Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048761 Campylobacter jejuni strain ZS004 chromosome, complete genome 1 crisprs DEDDh,WYL,csa3 0 1 1 0
NZ_CP048762 Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP048761
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048761_1 1361577-1361656 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048761_1 1.1|1361600|34|NZ_CP048761|CRISPRCasFinder 1361600-1361633 34 MH752385 Bacillus phage Ray17, complete genome 8509-8542 10 0.706

1. spacer 1.1|1361600|34|NZ_CP048761|CRISPRCasFinder matches to MH752385 (Bacillus phage Ray17, complete genome) position: , mismatch: 10, identity: 0.706

ttttttagctttatactcagccttactcatataa	CRISPR spacer
cttacaagctttatactcagccttattgatcgtt	Protospacer
.** . *******************.* **    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 354445 : 407097 68 Campylobacter_phage(53.12%) tail,transposase,plate,terminase,tRNA,integrase attL 353201:353220|attR 414737:414756
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage