatcttggattactccaattaa	Protospacer
***************************.*.**

13. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 2, identity: 0.938

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cgtattctggcatttgataaatgccgtttgaa	Protospacer
*****..*************************

14. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 2, identity: 0.938

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cgtattctggcatttgataaatgccgtttgaa	Protospacer
*****..*************************

15. spacer 1.2|16808|31|NZ_CP041297|PILER-CR matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 3, identity: 0.903

agatttccatgaaggaattttattctcttag	CRISPR spacer
aagtttctatgaaggaattttattctcttag	Protospacer
*..****.***********************

16. spacer 1.2|16808|31|NZ_CP041297|PILER-CR matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 3, identity: 0.903

agatttccatgaaggaattttattctcttag	CRISPR spacer
aagtttctatgaaggaattttattctcttag	Protospacer
*..****.***********************

17. spacer 1.5|16807|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 3, identity: 0.906

agatttccatgaaggaattttattctcttaga	CRISPR spacer
aagtttctatgaaggaattttattctcttaga	Protospacer
*..****.************************

18. spacer 1.5|16807|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 3, identity: 0.906

agatttccatgaaggaattttattctcttaga	CRISPR spacer
aagtttctatgaaggaattttattctcttaga	Protospacer
*..****.************************

19. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 8, identity: 0.742

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cttatcgtggcattttataaatgccggggag	Protospacer
* **** ******** **********   ..

20. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 8, identity: 0.742

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cttatcgtggcattttataaatgccggggag	Protospacer
* **** ******** **********   ..

21. spacer 1.3|16868|31|NZ_CP041297|PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 8, identity: 0.742

cgtatcttggcatttgataaatgccgtttga	CRISPR spacer
cttatcgtggcattttataaatgccggggag	Protospacer
* **** ******** **********   ..

22. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 8, identity: 0.75

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cttatcgtggcattttataaatgccggggaga	Protospacer
* **** ******** **********   ..*

23. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 8, identity: 0.75

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cttatcgtggcattttataaatgccggggaga	Protospacer
* **** ******** **********   ..*

24. spacer 1.6|16867|32|NZ_CP041297|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 8, identity: 0.75

cgtatcttggcatttgataaatgccgtttgaa	CRISPR spacer
cttatcgtggcattttataaatgccggggaga	Protospacer
* **** ******** **********   ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1491 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_2 7150 : 7357 1 Fusobacterium_phage(100.0%) NA NA
DBSCAN-SWA_3 11729 : 13625 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_4 20534 : 23083 2 Escherichia_phage(50.0%) integrase,transposase attL 21302:21361|attR 26419:27485
DBSCAN-SWA_5 27814 : 28630 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_6 33258 : 34038 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 37972 : 38677 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_8 43353 : 49979 5 uncultured_Caudovirales_phage(40.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP041295
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041295_1 1213578-1213789 Orphan I-F:NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041295_2 1458032-1458120 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041295_3 2599003-2599115 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041295_1 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder 1213727-1213757 31 MK024806 Proteus phage Mydo, complete genome 105143-105173 9 0.71
NZ_CP041295_1 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder 1213727-1213757 31 MT178275 Klebsiella virus KpS8, complete genome 49394-49424 9 0.71
NZ_CP041295_1 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder 1213727-1213757 31 NC_048647 UNVERIFIED: Klebsiella phage KNP2 genomic sequence 40138-40168 9 0.71
NZ_CP041295_1 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder 1213727-1213757 31 MT939253 Klebsiella phage vB_KpnM_Seu621, complete genome 49357-49387 9 0.71
NZ_CP041295_1 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder 1213727-1213757 31 KX452695 UNVERIFIED: Klebsiella phage KPN2 genomic sequence 40138-40168 9 0.71

1. spacer 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder matches to MK024806 (Proteus phage Mydo, complete genome) position: , mismatch: 9, identity: 0.71

ttgtcacgaactcccccaacaataagcgcag	CRISPR spacer
tcttcacgaactcccccaacgataacaaggc	Protospacer
*. *****************.****  . . 

2. spacer 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder matches to MT178275 (Klebsiella virus KpS8, complete genome) position: , mismatch: 9, identity: 0.71

ttgtcacgaactcccccaacaataagcgcag	CRISPR spacer
tcttcacgaactcccccaacgataacaaggc	Protospacer
*. *****************.****  . . 

3. spacer 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder matches to NC_048647 (UNVERIFIED: Klebsiella phage KNP2 genomic sequence) position: , mismatch: 9, identity: 0.71

ttgtcacgaactcccccaacaataagcgcag	CRISPR spacer
tcttcacgaactcccccaacgataacaaggc	Protospacer
*. *****************.****  . . 

4. spacer 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder matches to MT939253 (Klebsiella phage vB_KpnM_Seu621, complete genome) position: , mismatch: 9, identity: 0.71

ttgtcacgaactcccccaacaataagcgcag	CRISPR spacer
tcttcacgaactcccccaacgataacaaggc	Protospacer
*. *****************.****  . . 

5. spacer 1.3|1213727|31|NZ_CP041295|CRISPRCasFinder matches to KX452695 (UNVERIFIED: Klebsiella phage KPN2 genomic sequence) position: , mismatch: 9, identity: 0.71

ttgtcacgaactcccccaacaataagcgcag	CRISPR spacer
tcttcacgaactcccccaacgataacaaggc	Protospacer
*. *****************.****  . . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 866378 : 872302 7 Acinetobacter_phage(83.33%) NA NA
DBSCAN-SWA_2 1092875 : 1149031 55 uncultured_Caudovirales_phage(15.38%) tRNA,transposase,protease,integrase attL 1087992:1088007|attR 1151844:1151859
DBSCAN-SWA_3 1364491 : 1408225 47 uncultured_virus(20.0%) plate,protease NA
DBSCAN-SWA_4 1781021 : 1791589 9 Catovirus(16.67%) NA NA
DBSCAN-SWA_5 1890629 : 1899483 10 uncultured_Caudovirales_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1949315 : 2058787 82 Shigella_phage(15.79%) transposase,integrase attL 1949262:1949277|attR 2021603:2021617
DBSCAN-SWA_7 2873333 : 2914149 33 Helicobacter_phage(22.22%) tRNA,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage