Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050995 Chryseobacterium gallinarum strain FDAARGOS_636 chromosome, complete genome 4 crisprs PD-DExK,cas9,cas1,cas2,DEDDh,csa3,cas3,WYL 0 23 300 0
NZ_CP050996 Chryseobacterium gallinarum strain FDAARGOS_636 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP050995
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050995_1 662944-665608 orTypeII NA
34 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050995_2 1658273-1658386 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050995_3 2701948-2702076 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050995_4 3828874-3828977 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945672 UNVERIFIED: Microviridae sp. isolate 784-1602, complete genome 2913-2942 4 0.867
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 MN693101 Marine virus AFVG_25M559, complete genome 17421-17450 5 0.833
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 KC847113 Bacillus phage PBP180, complete sequence 26529-26558 5 0.833
NZ_CP050995_1 1.17|664223|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664223-664252 30 MF459647 Erwinia phage vB_EamM_Joad, complete genome 184245-184274 5 0.833
NZ_CP050995_1 1.17|664223|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664223-664252 30 MF459646 Erwinia phage vB_EamM_RisingSun, complete genome 183992-184021 5 0.833
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MK496823 Capybara microvirus Cap3_SP_645, complete genome 237-266 5 0.833
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 MT135024 Vibrio phage V05, complete genome 81526-81555 5 0.833
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 216786-216815 5 0.833
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 184634-184663 6 0.8
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 59985-60014 6 0.8
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 MH617539 Inoviridae sp. isolate ctcf31, complete genome 2331-2360 6 0.8
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 GU071095 Synechococcus phage S-SM2, complete genome 67721-67750 6 0.8
NZ_CP050995_1 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663607-663636 30 MK448592 Streptococcus satellite phage Javan641, complete genome 9705-9734 6 0.8
NZ_CP050995_1 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663607-663636 30 MK448593 Streptococcus satellite phage Javan643, complete genome 9705-9734 6 0.8
NZ_CP050995_1 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663607-663636 30 MK448595 Streptococcus satellite phage Javan646, complete genome 9705-9734 6 0.8
NZ_CP050995_1 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663607-663636 30 MK448604 Streptococcus satellite phage Javan70, complete genome 12739-12768 6 0.8
NZ_CP050995_1 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663607-663636 30 MK448598 Streptococcus satellite phage Javan650, complete genome 9705-9734 6 0.8
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_AP017937 Leuconostoc mesenteroides strain LK-151 plasmid pLm151-a, complete sequence 6775-6804 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572495 Microviridae sp. isolate SD_HF_26, complete genome 237-266 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH992181 Apis mellifera associated microvirus 8 isolate INH_SP_151, complete genome 1512-1541 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 KT264772 Gokushovirus WZ-2015a isolate 24Fra20, complete genome 231-260 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 KT264771 Gokushovirus WZ-2015a isolate 23Fra13, complete genome 231-260 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572289 Microviridae sp. isolate SD_SC_80, complete genome 237-266 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572310 Microviridae sp. isolate SD_SC_21, complete genome 228-257 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572425 Microviridae sp. isolate SD_MC_58, complete genome 237-266 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH616929 Microviridae sp. isolate ctba61, complete genome 222-251 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617342 Microviridae sp. isolate ctbe47, complete genome 252-281 6 0.8
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945669 UNVERIFIED: Microviridae sp. isolate 698-1507, complete genome 1755-1784 6 0.8
NZ_CP050995_1 1.25|664839|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664839-664868 30 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 44260-44289 6 0.8
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 MF403008 Agrobacterium phage Atu_ph07, complete genome 338865-338894 6 0.8
NZ_CP050995_1 1.5|663299|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663299-663328 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 479157-479186 7 0.767
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 MG744354 Lactobacillus phage Satyr, complete genome 10563-10592 7 0.767
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 NC_047764 Lactobacillus phage P1, complete genome 66165-66194 7 0.767
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 KY381600 Lactobacillus phage P2, complete genome 69737-69766 7 0.767
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 MG765274 Lactobacillus phage Maenad, complete genome 9871-9900 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP023002 Bacillus anthracis strain 14RA5914 plasmid pX01, complete sequence 137559-137588 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_AP019732 Bacillus anthracis strain PCr plasmid PCr-pXO1 132166-132195 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP029324 Bacillus anthracis strain 17OD930 plasmid pXO1, complete sequence 155621-155650 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP007665 Bacillus anthracis str. Vollum plasmid unnamed, complete sequence 133490-133519 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009340 Bacillus anthracis strain Ohio ACB plasmid 1, complete sequence 8493-8522 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009696 Bacillus anthracis strain RA3 plasmid pXO1, complete sequence 128705-128734 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009463 Bacillus anthracis strain SK-102 plasmid pXO1, complete sequence 174561-174590 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009699 Bacillus anthracis strain BA1035 plasmid pXO1, complete sequence 137599-137628 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009540 Bacillus anthracis str. Sterne plasmid pXO1, complete sequence 106988-107017 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009324 Bacillus anthracis strain PAK-1 plasmid 1, complete sequence 131633-131662 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009980 Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed1, complete sequence 39303-39332 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP047132 Bacillus anthracis str. BF1 plasmid pXO1, complete sequence 154741-154770 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_KT186230 Bacillus anthracis strain P.NO2 plasmid pXO1, complete sequence 68500-68529 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_014331 Bacillus cereus biovar anthracis str. CI plasmid pCI-XO1, complete sequence 68460-68489 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP022045 Bacillus anthracis strain FDAARGOS_341 plasmid unnamed1, complete sequence 5344-5373 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_007322 Bacillus anthracis str. 'Ames Ancestor' plasmid pXO1, complete sequence 68435-68464 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_012579 Bacillus anthracis str. CDC 684 plasmid pX01, complete sequence 68741-68770 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP015777 Bacillus anthracis strain Tangail-1 plasmid pXO1, complete sequence 68435-68464 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP018904 Bacillus anthracis strain Tyrol 4675 plasmid pXO1, complete sequence 68539-68568 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_AP018444 Bacillus anthracis strain CZC5 plasmid pXO1, complete sequence 68519-68548 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_012656 Bacillus anthracis str. A0248 plasmid pXO1, complete sequence 68699-68728 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_010934 Bacillus cereus strain G9241 plasmid pBCXO1, complete sequence 126543-126572 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP019589 Bacillus anthracis strain SPV842_15 plasmid pX01, complete sequence 68435-68464 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP010853 Bacillus anthracis strain A1144 plasmid pXO1, complete sequence 68404-68433 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP008847 Bacillus anthracis strain HYU01 plasmid pX01, complete sequence 68509-68538 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP006743 Bacillus anthracis str. SVA11 plasmid pXO1, complete sequence 68424-68453 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_AP014834 Bacillus anthracis strain Shikan-NIID plasmid pXO1 68519-68548 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP029806 Bacillus anthracis strain London_499 plasmid pX01, complete sequence 67409-67438 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_001496 Bacillus anthracis virulence plasmid PX01, complete sequence 68384-68413 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NC_017726 Bacillus anthracis str. H9401 plasmid BAP1, complete sequence 68494-68523 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP014177 Bacillus anthracis strain Stendal plasmid pXO1, complete sequence 68435-68464 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009597 Bacillus anthracis str. V770-NP-1R plasmid pXO1, complete sequence 42106-42135 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009901 Bacillus anthracis strain 2002013094 plasmid pXO1, complete sequence 39345-39374 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009592 Bacillus cereus G9241 plasmid pBCX01, complete sequence 7913-7942 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009543 Bacillus anthracis strain BA1015 plasmid pXO1, complete sequence 155025-155054 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP010321 Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 1, complete sequence 136610-136639 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009330 Bacillus anthracis strain K3 plasmid 1, complete sequence 106311-106340 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP009327 Bacillus anthracis strain Vollum 1B plasmid 1, complete sequence 112236-112265 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP001975 Bacillus anthracis str. A16R plasmid pXO1, complete sequence 68520-68549 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP001971 Bacillus anthracis str. A16 plasmid pXO1, complete sequence 68520-68549 7 0.767
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 KT588072 Enterococcus phage IME-EFm5, complete genome 37585-37614 7 0.767
NZ_CP050995_1 1.23|664685|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664685-664714 30 NZ_CP007647 Lactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence 31768-31797 7 0.767
NZ_CP050995_1 1.23|664685|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664685-664714 30 NZ_LT604075 Lactobacillus salivarius isolate LPM01 plasmid II 174857-174886 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572429 Microviridae sp. isolate SD_MC_77, partial genome 246-275 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572504 Microviridae sp. isolate SD_HF_58, complete genome 240-269 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617527 Microviridae sp. isolate ctcg631, complete genome 237-266 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH616713 Microviridae sp. isolate ctca042, complete genome 237-266 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617260 Microviridae sp. isolate ctch792, complete genome 237-266 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945454 UNVERIFIED: Microviridae sp. isolate 8431-1602, complete genome 2148-2177 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 NC_027638 Microviridae Bog9017_22, complete genome 243-272 7 0.767
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945589 UNVERIFIED: Microviridae sp. isolate 4205-1801, complete genome 2211-2240 7 0.767
NZ_CP050995_1 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665224-665253 30 MN694046 Marine virus AFVG_250M906, complete genome 21300-21329 7 0.767
NZ_CP050995_1 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665224-665253 30 MH638311 Bacillus phage OmnioDeoPrimus, complete genome 42407-42436 7 0.767
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 NZ_KM260754 Saccharopolyspora endophytica strain YIM 61095 plasmid pCM32, complete sequence 14133-14162 7 0.767
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 231413-231442 7 0.767
NZ_CP050995_1 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665532-665561 30 MT310865 Streptomyces phage Bmoc, complete genome 90746-90775 7 0.767
NZ_CP050995_4 4.1|3828912|28|NZ_CP050995|CRISPRCasFinder 3828912-3828939 28 FR751545 Pantoea phage LIMEzero complete genome 41993-42020 7 0.75
NZ_CP050995_4 4.1|3828912|28|NZ_CP050995|CRISPRCasFinder 3828912-3828939 28 NC_015585 Pantoea phage LIMEzero, complete genome 41993-42020 7 0.75
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 NZ_CP015777 Bacillus anthracis strain Tangail-1 plasmid pXO1, complete sequence 116521-116550 8 0.733
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 MF417940 Uncultured Caudovirales phage clone 3S_8, partial genome 13369-13398 8 0.733
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 MK448917 Streptococcus phage Javan362, complete genome 28262-28291 8 0.733
NZ_CP050995_1 1.1|662991|30|NZ_CP050995|CRISPRCasFinder 662991-663020 30 MK448740 Streptococcus phage Javan367, complete genome 28640-28669 8 0.733
NZ_CP050995_1 1.2|663068|30|NZ_CP050995|CRISPRCasFinder 663068-663097 30 NC_011259 Borrelia duttonii Ly plasmid pl23b, complete sequence 18789-18818 8 0.733
NZ_CP050995_1 1.2|663068|30|NZ_CP050995|CRISPRCasFinder 663068-663097 30 NZ_CP048608 Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence 44747-44776 8 0.733
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 NZ_LR214999 Mycoplasma conjunctivae strain NCTC10147 plasmid 3 82461-82490 8 0.733
NZ_CP050995_1 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663376-663405 30 LR214965 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11 72053-72082 8 0.733
NZ_CP050995_1 1.8|663530|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663530-663559 30 MN694537 Marine virus AFVG_250M1002, complete genome 8374-8403 8 0.733
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_KX258624 Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence 95180-95209 8 0.733
NZ_CP050995_1 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664146-664175 30 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 337843-337872 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617597 Microviridae sp. isolate ctbe632, complete genome 243-272 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572293 Microviridae sp. isolate SD_SC_89, complete genome 246-275 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617216 Microviridae sp. isolate ctcb794, complete genome 237-266 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945481 UNVERIFIED: Microviridae sp. isolate 819-1801, complete genome 1882-1911 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572382 Microviridae sp. isolate SD_SF_34, complete genome 246-275 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617418 Microviridae sp. isolate ctbb991, complete genome 237-266 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MN830257 Lactobacillus phage JNU_P11, complete genome 2018-2047 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MG945827 UNVERIFIED: Microviridae sp. isolate 8449-1602, complete genome 2167-2196 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MK765620 Tortoise microvirus 68 isolate 68_SP_146, complete genome 234-263 8 0.733
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH617417 Microviridae sp. isolate ctce43, complete genome 252-281 8 0.733
NZ_CP050995_1 1.26|664916|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664916-664945 30 MG250483 Aeromonas phage Ah1, complete genome 6695-6724 8 0.733
NZ_CP050995_1 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665070-665099 30 NZ_CP045357 Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence 289022-289051 8 0.733
NZ_CP050995_1 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665070-665099 30 NZ_CP046164 Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence 291136-291165 8 0.733
NZ_CP050995_1 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665070-665099 30 NZ_CP046067 Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence 39635-39664 8 0.733
NZ_CP050995_1 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665147-665176 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1649419-1649448 8 0.733
NZ_CP050995_1 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665224-665253 30 MK577502 Aeromonas phage Asfd_1, partial genome 168765-168794 8 0.733
NZ_CP050995_1 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665224-665253 30 MN871507 UNVERIFIED: Aeromonas phage asfd_1h, complete genome 117307-117336 8 0.733
NZ_CP050995_1 1.32|665378|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665378-665407 30 MH617623 Microviridae sp. isolate ctca762, complete genome 3847-3876 8 0.733
NZ_CP050995_1 1.10|663684|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663684-663713 30 NZ_AP019370 Silvanigrellales bacterium RF1110005 plasmid 68K, complete sequence 7435-7464 9 0.7
NZ_CP050995_1 1.10|663684|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663684-663713 30 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 65335-65364 9 0.7
NZ_CP050995_1 1.20|664454|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664454-664483 30 NC_049851 Burkholderia phage BcepSauron, complete genome 260124-260153 9 0.7
NZ_CP050995_1 1.20|664454|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664454-664483 30 NC_049850 Burkholderia phage BcepSaruman, complete genome 261206-261235 9 0.7
NZ_CP050995_1 1.21|664531|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664531-664560 30 NC_049851 Burkholderia phage BcepSauron, complete genome 260124-260153 9 0.7
NZ_CP050995_1 1.21|664531|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664531-664560 30 NC_049850 Burkholderia phage BcepSaruman, complete genome 261206-261235 9 0.7
NZ_CP050995_1 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 664762-664791 30 MH572521 Microviridae sp. isolate SD_HF_44, complete genome 177-206 9 0.7
NZ_CP050995_1 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665147-665176 30 NZ_CP024184 Moraxella osloensis strain KSH plasmid p4, complete sequence 26132-26161 9 0.7
NZ_CP050995_1 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665147-665176 30 NZ_CP024447 Moraxella osloensis strain NP7 plasmid pNP7-4, complete sequence 56623-56652 9 0.7
NZ_CP050995_1 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665147-665176 30 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 68183-68212 9 0.7
NZ_CP050995_1 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665147-665176 30 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 68151-68180 9 0.7
NZ_CP050995_1 1.33|665455|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 665455-665484 30 JQ680360 Unidentified phage clone 2016_scaffold57 genomic sequence 19135-19164 9 0.7
NZ_CP050995_1 1.11|663761|30|NZ_CP050995|CRISPRCasFinder,PILER-CR 663761-663790 30 MN855961 Bacteriophage sp. isolate 145, complete genome 11220-11249 10 0.667

1. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945672 (UNVERIFIED: Microviridae sp. isolate 784-1602, complete genome) position: , mismatch: 4, identity: 0.867

acactttttctttgtacctaatcgtatcct	CRISPR spacer
atactttttctttgtacctaatcgtttaat	Protospacer
*.*********************** *  *

2. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 5, identity: 0.833

tgat-tcataccattgttttttaaaatcagt	CRISPR spacer
-gatatcatacaattcttttttaaaatcatc	Protospacer
 *** ****** *** ************* .

3. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to KC847113 (Bacillus phage PBP180, complete sequence) position: , mismatch: 5, identity: 0.833

tgattcatacca---ttgttttttaaaatcagt	CRISPR spacer
tgattcataccattgttgttttttcacatc---	Protospacer
************   ********* * ***   

4. spacer 1.17|664223|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MF459647 (Erwinia phage vB_EamM_Joad, complete genome) position: , mismatch: 5, identity: 0.833

agcgttttcgctatcctctacaccgtttac-	CRISPR spacer
agcgttttggctatcctcgaca-cattgaca	Protospacer
******** ********* *** *.** ** 

5. spacer 1.17|664223|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MF459646 (Erwinia phage vB_EamM_RisingSun, complete genome) position: , mismatch: 5, identity: 0.833

agcgttttcgctatcctctacaccgtttac-	CRISPR spacer
agcgttttggctatcctcgaca-cattgaca	Protospacer
******** ********* *** *.** ** 

6. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK496823 (Capybara microvirus Cap3_SP_645, complete genome) position: , mismatch: 5, identity: 0.833

acactttttctttgtacctaatcgtatcct	CRISPR spacer
attctttttctttgtacctaatcgtttggt	Protospacer
*. ********************** *  *

7. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MT135024 (Vibrio phage V05, complete genome) position: , mismatch: 5, identity: 0.833

aggttcgaatcccgtattctccacaaatat	CRISPR spacer
tggttcgaatcccgtactctccaccacttt	Protospacer
 ***************.******* * * *

8. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 5, identity: 0.833

aggttcgaatcccgtattctccacaaatat-	CRISPR spacer
gggttcgaatcccatactctccac-catata	Protospacer
.************.**.*******  **** 

9. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 6, identity: 0.8

catattttc-aattcaaaaaagcaggggtta	CRISPR spacer
-gtatttttaaattcaaaaaagtagggggga	Protospacer
 .******. ************.*****  *

10. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 6, identity: 0.8

catattttcaattcaaaaaagcaggggtta	CRISPR spacer
caaaactaaaatacaaaaaagcaggggtta	Protospacer
** * .*  *** *****************

11. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617539 (Inoviridae sp. isolate ctcf31, complete genome) position: , mismatch: 6, identity: 0.8

gaattattacaatcaaactcagat-taattc	CRISPR spacer
aaattattactatcaaattcagatgttact-	Protospacer
.********* ******.****** * *.* 

12. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to GU071095 (Synechococcus phage S-SM2, complete genome) position: , mismatch: 6, identity: 0.8

gaattattacaatcaaactcagattaattc	CRISPR spacer
gaattattaaaatcaaactcatcttggttt	Protospacer
********* ***********  **..**.

13. spacer 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK448592 (Streptococcus satellite phage Javan641, complete genome) position: , mismatch: 6, identity: 0.8

--tgcgatttgtagcttatcatctacgctatt	CRISPR spacer
gttacg--ctgtagtttatcatctaggctatt	Protospacer
  *.**  .*****.********** ******

14. spacer 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK448593 (Streptococcus satellite phage Javan643, complete genome) position: , mismatch: 6, identity: 0.8

--tgcgatttgtagcttatcatctacgctatt	CRISPR spacer
gttacg--ctgtagtttatcatctaggctatt	Protospacer
  *.**  .*****.********** ******

15. spacer 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK448595 (Streptococcus satellite phage Javan646, complete genome) position: , mismatch: 6, identity: 0.8

--tgcgatttgtagcttatcatctacgctatt	CRISPR spacer
gttacg--ctgtagtttatcatctaggctatt	Protospacer
  *.**  .*****.********** ******

16. spacer 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK448604 (Streptococcus satellite phage Javan70, complete genome) position: , mismatch: 6, identity: 0.8

--tgcgatttgtagcttatcatctacgctatt	CRISPR spacer
gttacg--ctgtagtttatcatctaggctatt	Protospacer
  *.**  .*****.********** ******

17. spacer 1.9|663607|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK448598 (Streptococcus satellite phage Javan650, complete genome) position: , mismatch: 6, identity: 0.8

--tgcgatttgtagcttatcatctacgctatt	CRISPR spacer
gttacg--ctgtagtttatcatctaggctatt	Protospacer
  *.**  .*****.********** ******

18. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_AP017937 (Leuconostoc mesenteroides strain LK-151 plasmid pLm151-a, complete sequence) position: , mismatch: 6, identity: 0.8

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tatctcataacattgttttttaaactcact	Protospacer
*. .***** ************** *** *

19. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572495 (Microviridae sp. isolate SD_HF_26, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgtacctaatcgtcttat	Protospacer
 . ********************** *. *

20. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH992181 (Apis mellifera associated microvirus 8 isolate INH_SP_151, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgtacctaatcgtcttat	Protospacer
 . ********************** *. *

21. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to KT264772 (Gokushovirus WZ-2015a isolate 24Fra20, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttactttttctttgttccgaatcgtattgt	Protospacer
 .************* ** ********. *

22. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to KT264771 (Gokushovirus WZ-2015a isolate 23Fra13, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttactttttctttgttccgaatcgtattgt	Protospacer
 .************* ** ********. *

23. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572289 (Microviridae sp. isolate SD_SC_80, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
attctttttctttgttcctaatcgtttagt	Protospacer
*. ************ ********* *  *

24. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572310 (Microviridae sp. isolate SD_SC_21, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gcacttcttctttgttcctaatcgtctagt	Protospacer
.*****.******** ********* *  *

25. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572425 (Microviridae sp. isolate SD_MC_58, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
attctttttctttgttcctaatcgtttggt	Protospacer
*. ************ ********* *  *

26. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH616929 (Microviridae sp. isolate ctba61, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tcacttcttctttgtacctaaccgtctagt	Protospacer
 *****.**************.*** *  *

27. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617342 (Microviridae sp. isolate ctbe47, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
attctttttcttcgtaccaaatcgtattat	Protospacer
*. *********.***** ********. *

28. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945669 (UNVERIFIED: Microviridae sp. isolate 698-1507, complete genome) position: , mismatch: 6, identity: 0.8

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gcagtttttctttgttcctaatcgattgct	Protospacer
.** *********** ********  * **

29. spacer 1.25|664839|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 6, identity: 0.8

atgttgatcaggtaggtaaagcaagtattg	CRISPR spacer
atttaaatcagttagttaaagcaagtattt	Protospacer
** * .***** *** ************* 

30. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MF403008 (Agrobacterium phage Atu_ph07, complete genome) position: , mismatch: 6, identity: 0.8

aggttcgaatcccgtattctccacaaatat---	CRISPR spacer
cggttcgattccggtattctccac---tatgta	Protospacer
 ******* *** ***********   ***   

31. spacer 1.5|663299|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.767

taaatatggaaatgcctgtgccgtgcccca	CRISPR spacer
tcctgacggaaatgcctgtgccgtgccctt	Protospacer
*    *.*********************. 

32. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG744354 (Lactobacillus phage Satyr, complete genome) position: , mismatch: 7, identity: 0.767

gaattattacaatcaaactcagattaattc	CRISPR spacer
aagttattaaaatcaaacttagattatgac	Protospacer
.*.****** *********.******   *

33. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_047764 (Lactobacillus phage P1, complete genome) position: , mismatch: 7, identity: 0.767

gaattattacaatcaaactcagattaattc	CRISPR spacer
aagttattaaaatcaaacttagattatgac	Protospacer
.*.****** *********.******   *

34. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to KY381600 (Lactobacillus phage P2, complete genome) position: , mismatch: 7, identity: 0.767

gaattattacaatcaaactcagattaattc	CRISPR spacer
aagttattaaaatcaaacttagattatgac	Protospacer
.*.****** *********.******   *

35. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG765274 (Lactobacillus phage Maenad, complete genome) position: , mismatch: 7, identity: 0.767

gaattattacaatcaaactcagattaattc	CRISPR spacer
aagttattaaaatcaaacttagattatgac	Protospacer
.*.****** *********.******   *

36. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP023002 (Bacillus anthracis strain 14RA5914 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

37. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_AP019732 (Bacillus anthracis strain PCr plasmid PCr-pXO1) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

38. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP029324 (Bacillus anthracis strain 17OD930 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

39. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP007665 (Bacillus anthracis str. Vollum plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

40. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009340 (Bacillus anthracis strain Ohio ACB plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

41. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009696 (Bacillus anthracis strain RA3 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

42. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009463 (Bacillus anthracis strain SK-102 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

43. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009699 (Bacillus anthracis strain BA1035 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

44. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009540 (Bacillus anthracis str. Sterne plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

45. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009324 (Bacillus anthracis strain PAK-1 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

46. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009980 (Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

47. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP047132 (Bacillus anthracis str. BF1 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

48. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_KT186230 (Bacillus anthracis strain P.NO2 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

49. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_014331 (Bacillus cereus biovar anthracis str. CI plasmid pCI-XO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

50. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP022045 (Bacillus anthracis strain FDAARGOS_341 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

51. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_007322 (Bacillus anthracis str. 'Ames Ancestor' plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

52. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_012579 (Bacillus anthracis str. CDC 684 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

53. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP015777 (Bacillus anthracis strain Tangail-1 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

54. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP018904 (Bacillus anthracis strain Tyrol 4675 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

55. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_AP018444 (Bacillus anthracis strain CZC5 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

56. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_012656 (Bacillus anthracis str. A0248 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

57. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_010934 (Bacillus cereus strain G9241 plasmid pBCXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

58. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP019589 (Bacillus anthracis strain SPV842_15 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

59. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP010853 (Bacillus anthracis strain A1144 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

60. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP008847 (Bacillus anthracis strain HYU01 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

61. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP006743 (Bacillus anthracis str. SVA11 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

62. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_AP014834 (Bacillus anthracis strain Shikan-NIID plasmid pXO1) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

63. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP029806 (Bacillus anthracis strain London_499 plasmid pX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

64. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_001496 (Bacillus anthracis virulence plasmid PX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

65. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_017726 (Bacillus anthracis str. H9401 plasmid BAP1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

66. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP014177 (Bacillus anthracis strain Stendal plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

67. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009597 (Bacillus anthracis str. V770-NP-1R plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

68. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009901 (Bacillus anthracis strain 2002013094 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

69. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009592 (Bacillus cereus G9241 plasmid pBCX01, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

70. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009543 (Bacillus anthracis strain BA1015 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

71. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP010321 (Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

72. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009330 (Bacillus anthracis strain K3 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

73. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP009327 (Bacillus anthracis strain Vollum 1B plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

74. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP001975 (Bacillus anthracis str. A16R plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

75. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP001971 (Bacillus anthracis str. A16 plasmid pXO1, complete sequence) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaaatcagt	CRISPR spacer
tgattcataccattctttattaaaagtgaa	Protospacer
************** *** ****** ... 

76. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to KT588072 (Enterococcus phage IME-EFm5, complete genome) position: , mismatch: 7, identity: 0.767

tgattcataccattgttttttaaa--atcagt	CRISPR spacer
ccattgataccattgatttttaaaagacca--	Protospacer
. *** ********* ********  *.**  

77. spacer 1.23|664685|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP007647 (Lactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence) position: , mismatch: 7, identity: 0.767

aattatgtcaattttttcaaaagtgtcgat	CRISPR spacer
gattctgtcaattttttcaaaactggaatt	Protospacer
.*** ***************** **  . *

78. spacer 1.23|664685|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_LT604075 (Lactobacillus salivarius isolate LPM01 plasmid II) position: , mismatch: 7, identity: 0.767

aattatgtcaattttttcaaaagtgtcgat	CRISPR spacer
gattctgtcaattttttcaaaactggaatt	Protospacer
.*** ***************** **  . *

79. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572429 (Microviridae sp. isolate SD_MC_77, partial genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
cttctttttctttgtacctaatcgattagt	Protospacer
 . *********************  *  *

80. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572504 (Microviridae sp. isolate SD_HF_58, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
cttctttttctttgtaccgaatcgtttggt	Protospacer
 . *************** ****** *  *

81. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617527 (Microviridae sp. isolate ctcg631, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgttcctaatcgtctggt	Protospacer
 . ************ ********* *  *

82. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH616713 (Microviridae sp. isolate ctca042, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gttctttttctttgttcctaatcgtttagt	Protospacer
.. ************ ********* *  *

83. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617260 (Microviridae sp. isolate ctch792, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgttcctaatcgtcttgt	Protospacer
 . ************ ********* *. *

84. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945454 (UNVERIFIED: Microviridae sp. isolate 8431-1602, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gtattatttctttgttcctaatcgtattgt	Protospacer
..*.* ********* ***********. *

85. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_027638 (Microviridae Bog9017_22, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tgagtatttctttgtccctaatcgtatttt	Protospacer
  * * ********* ***********..*

86. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945589 (UNVERIFIED: Microviridae sp. isolate 4205-1801, complete genome) position: , mismatch: 7, identity: 0.767

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttactatttctttgtgcctaatcgtcttgt	Protospacer
 .*** *********.********* *. *

87. spacer 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN694046 (Marine virus AFVG_250M906, complete genome) position: , mismatch: 7, identity: 0.767

aatttgctttgttgataaactggtcttcag	CRISPR spacer
tttatgcttttttgataacctggtcttctt	Protospacer
  * ****** ******* *********  

88. spacer 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH638311 (Bacillus phage OmnioDeoPrimus, complete genome) position: , mismatch: 7, identity: 0.767

aatttgctttgttgataaactggtcttcag	CRISPR spacer
atgcttctttgtcgataaacaggtcttcac	Protospacer
*  .* ******.******* ******** 

89. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_KM260754 (Saccharopolyspora endophytica strain YIM 61095 plasmid pCM32, complete sequence) position: , mismatch: 7, identity: 0.767

aggttcgaatcccgtattctccacaaatat	CRISPR spacer
gggttcgaatcccgtatcctccgcaggtca	Protospacer
.****************.****.**..*  

90. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aggttcgaatcccgtattctccacaaatat	CRISPR spacer
gggttcgaatccccgattctccaccatgac	Protospacer
.************  ********* *  *.

91. spacer 1.34|665532|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MT310865 (Streptomyces phage Bmoc, complete genome) position: , mismatch: 7, identity: 0.767

aggttcgaatcccgtattctccacaaatat	CRISPR spacer
gggttcgaatcccatcttctccacgcagtt	Protospacer
.************.* ********. *  *

92. spacer 4.1|3828912|28|NZ_CP050995|CRISPRCasFinder matches to FR751545 (Pantoea phage LIMEzero complete genome) position: , mismatch: 7, identity: 0.75

gcattagctgcaggaccgacaccaacac	CRISPR spacer
gctttagctgcagtaccgacaccggagt	Protospacer
** ********** *********.. ..

93. spacer 4.1|3828912|28|NZ_CP050995|CRISPRCasFinder matches to NC_015585 (Pantoea phage LIMEzero, complete genome) position: , mismatch: 7, identity: 0.75

gcattagctgcaggaccgacaccaacac	CRISPR spacer
gctttagctgcagtaccgacaccggagt	Protospacer
** ********** *********.. ..

94. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to NZ_CP015777 (Bacillus anthracis strain Tangail-1 plasmid pXO1, complete sequence) position: , mismatch: 8, identity: 0.733

catattttcaattcaaaaaagcaggggtta	CRISPR spacer
tatattttcatttcaataaagcagtaactt	Protospacer
.********* ***** ******* ...* 

95. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to MF417940 (Uncultured Caudovirales phage clone 3S_8, partial genome) position: , mismatch: 8, identity: 0.733

catattttcaattcaaaaaagcaggggtta	CRISPR spacer
ttgaaattaaatttaaaaaagcaggggttt	Protospacer
.  *  ** ****.*************** 

96. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to MK448917 (Streptococcus phage Javan362, complete genome) position: , mismatch: 8, identity: 0.733

catattttcaattcaaaaaagcaggggtta	CRISPR spacer
ttgaaattaaatttaaaaaagcaggggttt	Protospacer
.  *  ** ****.*************** 

97. spacer 1.1|662991|30|NZ_CP050995|CRISPRCasFinder matches to MK448740 (Streptococcus phage Javan367, complete genome) position: , mismatch: 8, identity: 0.733

catattttcaattcaaaaaagcaggggtta	CRISPR spacer
ttgaaattaaatttaaaaaagcaggggttt	Protospacer
.  *  ** ****.*************** 

98. spacer 1.2|663068|30|NZ_CP050995|CRISPRCasFinder matches to NC_011259 (Borrelia duttonii Ly plasmid pl23b, complete sequence) position: , mismatch: 8, identity: 0.733

atggagcatggtcactttgggtaaaggatt	CRISPR spacer
gagtgagatggtaaatttgggtaaaggatt	Protospacer
. * .. ***** * ***************

99. spacer 1.2|663068|30|NZ_CP050995|CRISPRCasFinder matches to NZ_CP048608 (Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

atggagcatggtcactttgggtaaaggatt	CRISPR spacer
cgcaaacatggtcactctgcgtaaaggatc	Protospacer
   .*.**********.** *********.

100. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_LR214999 (Mycoplasma conjunctivae strain NCTC10147 plasmid 3) position: , mismatch: 8, identity: 0.733

gaattattacaatcaaactcagattaattc	CRISPR spacer
aaatcattaaaatcaaactcagatgatgct	Protospacer
.***.**** ************** *  ..

101. spacer 1.6|663376|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to LR214965 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11) position: , mismatch: 8, identity: 0.733

gaattattacaatcaaactcagattaattc	CRISPR spacer
aaatcattaaaatcaaactcagatgatgct	Protospacer
.***.**** ************** *  ..

102. spacer 1.8|663530|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN694537 (Marine virus AFVG_250M1002, complete genome) position: , mismatch: 8, identity: 0.733

agaaccttgtctcctttcacatatttcctc	CRISPR spacer
ctcatactttctcctttctcatatttcctc	Protospacer
   *. .* ********* ***********

103. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 8, identity: 0.733

tgattcataccattgttttttaaaatcagt	CRISPR spacer
agattcataccattctttattaaaagtgaa	Protospacer
 ************* *** ****** ... 

104. spacer 1.16|664146|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 8, identity: 0.733

tgattcataccattgttttttaaaatcagt	CRISPR spacer
agattcataccattctttattaaaagtgaa	Protospacer
 ************* *** ****** ... 

105. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617597 (Microviridae sp. isolate ctbe632, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgttcctaatcgtctgac	Protospacer
 . ************ ********* *  .

106. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572293 (Microviridae sp. isolate SD_SC_89, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
cttctttttctttgtacccaatcggttagt	Protospacer
 . ***************.*****  *  *

107. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617216 (Microviridae sp. isolate ctcb794, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gttttttttctttgttcctaatcgtttagt	Protospacer
.. .*********** ********* *  *

108. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945481 (UNVERIFIED: Microviridae sp. isolate 819-1801, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttactatttctttgttcctaatcgtctttc	Protospacer
 .*** ********* ********* *...

109. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572382 (Microviridae sp. isolate SD_SF_34, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
cttctttttctttgtaccgaatcgattagt	Protospacer
 . *************** *****  *  *

110. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617418 (Microviridae sp. isolate ctbb991, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
tttctttttctttgttcctaatcgccttgt	Protospacer
 . ************ ********. *. *

111. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN830257 (Lactobacillus phage JNU_P11, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ctactttttctttgaatctaatcgttttag	Protospacer
 .************ *.******** *.  

112. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG945827 (UNVERIFIED: Microviridae sp. isolate 8449-1602, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
cttctttttctttgttcctaatcgccttat	Protospacer
 . ************ ********. *. *

113. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK765620 (Tortoise microvirus 68 isolate 68_SP_146, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttattttttctttgtgcctaatcgtcttac	Protospacer
 .*.***********.********* *. .

114. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617417 (Microviridae sp. isolate ctce43, complete genome) position: , mismatch: 8, identity: 0.733

acactttttctttgtacctaatcgtatcct	CRISPR spacer
gttctttttctttgtaccaaatcgacttat	Protospacer
.. *************** *****  *. *

115. spacer 1.26|664916|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MG250483 (Aeromonas phage Ah1, complete genome) position: , mismatch: 8, identity: 0.733

caacctaa----tcaagtccaatttgatcttgaa	CRISPR spacer
----ctgggatttcaagtcaaatttgatcttgat	Protospacer
    **..    ******* ************* 

116. spacer 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP045357 (Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence) position: , mismatch: 8, identity: 0.733

agatgcaatcaacaataatatgtcttctcc	CRISPR spacer
aagccaaatcaacaataatatggcttcgct	Protospacer
*...  **************** **** *.

117. spacer 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP046164 (Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence) position: , mismatch: 8, identity: 0.733

agatgcaatcaacaataatatgtcttctcc	CRISPR spacer
aagccaaatcaacaataatatggcttcgct	Protospacer
*...  **************** **** *.

118. spacer 1.28|665070|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP046067 (Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence) position: , mismatch: 8, identity: 0.733

agatgcaatcaacaataatatgtcttctcc	CRISPR spacer
aagccaaatcaacaataatatggcttcgct	Protospacer
*...  **************** **** *.

119. spacer 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.733

tgcgattgacttcgggtggactgcgccgac	CRISPR spacer
tggaattgacttcgggtggacagcggaagt	Protospacer
** .***************** ***  ...

120. spacer 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MK577502 (Aeromonas phage Asfd_1, partial genome) position: , mismatch: 8, identity: 0.733

aatttgctttgttgataaactggtcttcag	CRISPR spacer
gatttgctttgttgatgacctggtaagtaa	Protospacer
.***************.* *****   .*.

121. spacer 1.30|665224|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN871507 (UNVERIFIED: Aeromonas phage asfd_1h, complete genome) position: , mismatch: 8, identity: 0.733

aatttgctttgttgataaactggtcttcag	CRISPR spacer
gatttgctttgttgatgacctggtaagtaa	Protospacer
.***************.* *****   .*.

122. spacer 1.32|665378|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH617623 (Microviridae sp. isolate ctca762, complete genome) position: , mismatch: 8, identity: 0.733

tataaccaatacaaggaggacattcacaat	CRISPR spacer
ataaaacaatacaaggagtacattcaatgt	Protospacer
   ** ************ *******  .*

123. spacer 1.10|663684|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_AP019370 (Silvanigrellales bacterium RF1110005 plasmid 68K, complete sequence) position: , mismatch: 9, identity: 0.7

aaatcaagcagaaggagcagattggttaat	CRISPR spacer
ttccaaagcagaaggagcagattttttagc	Protospacer
   . ******************  ***..

124. spacer 1.10|663684|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7

aaatcaagcagaaggagcagattggttaat	CRISPR spacer
tgctcaagcaggaggagcagattgatgtgc	Protospacer
 . ********.************.*  ..

125. spacer 1.20|664454|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 9, identity: 0.7

tcatggcgtcttctcccatcgatttgattc	CRISPR spacer
cttcttcgtcttctcccatcaattcgattt	Protospacer
.. .  **************.***.****.

126. spacer 1.20|664454|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 9, identity: 0.7

tcatggcgtcttctcccatcgatttgattc	CRISPR spacer
cttcttcgtcttctcccatcaattcgattt	Protospacer
.. .  **************.***.****.

127. spacer 1.21|664531|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 9, identity: 0.7

tcatggcgtcttctcccatcgatttgattc	CRISPR spacer
cttcttcgtcttctcccatcaattcgattt	Protospacer
.. .  **************.***.****.

128. spacer 1.21|664531|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 9, identity: 0.7

tcatggcgtcttctcccatcgatttgattc	CRISPR spacer
cttcttcgtcttctcccatcaattcgattt	Protospacer
.. .  **************.***.****.

129. spacer 1.24|664762|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MH572521 (Microviridae sp. isolate SD_HF_44, complete genome) position: , mismatch: 9, identity: 0.7

acactttttctttgtacctaatcgtatcct	CRISPR spacer
ttttcacttctttgttccaaatcgtatcct	Protospacer
 . .. .******** ** ***********

130. spacer 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP024184 (Moraxella osloensis strain KSH plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.7

tgcgattgacttcgggtggactgcgccgac	CRISPR spacer
aagtattgacttggggtggactgcgaggcg	Protospacer
 .  ******** ************  *  

131. spacer 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP024447 (Moraxella osloensis strain NP7 plasmid pNP7-4, complete sequence) position: , mismatch: 9, identity: 0.7

tgcgattgacttcgggtggactgcgccgac	CRISPR spacer
aagtattgacttggggtggactgcgaggcg	Protospacer
 .  ******** ************  *  

132. spacer 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcgattgacttcgggtggactgcgccgac	CRISPR spacer
aagtattgacttggggtggactgcgaggcg	Protospacer
 .  ******** ************  *  

133. spacer 1.29|665147|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcgattgacttcgggtggactgcgccgac	CRISPR spacer
aagtattgacttggggtggactgcgaggcg	Protospacer
 .  ******** ************  *  

134. spacer 1.33|665455|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to JQ680360 (Unidentified phage clone 2016_scaffold57 genomic sequence) position: , mismatch: 9, identity: 0.7

ttcatgctccgagttcataattcagaatta	CRISPR spacer
nnnnnnctccgatttcataattcagaactt	Protospacer
      ****** **************.* 

135. spacer 1.11|663761|30|NZ_CP050995|CRISPRCasFinder,PILER-CR matches to MN855961 (Bacteriophage sp. isolate 145, complete genome) position: , mismatch: 10, identity: 0.667

ccagctttagaaattccttcaccatacatg	CRISPR spacer
aagtctttagaaataccttcaccattagaa	Protospacer
  . ********** **********  . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4151 3 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_2 9596 : 13233 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_3 33686 : 35582 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_4 51874 : 54073 1 Feldmannia_irregularis_virus(100.0%) NA NA
DBSCAN-SWA_5 64433 : 74429 12 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_6 78156 : 83588 6 EBPR_siphovirus(33.33%) NA NA
DBSCAN-SWA_7 94225 : 95983 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_8 99507 : 100302 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_9 116404 : 119270 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_10 124060 : 125644 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_11 141042 : 146529 4 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_12 163247 : 164252 1 Acidianus_two-tailed_virus(100.0%) NA NA
DBSCAN-SWA_13 179509 : 180169 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 183417 : 184059 1 Sphenicid_alphaherpesvirus(100.0%) NA NA
DBSCAN-SWA_15 187493 : 188273 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_16 192196 : 193966 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_17 205303 : 208002 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_18 225701 : 226820 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_19 266178 : 270726 4 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_20 281290 : 284944 2 Liberibacter_phage(50.0%) NA NA
DBSCAN-SWA_21 295838 : 307167 2 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 319787 : 324411 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_23 335558 : 341754 5 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_24 366974 : 371806 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_25 394820 : 397136 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_26 406359 : 415138 9 Pacmanvirus(25.0%) transposase NA
DBSCAN-SWA_27 418864 : 419377 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_28 465648 : 468705 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_29 475375 : 476407 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_30 522856 : 523471 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_31 538688 : 539729 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_32 557600 : 563030 5 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_33 589958 : 590792 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_34 594055 : 603243 8 Hokovirus(20.0%) NA NA
DBSCAN-SWA_35 606421 : 607360 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_36 637160 : 640072 2 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_37 669794 : 672462 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_38 678140 : 689381 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_39 704450 : 706625 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_40 718255 : 724895 5 Tetraselmis_virus(33.33%) NA NA
DBSCAN-SWA_41 729387 : 732573 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_42 748804 : 752221 4 Pseudoalteromonas_phage(33.33%) tRNA NA
DBSCAN-SWA_43 767571 : 768987 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_44 773920 : 775189 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_45 797039 : 801988 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_46 814909 : 815524 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_47 857787 : 860619 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_48 863893 : 866488 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_49 877367 : 879083 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_50 886744 : 887665 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_51 895423 : 896461 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_52 902693 : 903503 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_53 914869 : 915736 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_54 920380 : 921544 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_55 929074 : 931867 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_56 935082 : 935529 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_57 939880 : 940345 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_58 943495 : 944419 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_59 958897 : 961450 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_60 975116 : 976442 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_61 995458 : 998068 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_62 1010499 : 1011429 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_63 1026966 : 1030629 3 Mycobacterium_phage(33.33%) tRNA NA
DBSCAN-SWA_64 1039829 : 1040297 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_65 1049234 : 1052690 3 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_66 1069719 : 1070328 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_67 1086391 : 1087195 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_68 1106484 : 1107777 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_69 1130578 : 1132159 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_70 1145203 : 1146337 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_71 1149648 : 1153167 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_72 1160649 : 1166455 5 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_73 1172044 : 1178529 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_74 1184871 : 1185483 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_75 1190540 : 1191209 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_76 1197547 : 1201566 3 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_77 1212525 : 1213959 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_78 1219232 : 1221392 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_79 1234592 : 1235399 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_80 1246988 : 1249355 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_81 1256217 : 1256526 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_82 1260418 : 1262561 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_83 1269650 : 1270715 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_84 1282107 : 1282524 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_85 1286231 : 1287317 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_86 1310170 : 1311211 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_87 1321654 : 1327125 3 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_88 1336900 : 1339468 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_89 1345317 : 1347567 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_90 1360206 : 1360833 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_91 1372041 : 1373784 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_92 1382408 : 1426646 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_93 1444898 : 1446611 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_94 1450366 : 1465027 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_95 1469607 : 1470549 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_96 1475355 : 1477221 3 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_97 1489112 : 1491287 2 Halovirus(50.0%) NA NA
DBSCAN-SWA_98 1497048 : 1498188 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_99 1505469 : 1516718 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_100 1522517 : 1529199 4 Helicoverpa_zea_nudivirus(50.0%) NA NA
DBSCAN-SWA_101 1542288 : 1545848 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_102 1555903 : 1559064 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_103 1565134 : 1568457 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_104 1583255 : 1585292 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_105 1605434 : 1607066 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_106 1610821 : 1612286 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_107 1617448 : 1620074 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_108 1642872 : 1644807 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_109 1647936 : 1649634 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_110 1654473 : 1656962 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_111 1666136 : 1670354 5 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_112 1694162 : 1698392 3 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_113 1714592 : 1716395 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_114 1724870 : 1725866 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_115 1732142 : 1735359 2 Campylobacter_virus(50.0%) NA NA
DBSCAN-SWA_116 1773177 : 1776443 3 Cassava_brown_streak_virus(50.0%) protease NA
DBSCAN-SWA_117 1779657 : 1784380 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_118 1792691 : 1797359 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_119 1805167 : 1806172 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_120 1812066 : 1813542 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_121 1817264 : 1818380 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_122 1822710 : 1825083 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_123 1828840 : 1831444 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_124 1842459 : 1844184 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_125 1858717 : 1861501 2 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_126 1872696 : 1874043 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_127 1883006 : 1884389 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_128 1888493 : 1892650 6 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_129 1916786 : 1918154 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_130 1937546 : 1938167 1 Salicola_phage(100.0%) NA NA
DBSCAN-SWA_131 1950562 : 1960562 8 Cafeteria_roenbergensis_virus(25.0%) NA NA
DBSCAN-SWA_132 1970890 : 1972186 1 Pectobacterium_phage(100.0%) tRNA NA
DBSCAN-SWA_133 1978949 : 1979588 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_134 1987727 : 1996426 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_135 2000021 : 2034473 6 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_136 2038569 : 2040146 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_137 2045671 : 2047378 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_138 2051425 : 2059932 8 Leptospira_phage(16.67%) NA NA
DBSCAN-SWA_139 2063162 : 2064467 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_140 2083736 : 2087768 3 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_141 2094939 : 2095923 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_142 2100588 : 2101098 1 Staphylococcus_virus(100.0%) NA NA
DBSCAN-SWA_143 2116437 : 2117151 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_144 2128529 : 2130536 1 Serratia_phage(100.0%) NA NA
DBSCAN-SWA_145 2139167 : 2141207 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 2157684 : 2163082 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_147 2171917 : 2174413 1 Vibrio_phage(100.0%) protease NA
DBSCAN-SWA_148 2181339 : 2181630 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_149 2194041 : 2194917 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 2206067 : 2208137 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_151 2214972 : 2215386 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_152 2228391 : 2237297 4 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_153 2242420 : 2250733 8 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_154 2255027 : 2256695 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_155 2268686 : 2269538 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_156 2277630 : 2278647 1 Moraxella_phage(100.0%) tRNA NA
DBSCAN-SWA_157 2299641 : 2301495 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_158 2311212 : 2312682 1 Bathycoccus_sp._RCC1105_virus(100.0%) NA NA
DBSCAN-SWA_159 2324623 : 2330752 4 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_160 2355547 : 2356573 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_161 2363178 : 2371160 8 Caulobacter_phage(40.0%) NA NA
DBSCAN-SWA_162 2377287 : 2379002 2 Beihai_hepe-like_virus(50.0%) NA NA
DBSCAN-SWA_163 2388002 : 2389136 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_164 2395905 : 2397486 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_165 2402517 : 2404374 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_166 2421867 : 2423847 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_167 2454688 : 2455261 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2480144 : 2483315 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_169 2494681 : 2497717 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_170 2505827 : 2507315 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_171 2513476 : 2515105 1 Pike_perch_iridovirus(100.0%) NA NA
DBSCAN-SWA_172 2532419 : 2533607 1 Bacillus_virus(100.0%) protease NA
DBSCAN-SWA_173 2567337 : 2576040 8 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_174 2582859 : 2586442 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_175 2592028 : 2593045 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_176 2596902 : 2597499 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2606754 : 2609895 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_178 2620709 : 2625029 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_179 2660999 : 2663192 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_180 2671701 : 2674392 3 Powai_lake_megavirus(50.0%) tRNA NA
DBSCAN-SWA_181 2681820 : 2682831 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_182 2699597 : 2707908 7 uncultured_virus(25.0%) NA NA
DBSCAN-SWA_183 2724259 : 2725552 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_184 2751247 : 2751979 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_185 2757487 : 2757988 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_186 2762581 : 2764699 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_187 2768662 : 2770411 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_188 2779513 : 2780188 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_189 2787475 : 2789002 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_190 2792716 : 2793961 1 Deep-sea_thermophilic_phage(100.0%) NA NA
DBSCAN-SWA_191 2806462 : 2807137 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_192 2811307 : 2814672 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_193 2840301 : 2841918 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_194 2860571 : 2874882 13 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_195 2879928 : 2886836 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_196 2889878 : 2891291 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_197 2894758 : 2897808 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_198 2901988 : 2902546 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_199 2913776 : 2917145 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_200 2926877 : 2929007 2 uncultured_marine_virus(50.0%) NA NA
DBSCAN-SWA_201 2937246 : 2939838 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_202 2946038 : 2946791 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_203 2954551 : 2955148 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_204 2959835 : 2971195 12 Bacillus_phage(25.0%) tRNA,protease NA
DBSCAN-SWA_205 2979381 : 2981755 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_206 2988195 : 2988693 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_207 2992145 : 2994296 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_208 3017440 : 3025231 6 Orpheovirus(25.0%) tRNA NA
DBSCAN-SWA_209 3049955 : 3053089 3 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_210 3076698 : 3078624 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_211 3084414 : 3087549 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_212 3092527 : 3096598 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_213 3106921 : 3108205 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_214 3120066 : 3124403 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_215 3132915 : 3134719 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_216 3184959 : 3187967 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_217 3194987 : 3195722 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_218 3205510 : 3208102 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_219 3235175 : 3237713 1 Enterobacteria_phage(100.0%) protease NA
DBSCAN-SWA_220 3250893 : 3268977 15 Amsacta_moorei_entomopoxvirus(14.29%) NA NA
DBSCAN-SWA_221 3276130 : 3281321 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_222 3285365 : 3285884 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_223 3289696 : 3300765 11 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_224 3313055 : 3314438 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_225 3317734 : 3318112 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_226 3331349 : 3337123 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_227 3343214 : 3343661 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_228 3379769 : 3380798 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_229 3399861 : 3402300 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_230 3417862 : 3421816 4 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_231 3439994 : 3441200 1 Methanothermobacter_phage(100.0%) NA NA
DBSCAN-SWA_232 3449451 : 3450174 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_233 3457623 : 3465523 5 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_234 3469440 : 3470832 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_235 3484355 : 3485877 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_236 3493076 : 3495482 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_237 3505471 : 3509273 3 Organic_Lake_phycodnavirus(50.0%) tRNA NA
DBSCAN-SWA_238 3516597 : 3518976 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_239 3540837 : 3552507 11 Catovirus(16.67%) NA NA
DBSCAN-SWA_240 3556053 : 3556725 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_241 3561565 : 3571372 5 Moumouvirus(33.33%) tRNA NA
DBSCAN-SWA_242 3590551 : 3596068 4 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_243 3608592 : 3611154 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_244 3619138 : 3619888 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_245 3624173 : 3625037 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_246 3655917 : 3656901 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_247 3665939 : 3669798 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_248 3685509 : 3690339 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_249 3722421 : 3723465 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_250 3733658 : 3739561 7 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_251 3743460 : 3747920 5 Phaeocystis_globosa_virus(50.0%) tRNA NA
DBSCAN-SWA_252 3751391 : 3756031 3 Burkholderia_phage(50.0%) tRNA NA
DBSCAN-SWA_253 3763731 : 3765393 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_254 3769512 : 3776756 6 Sinorhizobium_phage(25.0%) tRNA NA
DBSCAN-SWA_255 3783060 : 3784152 1 Aeropyrum_pernix_ovoid_virus(100.0%) NA NA
DBSCAN-SWA_256 3792873 : 3794283 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_257 3813397 : 3818093 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_258 3822579 : 3825930 4 Micromonas_pusilla_virus(33.33%) NA NA
DBSCAN-SWA_259 3829810 : 3836513 12 uncultured_marine_virus(16.67%) NA NA
DBSCAN-SWA_260 3840255 : 3863909 27 Flavobacterium_phage(35.71%) tail,head,portal,protease,capsid,terminase NA
DBSCAN-SWA_261 3867000 : 3871517 4 Bacillus_phage(66.67%) integrase attL 3866067:3866081|attR 3868335:3868349
DBSCAN-SWA_262 3877462 : 3878650 1 Brazilian_marseillevirus(100.0%) NA NA
DBSCAN-SWA_263 3889737 : 3897947 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_264 3901131 : 3909905 9 Moumouvirus(20.0%) NA NA
DBSCAN-SWA_265 3917084 : 3918848 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_266 3922233 : 3923526 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_267 3926718 : 3927366 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_268 3930792 : 3932181 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_269 3940701 : 3941877 1 Myxoma_virus(100.0%) NA NA
DBSCAN-SWA_270 3947387 : 3949777 3 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_271 3956913 : 3961189 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_272 3976186 : 3977947 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_273 4024685 : 4026578 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_274 4031914 : 4032916 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_275 4054146 : 4056042 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_276 4071221 : 4072601 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_277 4087862 : 4088933 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_278 4101339 : 4103064 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_279 4122449 : 4123088 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_280 4130565 : 4139786 7 unidentified_phage(20.0%) tRNA NA
DBSCAN-SWA_281 4146817 : 4147771 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_282 4161808 : 4169217 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_283 4184960 : 4186439 1 Thermoanaerobacterium_phage(100.0%) NA NA
DBSCAN-SWA_284 4191386 : 4194423 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_285 4200593 : 4203890 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_286 4210052 : 4212911 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_287 4217644 : 4218409 1 Flavobacterium_sp._phage(100.0%) NA NA
DBSCAN-SWA_288 4223162 : 4225154 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_289 4232189 : 4237405 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_290 4247578 : 4249670 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_291 4256091 : 4260880 3 Acanthamoeba_polyphaga_moumouvirus(50.0%) tRNA NA
DBSCAN-SWA_292 4264397 : 4270461 5 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_293 4278335 : 4282521 4 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_294 4289177 : 4294163 4 Helicoverpa_zea_nudivirus(33.33%) NA NA
DBSCAN-SWA_295 4297772 : 4298741 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_296 4302645 : 4305329 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_297 4314419 : 4314965 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_298 4319033 : 4320236 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_299 4323950 : 4325168 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_300 4333182 : 4337321 5 Staphylococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage