Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 1 crisprs csa3,WYL 0 2 2 0
NZ_CP050824 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP050825 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP050822 Klebsiella pneumoniae strain Bckp091 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,DinG,WYL 0 0 5 0

Results visualization

1. NZ_CP050823
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050823_1 121857-122016 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290700-290719 0 1.0
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182565-182584 0 1.0
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 121900-121919 0 1.0
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 65789-65808 0 1.0
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42375-42394 0 1.0
NZ_CP050823_1 1.1|121900|20|NZ_CP050823|PILER-CR 121900-121919 20 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 140382-140401 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182511-182547 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42321-42357 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 140328-140364 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 121937-121973 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 65826-65862 0 1.0
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290179-290215 1 0.973
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290646-290682 1 0.973
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 102806-102842 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 197540-197576 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 103219-103255 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 72277-72313 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 121034-121070 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 163312-163348 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69199-69235 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69668-69704 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 198410-198446 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 38247-38283 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 228773-228809 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 44762-44798 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 70069-70105 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 3116-3152 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 48752-48788 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49221-49257 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47425-47461 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47894-47930 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 49366-49402 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 186633-186669 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 196695-196731 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 148434-148470 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 32247-32283 2 0.946
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 181926-181962 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182044-182080 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42086-42122 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139743-139779 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139861-139897 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66061-66097 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289476-289512 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289594-289630 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 184851-184887 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 73775-73811 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146591-146627 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146709-146745 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146827-146863 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217495-217531 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217613-217649 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 46271-46307 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 64168-64204 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 38313-38349 3 0.919
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 184499-184535 4 0.892
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146473-146509 4 0.892
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 201258-201294 4 0.892
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 195159-195195 5 0.865
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 41850-41886 6 0.838
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66297-66333 6 0.838
NZ_CP050823_1 1.2|121963|37|NZ_CP050823|PILER-CR 121963-121999 37 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146355-146391 6 0.838

1. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

2. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

3. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

4. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

5. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

6. spacer 1.1|121900|20|NZ_CP050823|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ggataggttctgaaggtaat	CRISPR spacer
ggataggttctgaaggtaat	Protospacer
********************

7. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgccta	Protospacer
*************************************

8. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgccta	Protospacer
*************************************

9. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgccta	Protospacer
*************************************

10. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgccta	Protospacer
*************************************

11. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgccta	Protospacer
*************************************

12. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.973

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcctg	Protospacer
************************************.

13. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.973

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcctg	Protospacer
************************************.

14. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

15. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

16. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

17. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

18. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

19. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

20. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

21. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

22. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

23. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

24. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

25. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

26. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

27. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

28. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

29. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

30. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

31. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

32. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

33. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

34. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

35. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

36. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 2, identity: 0.946

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcctg	Protospacer
**************** *******************.

37. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

38. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

39. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

40. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

41. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

42. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

43. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

44. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

45. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgccgg	Protospacer
**************** ****************** .

46. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatagccggttatgcccg	Protospacer
**************** ******************..

47. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

48. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

49. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

50. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

51. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

52. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

53. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

54. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 3, identity: 0.919

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcctg	Protospacer
**************** ***** *************.

55. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 4, identity: 0.892

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgccgg	Protospacer
**************** ***** ************ .

56. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 4, identity: 0.892

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccgg	Protospacer
**************** ***** ************ .

57. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 4, identity: 0.892

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccgg	Protospacer
**************** ***** ************ .

58. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.865

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgtcgg	Protospacer
**************** ***** **********.* .

59. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 6, identity: 0.838

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcacag	Protospacer
**************** ***** *********  * .

60. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 6, identity: 0.838

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcacag	Protospacer
**************** ***** *********  * .

61. spacer 1.2|121963|37|NZ_CP050823|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 6, identity: 0.838

gtgcggttgaatggcccggcatagccggttatgccta	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcacag	Protospacer
**************** ***** *********  * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20782 : 80596 53 uncultured_Caudovirales_phage(42.11%) transposase NA
DBSCAN-SWA_2 100438 : 111156 9 Salmonella_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP050822
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050822_1 4299004-4299098 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1367488 : 1434831 77 Klebsiella_phage(44.23%) transposase,tRNA,tail,integrase,protease,capsid,head,terminase,holin attL 1390376:1390401|attR 1433788:1433813
DBSCAN-SWA_2 1662052 : 1668958 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2652996 : 2663883 8 Escherichia_phage(85.71%) NA NA
DBSCAN-SWA_4 3312882 : 3322356 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_5 4810124 : 4835718 19 Salmonella_phage(60.0%) transposase,integrase attL 4797675:4797689|attR 4845641:4845655
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage