Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050746 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence 0 crisprs cas14j 0 0 11 0
NZ_CP050747 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP050745 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 chromosome, complete genome 5 crisprs cas3,PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas14j,DEDDh,DinG,RT 0 37 13 0
NZ_CP050749 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP050746
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14879 14 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_2 18518 : 23824 3 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_3 30118 : 30859 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_4 48765 : 49185 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_5 55654 : 55876 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_6 66109 : 70015 4 Emiliania_huxleyi_virus(33.33%) NA NA
DBSCAN-SWA_7 73207 : 82503 11 Escherichia_phage(28.57%) transposase NA
DBSCAN-SWA_8 88520 : 94133 7 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_9 98178 : 101615 3 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_10 107038 : 107389 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_11 110449 : 111232 1 Macacine_betaherpesvirus(100.0%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP050747
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44084 : 52527 8 Rhodococcus_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP050748
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050748_1 5835-5954 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP050748_1 1.1|5878|34|NZ_CP050748|CRISPRCasFinder 5878-5911 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

3. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

4. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

5. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

6. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

7. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

8. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

9. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

10. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

11. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

12. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

13. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

14. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

15. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

16. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

17. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

18. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

19. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

20. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

21. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

22. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

23. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

24. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

25. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

26. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

27. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

28. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

29. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

30. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

31. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

32. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

33. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

34. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

35. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

36. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

37. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

38. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

39. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

40. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

41. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

42. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

43. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

44. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

45. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

46. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

47. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

48. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

49. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

50. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

51. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

52. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

53. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

54. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

55. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

56. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

57. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

58. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

59. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

60. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

61. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

62. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

63. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

64. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

65. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

66. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

67. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

68. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

69. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

70. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

71. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

72. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

73. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

74. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

75. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

76. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

77. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

78. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

79. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

80. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

81. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

82. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

83. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

84. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

85. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

86. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

87. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

88. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

89. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

90. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

91. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

92. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

93. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

94. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

95. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

96. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

97. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

98. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

99. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

100. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

101. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

102. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

103. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

104. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

105. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

106. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

107. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

108. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

109. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

110. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

111. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

112. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

113. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

114. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

115. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

116. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

117. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

118. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

119. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

120. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

121. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

122. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

123. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

124. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

125. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

126. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

127. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

128. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

129. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

130. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

131. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

132. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

133. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

134. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

135. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

136. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

137. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

138. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

139. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

140. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

141. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

142. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

143. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

144. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

145. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

146. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

147. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

148. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

149. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

150. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

151. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

152. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

153. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

154. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

155. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

156. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

157. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

158. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

159. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

160. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

161. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

162. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

163. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

164. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

165. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

166. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

167. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

169. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

170. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

171. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

172. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

173. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

174. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

175. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

176. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

177. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

178. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

179. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

180. spacer 1.1|5878|34|NZ_CP050748|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
*****************************. *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP050745
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050745_1 678225-678325 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050745_2 1028172-1030153 TypeI-E I-E
32 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050745_3 1046285-1047169 TypeI-E I-E
14 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050745_4 1047243-1047637 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050745_5 1386604-1386713 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050745_2 2.28|1029852|32|NZ_CP050745|PILER-CR 1029852-1029883 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP050745_2 2.28|1029852|32|NZ_CP050745|PILER-CR 1029852-1029883 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP050745_2 2.38|1029849|32|NZ_CP050745|CRISPRCasFinder,CRT 1029849-1029880 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
NZ_CP050745_2 2.38|1029849|32|NZ_CP050745|CRISPRCasFinder,CRT 1029849-1029880 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
NZ_CP050745_3 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT 1047046-1047077 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
NZ_CP050745_3 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT 1047046-1047077 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
NZ_CP050745_3 3.22|1047045|33|NZ_CP050745|PILER-CR 1047045-1047077 33 CP051275 Salmonella phage SW-37, complete genome 24294-24326 1 0.97
NZ_CP050745_3 3.22|1047045|33|NZ_CP050745|PILER-CR 1047045-1047077 33 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44003 1 0.97
NZ_CP050745_2 2.32|1029482|32|NZ_CP050745|CRISPRCasFinder,CRT 1029482-1029513 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
NZ_CP050745_3 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT 1047046-1047077 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
NZ_CP050745_2 2.22|1029482|35|NZ_CP050745|PILER-CR 1029482-1029516 35 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130780-130814 4 0.886
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387378 5 0.844
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461590 5 0.844
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599340-599371 5 0.844
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 121315-121346 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 850282-850313 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 887728-887759 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 856045-856076 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 835457-835488 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 953948-953979 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 431895-431926 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 843687-843718 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 833486-833517 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 457962-457993 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1502459-1502490 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1188725-1188756 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1094940-1094971 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 574071-574102 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 758103-758134 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 92938-92969 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1622461-1622492 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 174090-174121 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 996227-996258 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 856529-856560 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1026857-1026888 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 801217-801248 6 0.812
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 887731-887762 6 0.812
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NZ_CP050745_3 3.20|1046923|33|NZ_CP050745|PILER-CR 1046923-1046955 33 MT774487 Salmonella phage MG40, complete genome 21745-21777 6 0.818
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 135155-135186 7 0.781
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 195902-195933 7 0.781
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 581076-581107 7 0.781
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 122557-122588 7 0.781
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 529537-529568 7 0.781
NZ_CP050745_2 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028689-1028720 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 327444-327475 7 0.781
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 360377-360408 7 0.781
NZ_CP050745_3 3.8|1046741|32|NZ_CP050745|CRISPRCasFinder,CRT 1046741-1046772 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NZ_CP050745_3 3.8|1046741|32|NZ_CP050745|CRISPRCasFinder,CRT 1046741-1046772 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NZ_CP050745_3 3.20|1046923|33|NZ_CP050745|PILER-CR 1046923-1046955 33 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39484 7 0.788
NZ_CP050745_3 3.20|1046923|33|NZ_CP050745|PILER-CR 1046923-1046955 33 MH370364 Salmonella phage S107, complete genome 29958-29990 7 0.788
NZ_CP050745_3 3.20|1046923|33|NZ_CP050745|PILER-CR 1046923-1046955 33 MH370382 Salmonella phage S135, complete genome 29958-29990 7 0.788
NZ_CP050745_3 3.20|1046923|33|NZ_CP050745|PILER-CR 1046923-1046955 33 MH370383 Salmonella phage S137, complete genome 29958-29990 7 0.788
NZ_CP050745_4 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047272-1047303 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP050745_4 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047272-1047303 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP050745_4 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047272-1047303 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79087-79118 8 0.75
NZ_CP050745_2 2.7|1028567|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028567-1028598 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NZ_CP050745_2 2.16|1029116|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029116-1029147 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
NZ_CP050745_2 2.17|1029177|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029177-1029208 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
NZ_CP050745_2 2.17|1029177|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029177-1029208 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 43093-43124 8 0.75
NZ_CP050745_2 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029360-1029391 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 152052-152083 8 0.75
NZ_CP050745_2 2.25|1029669|32|NZ_CP050745|PILER-CR 1029669-1029700 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP050745_2 2.25|1029669|32|NZ_CP050745|PILER-CR 1029669-1029700 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP050745_2 2.35|1029666|32|NZ_CP050745|CRISPRCasFinder,CRT 1029666-1029697 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
NZ_CP050745_2 2.35|1029666|32|NZ_CP050745|CRISPRCasFinder,CRT 1029666-1029697 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
NZ_CP050745_3 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT 1046558-1046589 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
NZ_CP050745_3 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT 1046558-1046589 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
NZ_CP050745_3 3.9|1046802|32|NZ_CP050745|CRISPRCasFinder,CRT 1046802-1046833 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NZ_CP050745_3 3.17|1046740|33|NZ_CP050745|PILER-CR 1046740-1046772 33 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142293-142325 8 0.758
NZ_CP050745_3 3.17|1046740|33|NZ_CP050745|PILER-CR 1046740-1046772 33 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29080 8 0.758
NZ_CP050745_4 4.2|1047333|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047333-1047364 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP050745_4 4.2|1047333|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047333-1047364 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP050745_4 4.5|1047516|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1047516-1047547 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP050745_2 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028750-1028781 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP050745_2 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028750-1028781 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP050745_2 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028750-1028781 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP050745_2 2.12|1028872|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028872-1028903 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP050745_2 2.12|1028872|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028872-1028903 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP050745_2 2.14|1028994|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028994-1029025 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP050745_2 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029299-1029330 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP050745_2 2.23|1029546|32|NZ_CP050745|PILER-CR 1029546-1029577 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP050745_2 2.33|1029543|32|NZ_CP050745|CRISPRCasFinder,CRT 1029543-1029574 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NZ_CP050745_3 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT 1046924-1046955 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 68697-68728 10 0.688
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 43950-43981 10 0.688
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 49131-49162 10 0.688
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 66631-66662 10 0.688
NZ_CP050745_2 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028506-1028537 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 147167-147198 10 0.688
NZ_CP050745_2 2.11|1028811|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028811-1028842 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP050745_2 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1029055-1029086 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP050745_2 2.29|1029913|32|NZ_CP050745|PILER-CR 1029913-1029944 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP050745_2 2.39|1029910|32|NZ_CP050745|CRISPRCasFinder,CRT 1029910-1029941 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP050745_2 2.42|1030093|32|NZ_CP050745|CRISPRCasFinder,CRT 1030093-1030124 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP050745_3 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT 1046558-1046589 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NZ_CP050745_3 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT 1046619-1046650 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NZ_CP050745_3 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT 1047046-1047077 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
NZ_CP050745_4 4.6|1047577|32|NZ_CP050745|CRISPRCasFinder,CRT 1047577-1047608 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP050745_4 4.6|1047577|32|NZ_CP050745|CRISPRCasFinder,CRT 1047577-1047608 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP050745_2 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT 1028933-1028964 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.28|1029852|32|NZ_CP050745|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 2.28|1029852|32|NZ_CP050745|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 2.38|1029849|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

4. spacer 2.38|1029849|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

5. spacer 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacgttcggcgatgttggccccatcggtccg	Protospacer
*******************************.

6. spacer 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacattcggcgatgttggccccatcggtcca	Protospacer
****.***************************

7. spacer 3.22|1047045|33|NZ_CP050745|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.97

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacgttcggcgatgttggccccatcggtccg	Protospacer
********************************.

8. spacer 3.22|1047045|33|NZ_CP050745|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.97

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacattcggcgatgttggccccatcggtcca	Protospacer
*****.***************************

9. spacer 2.32|1029482|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

aaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
aaacgaaagaggccatgcgattgtttatcggt	Protospacer
*************.*****.************

10. spacer 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ctacgttcggtgatgttggccccataggtcca	Protospacer
*.********.************** ******

11. spacer 2.22|1029482|35|NZ_CP050745|PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 4, identity: 0.886

tcgaaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
atgaaacgaaagaggccatgcgattgtttatcggt	Protospacer
 .**************.*****.************

12. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

13. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

14. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * **** 

15. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812

gatcgggtggtgccggtgggccatgtggcgct--	CRISPR spacer
ggtcgggtggtgcgggtcggcca--tggcgttgg	Protospacer
*.*********** *** *****  *****.*  

16. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

17. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

18. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

19. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

20. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

21. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

22. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

23. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

24. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

25. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

26. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

27. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

28. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

29. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

30. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

31. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

32. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

33. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

34. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

35. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

36. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

37. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

38. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgg	Protospacer
 .  **********************  ****

39. spacer 3.20|1046923|33|NZ_CP050745|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.818

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgg	Protospacer
* .  **********************  ****

40. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

41. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

42. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

43. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

44. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************  

45. spacer 2.9|1028689|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgggtggtgccggtgggccatgtggcgct	CRISPR spacer
gctagtgccgtgccggtgcgccatgtggggct	Protospacer
* * * *. ********* ********* ***

46. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

47. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcaccgccgatcctttcaccgccgcc	Protospacer
********* ********* ****. *.  **

48. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

49. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.781

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcttcggtgacgacattgccgaaggcgacgta	Protospacer
*.  ******** ** ************ .**

50. spacer 3.8|1046741|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

51. spacer 3.8|1046741|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

52. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

53. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

54. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

55. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

56. spacer 3.20|1046923|33|NZ_CP050745|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

57. spacer 3.20|1046923|33|NZ_CP050745|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

58. spacer 3.20|1046923|33|NZ_CP050745|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

59. spacer 3.20|1046923|33|NZ_CP050745|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.788

ggtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
gccatttcatcaggcactaccggcactggctgc	Protospacer
* .  **********************  *** 

60. spacer 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

61. spacer 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

62. spacer 4.1|1047272|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**  

63. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 8, identity: 0.75

gctcattaaataactatataacccccggactc	CRISPR spacer
tatcattaaataactatataacacacgagagc	Protospacer
  ******************** * **..  *

64. spacer 2.7|1028567|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttccagaaccgtttgacttactgtggccatta	CRISPR spacer
ctgccgaaccgtgtgccttactgtggccaccg	Protospacer
.* * ******* ** *************...

65. spacer 2.16|1029116|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

cggaggatggaatatttccgaggctggcgatt	CRISPR spacer
tgggagatggaatacttccggggctggcaacc	Protospacer
.**..*********.*****.*******.*..

66. spacer 2.17|1029177|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

67. spacer 2.17|1029177|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

68. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac-	CRISPR spacer
atacgctggtctataccggcaa-ggatccgctg	Protospacer
  ******************** *.*. ** . 

69. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

70. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

71. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
ggacgctgttcaataccggcaacgtccggatc	Protospacer
 ******* ** ************  ** . *

72. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcgacggtgacgtccgtgacgaaggtgttcga	Protospacer
*.************ *** ******.*    *

73. spacer 2.20|1029360|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
ttctggtggacgtccgtgccgaaggcgcaatg	Protospacer
**   *  ****** ************ ***.

74. spacer 2.25|1029669|32|NZ_CP050745|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

75. spacer 2.25|1029669|32|NZ_CP050745|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

76. spacer 2.35|1029666|32|NZ_CP050745|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

77. spacer 2.35|1029666|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

78. spacer 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
acgcatcagcactggatcaagctggcgcaact	Protospacer
 ***    ************ ***.****** 

79. spacer 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
acgcatcagcactggatcaagctggcgcaact	Protospacer
 ***    ************ ***.****** 

80. spacer 3.9|1046802|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

81. spacer 3.17|1046740|33|NZ_CP050745|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

82. spacer 3.17|1046740|33|NZ_CP050745|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 8, identity: 0.758

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

83. spacer 4.2|1047333|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

84. spacer 4.2|1047333|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *. 

85. spacer 4.5|1047516|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  . 

86. spacer 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
ggtgcgggtgaggaactcctcgtccactgaac	Protospacer
*  **** **** **************   . 

87. spacer 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

88. spacer 2.10|1028750|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

89. spacer 2.12|1028872|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

90. spacer 2.12|1028872|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

91. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcagcgccgagcagttcagcaaactg	Protospacer
**************** * *****  . .*. 

92. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
gcggcatcagcgccgaccggttcaccgtcagg	Protospacer
 ***************.* *****. **    

93. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatgagcgccgatcagttcgacgccctg	Protospacer
******* ********** ****.  *. *. 

94. spacer 2.14|1028994|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

aacaggaacaggaaaaaaaagatttgtccggt	CRISPR spacer
tacagtaacaggaaaaaaaggattaatgatgc	Protospacer
 **** *************.**** .*   *.

95. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaacggtcagcctgtccaggagga	Protospacer
****** *********** ****..**     

96. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

97. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

98. spacer 2.19|1029299|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattt	Protospacer
****.********.********** * .   .

99. spacer 2.23|1029546|32|NZ_CP050745|PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

100. spacer 2.33|1029543|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

101. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

ttgcag----ggcgatattgttgttggtgaatggga	CRISPR spacer
----aacactgacgatattattgttggtgattgggg	Protospacer
    *.    *.*******.********** ****.

102. spacer 3.11|1046924|32|NZ_CP050745|CRISPRCasFinder,CRT matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
tgagttcatccggcactaccggcgctggatgc	Protospacer
   ******* ************.**   ** 

103. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

104. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

105. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

106. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

107. spacer 2.6|1028506|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 10, identity: 0.688

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*   

108. spacer 2.11|1028811|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

ctccagcgctcgaatttatttgaggccaccac	CRISPR spacer
gaacaccgcgcgaatttatttgaggcaagttt	Protospacer
   ** *** **************** * . .

109. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

110. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

111. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

112. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

113. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

114. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

115. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

116. spacer 2.15|1029055|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

117. spacer 2.29|1029913|32|NZ_CP050745|PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

118. spacer 2.39|1029910|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

119. spacer 2.42|1030093|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*  

120. spacer 3.5|1046558|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctgacgcactggatcaacctgacgcaacg	CRISPR spacer
aatctgacgcacttgatcaacctggcgtttga	Protospacer
   ********** **********.**.   .

121. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

122. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

123. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

124. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

125. spacer 3.6|1046619|32|NZ_CP050745|CRISPRCasFinder,CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

126. spacer 3.13|1047046|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
actcgttcggcgatgtggcccccatccaggtg	Protospacer
 * ************* * ******* .  ..

127. spacer 4.6|1047577|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

128. spacer 4.6|1047577|32|NZ_CP050745|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

129. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

130. spacer 2.13|1028933|32|NZ_CP050745|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65645 : 100522 34 Escherichia_phage(44.44%) transposase,integrase attL 60916:60945|attR 81546:81575
DBSCAN-SWA_2 1150249 : 1261304 114 Salmonella_phage(35.09%) head,capsid,holin,portal,integrase,tail,lysis,protease,tRNA,terminase,transposase attL 1142087:1142103|attR 1255525:1255541
DBSCAN-SWA_3 1282436 : 1317044 41 Cronobacter_phage(64.52%) head,capsid,holin,portal,integrase,tail,tRNA,terminase attL 1280889:1280904|attR 1309052:1309067
DBSCAN-SWA_4 1345443 : 1378856 45 Salmonella_phage(97.56%) head,capsid,plate,integrase,portal,tail,lysis,terminase attL 1345282:1345328|attR 1378974:1379020
DBSCAN-SWA_5 1401454 : 1438390 33 Salmonella_phage(27.27%) tail,transposase,integrase,tRNA attL 1401563:1401579|attR 1450652:1450668
DBSCAN-SWA_6 1791451 : 1821044 32 Salmonella_phage(38.46%) tail,protease,holin NA
DBSCAN-SWA_7 1893096 : 1902267 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 1970575 : 1981081 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_9 2070424 : 2077678 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_10 2973718 : 3058453 93 Salmonella_phage(43.64%) holin,portal,integrase,tail,lysis,protease,tRNA,terminase attL 2997812:2997831|attR 3069599:3069618
DBSCAN-SWA_11 3122589 : 3131321 7 Enterobacteria_phage(14.29%) transposase,protease NA
DBSCAN-SWA_12 3711926 : 3723022 18 Enterobacteria_phage(66.67%) transposase,integrase attL 3697692:3697706|attR 3731371:3731385
DBSCAN-SWA_13 4550280 : 4597324 50 Burkholderia_phage(40.91%) tail,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage