Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022871 Phytohabitans suffuscus strain NBRC 105367 23 crisprs csb3,cas3,csb2gr5,csb1gr7,csa3,cas2,cas6e,cse2gr11,cas8e,RT,DEDDh,WYL,cas4 8 101 1 0

Results visualization

1. NZ_AP022871
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_1 287131-287706 Unclear I-E
9 spacers
cas1,csb3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_2 295020-295208 Unclear NA
2 spacers
cas1,csb3,cas3,csb2gr5,csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_3 298150-302999 Unclear NA
66 spacers
cas1,csb3,cas3,csb2gr5,csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_4 317253-319507 TypeI-E NA
29 spacers
csb1gr7,csb2gr5,cas3,csb3,cas1,csa3,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_5 319846-319961 TypeI-E NA
1 spacers
csb1gr7,csb2gr5,cas3,csb3,cas1,csa3,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_6 327819-329311 TypeI-E NA
24 spacers
csa3,cas2,cas6e,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_7 345782-347632 TypeI-E I-E:NA
30 spacers
cas3,cas8e,cse2gr11,cas6e,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_8 350474-351294 TypeI-E I-E
13 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_9 355157-357392 Unclear NA:I-E
36 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_10 1069157-1069251 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_11 1388092-1388426 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_12 1403353-1403438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_13 5709756-5709856 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_14 5912174-5912280 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_15 6145200-6145294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_16 6490268-6490581 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_17 6869960-6870075 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_18 6973530-6973633 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_19 7659308-7660936 Orphan NA
22 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_20 8701381-8701479 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_21 9005059-9005151 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_22 9252899-9252988 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022871_23 9441500-9441575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP022871_6 6.5|328090|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328090-328122 33 NZ_AP022871.1 1972469-1972501 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 5662915-5662933 1 0.947
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 6444731-6444749 1 0.947
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 7109648-7109666 1 0.947
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 1271253-1271271 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 2449528-2449546 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 3998789-3998807 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 5593875-5593893 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 6080767-6080785 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 7354889-7354907 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 7889894-7889912 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 8351418-8351436 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9000261-9000279 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9343684-9343702 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9362913-9362931 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 1258393-1258411 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 1803565-1803583 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 2054505-2054523 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 3824746-3824764 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 5255669-5255687 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 5322350-5322368 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 5574661-5574679 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 7959009-7959027 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9725621-9725639 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9743052-9743070 2 0.895
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_AP022871.1 9850329-9850347 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 448579-448597 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 2082862-2082880 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 8637031-8637049 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 8844578-8844596 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 8857840-8857858 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 8924167-8924185 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 9472989-9473007 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 2360712-2360730 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 3928712-3928730 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 4520034-4520052 2 0.895
NZ_AP022871_11 11.2|1388151|19|NZ_AP022871|CRT 1388151-1388169 19 NZ_AP022871.1 9155529-9155547 2 0.895
NZ_AP022871_11 11.3|1388190|19|NZ_AP022871|CRT 1388190-1388208 19 NZ_AP022871.1 8777711-8777729 2 0.895
NZ_AP022871_11 11.4|1388229|19|NZ_AP022871|CRT 1388229-1388247 19 NZ_AP022871.1 6566593-6566611 2 0.895
NZ_AP022871_11 11.6|1388307|19|NZ_AP022871|CRT 1388307-1388325 19 NZ_AP022871.1 9906922-9906940 2 0.895
NZ_AP022871_16 16.2|6490330|19|NZ_AP022871|CRISPRCasFinder 6490330-6490348 19 NZ_AP022871.1 3451365-3451383 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 4274157-4274175 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 5268995-5269013 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 9484345-9484363 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 261333-261351 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 8004541-8004559 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 8929117-8929135 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 10139811-10139829 2 0.895
NZ_AP022871_16 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder 6490471-6490489 19 NZ_AP022871.1 217299-217317 7 0.632

1. spacer 6.5|328090|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to position: 1972469-1972501, mismatch: 0, identity: 1.0

acgccgagcaccttctcgccggatcccgtgcgc	CRISPR spacer
acgccgagcaccttctcgccggatcccgtgcgc	Protospacer
*********************************

2. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 5662915-5662933, mismatch: 1, identity: 0.947

gccggctgggaccgcgccg	CRISPR spacer
gccggccgggaccgcgccg	Protospacer
******.************

3. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 6444731-6444749, mismatch: 1, identity: 0.947

gccggctgggacggcgggc	CRISPR spacer
gccggcggggacggcgggc	Protospacer
****** ************

4. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 7109648-7109666, mismatch: 1, identity: 0.947

gccggctgggacggcgggc	CRISPR spacer
gccggcggggacggcgggc	Protospacer
****** ************

5. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 1271253-1271271, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggccgggaccgcggcg	Protospacer
******.********* **

6. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 2449528-2449546, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggccggcaccgcgccg	Protospacer
******.** *********

7. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 3998789-3998807, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggccggcgccg	Protospacer
********** * ******

8. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 5593875-5593893, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggatgggtccgcgccg	Protospacer
***** **** ********

9. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 6080767-6080785, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggcccggaccgcgccg	Protospacer
******. ***********

10. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 7354889-7354907, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctggaaccgcggcg	Protospacer
*********.****** **

11. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 7889894-7889912, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccagctgggacagcgccg	Protospacer
***.******** ******

12. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 8351418-8351436, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggccgtgaccgcgccg	Protospacer
******.* **********

13. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9000261-9000279, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctcggcccgcgccg	Protospacer
******* ** ********

14. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9343684-9343702, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctggaaccgcaccg	Protospacer
*********.*****.***

15. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9362913-9362931, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggcgggcaccgcgccg	Protospacer
****** ** *********

16. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 1258393-1258411, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggccggcaccgcgccg	Protospacer
******.** *********

17. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 1803565-1803583, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccccgacg	Protospacer
************* ** **

18. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 2054505-2054523, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctggcgccgcgccg	Protospacer
********* .********

19. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 3824746-3824764, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gcgggctgggacagcgccg	Protospacer
** ********* ******

20. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 5255669-5255687, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctcggaccgccccg	Protospacer
******* ******* ***

21. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 5322350-5322368, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggacccggccg	Protospacer
*************  ****

22. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 5574661-5574679, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggccgggaccgagccg	Protospacer
******.******* ****

23. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 7959009-7959027, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggcggggaccgcgtcg	Protospacer
****** *********.**

24. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9725621-9725639, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccgcctggcaccgcgccg	Protospacer
**** **** *********

25. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9743052-9743070, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggccggcgccg	Protospacer
********** * ******

26. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to position: 9850329-9850347, mismatch: 2, identity: 0.895

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggacatcgccg	Protospacer
************  *****

27. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 448579-448597, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggctccgacggcgggc	Protospacer
*******  **********

28. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 2082862-2082880, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggcgggaacggcgggc	Protospacer
****** **.*********

29. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 8637031-8637049, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggctcgggcggcgggc	Protospacer
******* **.********

30. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 8844578-8844596, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggccggggcggcgggc	Protospacer
******.***.********

31. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 8857840-8857858, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggcggtgacggcgggc	Protospacer
****** * **********

32. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 8924167-8924185, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggcctggacggcgggc	Protospacer
******. ***********

33. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 9472989-9473007, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggacgggacggcgggc	Protospacer
***** .************

34. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 2360712-2360730, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggctgcgacggcgcgc	Protospacer
******** ******* **

35. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 3928712-3928730, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gcccgctgggacgacgggc	Protospacer
*** *********.*****

36. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 4520034-4520052, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccggcgcggacggcgggc	Protospacer
******  ***********

37. spacer 11.2|1388151|19|NZ_AP022871|CRT matches to position: 9155529-9155547, mismatch: 2, identity: 0.895

gccggctgggacggcgggc	CRISPR spacer
gccgggcgggacggcgggc	Protospacer
***** .************

38. spacer 11.3|1388190|19|NZ_AP022871|CRT matches to position: 8777711-8777729, mismatch: 2, identity: 0.895

accgcgtgggacgaccgcc	CRISPR spacer
accgcgtggctcgaccgcc	Protospacer
*********  ********

39. spacer 11.4|1388229|19|NZ_AP022871|CRT matches to position: 6566593-6566611, mismatch: 2, identity: 0.895

gacggctggaacggcggac	CRISPR spacer
gacggcgggaacggcgcac	Protospacer
****** ********* **

40. spacer 11.6|1388307|19|NZ_AP022871|CRT matches to position: 9906922-9906940, mismatch: 2, identity: 0.895

agcggctggaacggcggac	CRISPR spacer
agccgcgggaacggcggac	Protospacer
*** ** ************

41. spacer 16.2|6490330|19|NZ_AP022871|CRISPRCasFinder matches to position: 3451365-3451383, mismatch: 2, identity: 0.895

gccacccccgggacggggt	CRISPR spacer
gccacctccgcgacggggt	Protospacer
******.*** ********

42. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 4274157-4274175, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tccgccgccggcgacgacc	Protospacer
************** * **

43. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 5268995-5269013, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tcccccgccggcgcggtcc	Protospacer
*** ********* *****

44. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 9484345-9484363, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tcggccgccggccaggtcc	Protospacer
** ********* ******

45. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 261333-261351, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tccggcgccggcgaggacc	Protospacer
**** *********** **

46. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 8004541-8004559, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tccgccggcggcgagggcc	Protospacer
******* ******** **

47. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 8929117-8929135, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tccgccgccggcgccgtcc	Protospacer
*************  ****

48. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 10139811-10139829, mismatch: 2, identity: 0.895

tccgccgccggcgaggtcc	CRISPR spacer
tccgccgcgggcgcggtcc	Protospacer
******** **** *****

49. spacer 16.5|6490471|19|NZ_AP022871|CRISPRCasFinder matches to position: 217299-217317, mismatch: 7, identity: 0.632

----tccgccgccggcgaggtcc	CRISPR spacer
ggaccccgccgccggcgga----	Protospacer
    .************..    

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1018879-1018897 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 749903-749921 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 394284-394302 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1583827-1583845 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 734300-734318 0 1.0
NZ_AP022871_11 11.1|1388112|19|NZ_AP022871|CRT 1388112-1388130 19 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1113509-1113527 0 1.0
NZ_AP022871_11 11.7|1388346|22|NZ_AP022871|CRT 1388346-1388367 22 NC_014819 Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence 52369-52390 2 0.909
NZ_AP022871_16 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder 6490372-6490393 22 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 47333-47354 2 0.909
NZ_AP022871_16 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder 6490372-6490393 22 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 70983-71004 2 0.909
NZ_AP022871_16 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder 6490372-6490393 22 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 116717-116738 2 0.909
NZ_AP022871_16 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder 6490372-6490393 22 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 263114-263135 2 0.909
NZ_AP022871_16 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder 6490372-6490393 22 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 120542-120563 2 0.909
NZ_AP022871_19 19.2|7659418|35|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659418-7659452 35 CP058906 Micromonospora phage pMLP1, complete sequence 20560-20594 3 0.914
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 209561-209592 4 0.875
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP017664 Cronobacter sp. JZ38 plasmid unnamed2, complete sequence 71322-71354 4 0.879
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 21798-21828 5 0.839
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 6254-6284 5 0.839
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 18620-18650 5 0.839
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 20871-20901 5 0.839
NZ_AP022871_4 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR 317505-317538 34 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 145584-145617 5 0.853
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN703407 Microbacterium phage Leaf, complete genome 14598-14629 5 0.844
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN703414 Microbacterium phage Dewdrop, complete genome 14598-14629 5 0.844
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 24485-24515 6 0.806
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 24467-24497 6 0.806
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 7917-7947 6 0.806
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 6253-6284 6 0.812
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 18619-18650 6 0.812
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 21798-21829 6 0.812
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 20870-20901 6 0.812
NZ_AP022871_1 1.21|287524|33|NZ_AP022871|CRT 287524-287556 33 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 24484-24516 6 0.818
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 KR080197 Mycobacterium phage FlagStaff, complete genome 37996-38029 6 0.824
NZ_AP022871_4 4.43|318374|34|NZ_AP022871|CRISPRCasFinder,PILER-CR 318374-318407 34 NZ_CP008954 Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence 244-277 6 0.824
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 MT711977 Streptomyces phage Dagobah, complete genome 40839-40870 6 0.812
NZ_AP022871_6 6.3|327968|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 327968-328000 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 45730-45762 6 0.818
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK864266 Gordonia phage Arri, complete genome 20700-20731 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MN284907 Gordonia phage Fireball, complete genome 20136-20167 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK864264 Gordonia phage VanDeWege, complete genome 20810-20841 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MH479910 Gordonia phage Danyall, complete genome 20518-20549 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MT639651 Gordonia phage Portcullis, complete genome 20046-20077 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MH479917 Gordonia phage KimmyK, complete genome 20718-20749 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MH669015 Gordonia phage TillyBobJoe, complete genome 19801-19832 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK814761 Gordonia phage SmokingBunny, complete genome 20002-20033 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 KX557286 Gordonia phage Twister6, complete genome 20429-20460 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK864267 Gordonia phage Valary, complete genome 20938-20969 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK967381 Gordonia phage RogerDodger, complete genome 20896-20927 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MT310872 Gordonia phage Evamon, complete genome 20004-20035 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MT521998 Gordonia phage Jambalaya, complete genome 19783-19814 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK864265 Gordonia phage Barb, complete genome 20718-20749 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_030913 Gordonia phage Wizard, complete genome 20136-20167 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MK305889 Gordonia phage Mutzi, complete genome 20460-20491 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MN010760 Gordonia phage Nubi, complete genome 20024-20055 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MN234196 Gordonia phage CloverMinnie, complete genome 21168-21199 6 0.812
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 28391-28422 6 0.812
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 124622-124653 6 0.812
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 484181-484213 6 0.818
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 563219-563251 6 0.818
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 118801-118832 6 0.812
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 34142-34173 6 0.812
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 532885-532917 6 0.818
NZ_AP022871_7 7.25|347267|33|NZ_AP022871|CRISPRCasFinder,CRT 347267-347299 33 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 179468-179500 6 0.818
NZ_AP022871_7 7.27|347389|33|NZ_AP022871|CRISPRCasFinder,CRT 347389-347421 33 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 212586-212618 6 0.818
NZ_AP022871_9 9.42|355796|32|NZ_AP022871|CRISPRCasFinder,CRT 355796-355827 32 NZ_CP021374 Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence 2919-2950 6 0.812
NZ_AP022871_9 9.49|356222|32|NZ_AP022871|CRISPRCasFinder,CRT 356222-356253 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 134867-134898 6 0.812
NZ_AP022871_9 9.53|356463|32|NZ_AP022871|CRISPRCasFinder,CRT 356463-356494 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 791768-791799 6 0.812
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 MK875794 Microbacterium phage Chepli, complete genome 38397-38429 6 0.818
NZ_AP022871_22 22.1|9252929|30|NZ_AP022871|CRISPRCasFinder 9252929-9252958 30 NZ_CP007515 Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence 92737-92766 6 0.8
NZ_AP022871_22 22.1|9252929|30|NZ_AP022871|CRISPRCasFinder 9252929-9252958 30 NZ_CP007517 Rubrobacter radiotolerans strain RSPS-4 plasmid 3, complete sequence 39984-40013 6 0.8
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 877348-877378 7 0.774
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 293129-293159 7 0.774
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 36588-36618 7 0.774
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 90198-90228 7 0.774
NZ_AP022871_1 1.11|287403|32|NZ_AP022871|CRISPRCasFinder 287403-287434 32 MN478374 Bacteriophage Phobos, complete genome 4431-4462 7 0.781
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1227012-1227042 7 0.774
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP007143 Hymenobacter swuensis DY53 plasmid pHsw2, complete sequence 16729-16759 7 0.774
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1758715-1758745 7 0.774
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 135724-135754 7 0.774
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 54547-54577 7 0.774
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MG812490 Mycobacterium phage Holeinone, complete genome 18741-18772 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH051249 Mycobacterium phage Boyle, complete genome 18864-18895 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN428049 Mycobacterium phage West99, complete genome 18863-18894 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN586045 Mycobacterium phage Brownie5, complete genome 18863-18894 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH001452 Mycobacterium phage Kheth, complete genome 18746-18777 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH697584 Mycobacterium phage FrenchFry, complete genome 18863-18894 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MG757162 Mycobacterium phage Opia, complete genome 18743-18774 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MK814751 Mycobacterium phage Bananafish, complete genome 18739-18770 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 KT365402 Mycobacterium phage Tres, complete genome 18743-18774 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 JN698991 Mycobacterium phage Hedgerow, complete genome 18845-18876 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN586046 Mycobacterium phage Tinciduntsolum, complete genome 18862-18893 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MT639652 Mycobacterium phage MasterPo, complete genome 18743-18774 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MK620898 Mycobacterium phage Coffee, complete genome 18856-18887 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 JN699004 Mycobacterium phage Ares, complete genome 18746-18777 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 KR997932 Mycobacterium phage Godines, complete genome 18756-18787 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 AY129334 Mycobacterium phage Rosebush, complete genome 18860-18891 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH590591 Mycobacterium phage Sabella, complete genome 18746-18777 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 KX443696 Mycobacterium phage Laurie, complete genome 18737-18768 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH727546 Mycobacterium phage Eaglehorse, complete genome 18764-18795 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MK061411 Mycobacterium phage Faze9, complete genome 18860-18891 7 0.781
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 KT880194 Mycobacterium phage Glass, complete genome 18863-18894 7 0.781
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 20333-20364 7 0.781
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 90197-90228 7 0.781
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 877348-877379 7 0.781
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 293129-293160 7 0.781
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 36588-36619 7 0.781
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MG872834 Gordonia phage Confidence, complete genome 37098-37130 7 0.788
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 20333-20365 7 0.788
NZ_AP022871_3 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 298405-298437 33 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 303304-303336 7 0.788
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 317547-317580 7 0.794
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1318040-1318071 7 0.781
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 920136-920167 7 0.781
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 577026-577057 7 0.781
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 AP018707 Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence 17899-17931 7 0.788
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 AP018708 Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence 17983-18015 7 0.788
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 118206-118238 7 0.788
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 5177-5209 7 0.788
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 MN536506 Uncultured bacterium plasmid pEN1, complete sequence 36046-36078 7 0.788
NZ_AP022871_6 6.10|328396|32|NZ_AP022871|CRISPRCasFinder 328396-328427 32 NC_021709 Alteromonas mediterranea 615 plasmid unnamed, complete sequence 135700-135731 7 0.781
NZ_AP022871_6 6.10|328396|32|NZ_AP022871|CRISPRCasFinder 328396-328427 32 NC_019408 Caulobacter phage CcrRogue, complete genome 87354-87385 7 0.781
NZ_AP022871_6 6.10|328396|32|NZ_AP022871|CRISPRCasFinder 328396-328427 32 MH588544 Caulobacter phage CcrBL10, complete genome 86134-86165 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 944703-944734 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 868421-868452 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 MN369758 Gordonia phage NHagos, complete genome 19760-19791 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 69102-69133 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 508050-508081 7 0.781
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 97094-97125 7 0.781
NZ_AP022871_6 6.16|328758|32|NZ_AP022871|CRISPRCasFinder 328758-328789 32 NZ_CP025585 Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-02, complete sequence 7835-7866 7 0.781
NZ_AP022871_6 6.17|328818|32|NZ_AP022871|CRISPRCasFinder 328818-328849 32 NC_018532 Arthrobacter sp. Rue61a plasmid p232, complete sequence 41066-41097 7 0.781
NZ_AP022871_6 6.17|328818|32|NZ_AP022871|CRISPRCasFinder 328818-328849 32 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 43118-43149 7 0.781
NZ_AP022871_6 6.24|329253|31|NZ_AP022871|CRISPRCasFinder 329253-329283 31 MN334766 Serratia phage PCH45, complete genome 140039-140069 7 0.774
NZ_AP022871_7 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT 346176-346208 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 21455-21487 7 0.788
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 331075-331106 7 0.781
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LQ277708 Sequence 3 from Patent WO2016071503 26851-26882 7 0.781
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LZ998058 JP 2017534684-A/5: Phage Therapy 26179-26210 7 0.781
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LQ277710 Sequence 5 from Patent WO2016071503 26179-26210 7 0.781
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LZ998056 JP 2017534684-A/3: Phage Therapy 26851-26882 7 0.781
NZ_AP022871_7 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT 346357-346389 33 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 534847-534879 7 0.788
NZ_AP022871_7 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT 346357-346389 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 760039-760071 7 0.788
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 160193-160224 7 0.781
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 434222-434253 7 0.781
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 434230-434261 7 0.781
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1232432-1232463 7 0.781
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 581101-581132 7 0.781
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1175581-1175613 7 0.788
NZ_AP022871_8 8.10|351052|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 351052-351084 33 NC_015162 Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence 147244-147276 7 0.788
NZ_AP022871_8 8.14|350624|33|NZ_AP022871|CRT 350624-350656 33 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 142410-142442 7 0.788
NZ_AP022871_9 9.39|355613|32|NZ_AP022871|CRISPRCasFinder,CRT 355613-355644 32 NC_001387 Streptomyces lividans plasmid pIJ101, complete sequence 3000-3031 7 0.781
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 777297-777328 7 0.781
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1035773-1035804 7 0.781
NZ_AP022871_9 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT 356162-356192 31 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 186376-186406 7 0.774
NZ_AP022871_9 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT 356162-356192 31 MG812491 Mycobacterium phage ItsyBitsy1, complete genome 38903-38933 7 0.774
NZ_AP022871_9 9.59|356828|32|NZ_AP022871|CRISPRCasFinder,CRT 356828-356859 32 NC_011961 Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence 152298-152329 7 0.781
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022371 Bosea sp. AS-1 plasmid unnamed2, complete sequence 71805-71836 7 0.781
NZ_AP022871_15 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder 6145232-6145262 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1042603-1042633 7 0.774
NZ_AP022871_15 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder 6145232-6145262 31 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 644333-644363 7 0.774
NZ_AP022871_15 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder 6145232-6145262 31 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 301589-301619 7 0.774
NZ_AP022871_19 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659632-7659663 32 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 253845-253876 7 0.781
NZ_AP022871_19 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659700-7659730 31 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 317487-317517 7 0.774
NZ_AP022871_19 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659700-7659730 31 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 731062-731092 7 0.774
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 819001-819032 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 241260-241291 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1821542-1821573 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1882870-1882901 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1844510-1844541 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 827337-827368 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 16327-16358 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1881481-1881512 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1084411-1084442 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1903715-1903746 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 2047963-2047994 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1529348-1529379 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 608813-608844 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1811912-1811943 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 419147-419178 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 787170-787201 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 488203-488234 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1889788-1889819 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 583514-583545 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1599422-1599453 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1828864-1828895 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1828958-1828989 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1823735-1823766 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1892451-1892482 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1280122-1280153 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1763260-1763291 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1825086-1825117 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1901267-1901298 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1892418-1892449 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1798740-1798771 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1876239-1876270 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1891161-1891192 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1792173-1792204 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1799052-1799083 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1876239-1876270 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1891260-1891291 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1798740-1798771 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1792822-1792853 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1797943-1797974 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1876239-1876270 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1876239-1876270 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1876239-1876270 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1891256-1891287 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1953117-1953148 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1891245-1891276 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1792198-1792229 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1807365-1807396 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1788001-1788032 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1849108-1849139 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1879017-1879048 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1873554-1873585 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1891245-1891276 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1792198-1792229 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1799051-1799082 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1826160-1826191 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1892241-1892272 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1792198-1792229 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1792198-1792229 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1891256-1891287 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1876244-1876275 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 126253-126284 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1891267-1891298 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1891068-1891099 8 0.75
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 126253-126284 8 0.75
NZ_AP022871_1 1.10|287342|32|NZ_AP022871|CRISPRCasFinder 287342-287373 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 207693-207724 8 0.75
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1630651-1630681 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1630649-1630679 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1536658-1536688 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1479858-1479888 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1942360-1942390 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 21045-21075 8 0.742
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 995135-995165 8 0.742
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 140515-140546 8 0.75
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 656274-656305 8 0.75
NZ_AP022871_1 1.21|287524|33|NZ_AP022871|CRT 287524-287556 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1227011-1227043 8 0.758
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MK284520 Gordonia phage Lilas, complete genome 40046-40078 8 0.758
NZ_AP022871_3 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 298405-298437 33 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 13476-13508 8 0.758
NZ_AP022871_3 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 298405-298437 33 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 288700-288732 8 0.758
NZ_AP022871_3 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 298405-298437 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1032899-1032931 8 0.758
NZ_AP022871_3 3.29|300219|35|NZ_AP022871|CRISPRCasFinder,CRT 300219-300253 35 NZ_CP045373 Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence 66242-66276 8 0.771
NZ_AP022871_3 3.29|300219|35|NZ_AP022871|CRISPRCasFinder,CRT 300219-300253 35 NZ_CP018081 Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence 182643-182677 8 0.771
NZ_AP022871_3 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300881-300913 33 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 12655-12687 8 0.758
NZ_AP022871_3 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300881-300913 33 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 5503-5535 8 0.758
NZ_AP022871_3 3.52|301902|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 301902-301939 38 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 36303-36340 8 0.789
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 1029729-1029762 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 546730-546763 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 558204-558237 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 545500-545533 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 586294-586327 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 542678-542711 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 572605-572638 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 358909-358942 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 559404-559437 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 557100-557133 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 558204-558237 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 572605-572638 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 542678-542711 8 0.765
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 544636-544669 8 0.765
NZ_AP022871_4 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR 317505-317538 34 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 46824-46857 8 0.765
NZ_AP022871_4 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR 317505-317538 34 NZ_CP009433 Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_1, complete sequence 138139-138172 8 0.765
NZ_AP022871_4 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR 317505-317538 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 124514-124547 8 0.765
NZ_AP022871_4 4.57|319437|34|NZ_AP022871|CRISPRCasFinder 319437-319470 34 NZ_CP029362 Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence 93438-93471 8 0.765
NZ_AP022871_4 4.57|319437|34|NZ_AP022871|CRISPRCasFinder 319437-319470 34 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 27634-27667 8 0.765
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 476211-476242 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 25604-25635 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 32695-32726 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 333307-333338 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 622229-622260 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 239939-239970 8 0.75
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 4067-4098 8 0.75
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 46764-46796 8 0.758
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 289909-289941 8 0.758
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 193596-193628 8 0.758
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 29720-29752 8 0.758
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 89619-89651 8 0.758
NZ_AP022871_6 6.16|328758|32|NZ_AP022871|CRISPRCasFinder 328758-328789 32 MT094430 Pseudomonas phage BIM BV-45, complete genome 14260-14291 8 0.75
NZ_AP022871_6 6.17|328818|32|NZ_AP022871|CRISPRCasFinder 328818-328849 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 719962-719993 8 0.75
NZ_AP022871_6 6.17|328818|32|NZ_AP022871|CRISPRCasFinder 328818-328849 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 118196-118227 8 0.75
NZ_AP022871_6 6.17|328818|32|NZ_AP022871|CRISPRCasFinder 328818-328849 32 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 118196-118227 8 0.75
NZ_AP022871_6 6.24|329253|31|NZ_AP022871|CRISPRCasFinder 329253-329283 31 MH590599 Streptomyces phage Karimac, complete genome 114374-114404 8 0.742
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 123493-123524 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 88533-88564 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 123675-123706 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 147650-147681 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 KC294142 Pseudomonas phage PaP4 26081-26112 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NC_010325 Pseudomonas phage LUZ24, complete genome 26705-26736 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MT108724 Pseudomonas phage Epa2, complete genome 36424-36455 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LZ998057 JP 2017534684-A/4: Phage Therapy 26551-26582 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MG589386 Pseudomonas phage phiPA01_EW, complete genome 19205-19236 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MK837012 Pseudomonas virus Pa223, complete genome 26788-26819 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN562749 Pseudomonas phage U47, complete genome 24468-24499 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN553586 UNVERIFIED: Pseudomonas phage phiKMVC5-4, complete genome 39067-39098 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LQ277709 Sequence 4 from Patent WO2016071503 26551-26582 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NC_042343 Pseudomonas phage PaP4, complete genome 26081-26112 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MH973725 Pseudomonas phage SaPL, complete genome 23874-23905 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MT119371 Pseudomonas phage oldone, complete genome 26787-26818 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MG589385 Pseudomonas phage phiPA01_302, complete genome 26810-26841 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN508619 UNVERIFIED: Pseudomonas phage Paer4, complete genome 38910-38941 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MK837011 Pseudomonas virus Pa222, complete genome 26796-26827 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MG432151 Pseudomonas phage Delta, complete genome 18828-18859 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 HG518155 Pseudomonas phage TL complete genome 26745-26776 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MN871484 UNVERIFIED: Pseudomonas phage PaSz-8_45_45k, complete genome 18416-18447 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 LN610578 Pseudomonas phage vB_PaeP_C2-10_Ab22, complete genome 26913-26944 8 0.75
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 MF768469 Pseudomonas phage SL4, complete genome 9374-9405 8 0.75
NZ_AP022871_7 7.9|346297|32|NZ_AP022871|CRISPRCasFinder,CRT 346297-346328 32 NZ_CP021375 Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence 57675-57706 8 0.75
NZ_AP022871_7 7.16|346721|33|NZ_AP022871|CRISPRCasFinder,CRT 346721-346753 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 708340-708372 8 0.758
NZ_AP022871_7 7.17|346782|33|NZ_AP022871|CRISPRCasFinder,CRT 346782-346814 33 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 456703-456735 8 0.758
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 MK356558 Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence 8446-8478 8 0.758
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 443447-443479 8 0.758
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 254721-254753 8 0.758
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 91950-91982 8 0.758
NZ_AP022871_7 7.19|346904|33|NZ_AP022871|CRISPRCasFinder,CRT 346904-346936 33 NZ_AP014708 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence 18106-18138 8 0.758
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NZ_LR594664 Variovorax sp. RA8 plasmid 3 213448-213480 8 0.758
NZ_AP022871_7 7.27|347389|33|NZ_AP022871|CRISPRCasFinder,CRT 347389-347421 33 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 160173-160205 8 0.758
NZ_AP022871_7 7.28|347450|33|NZ_AP022871|CRISPRCasFinder,CRT 347450-347482 33 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 375754-375786 8 0.758
NZ_AP022871_7 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT 347511-347543 33 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 145312-145344 8 0.758
NZ_AP022871_7 7.30|347572|33|NZ_AP022871|CRISPRCasFinder,CRT 347572-347604 33 NC_014028 Salinibacter ruber M8 plasmid pSR56, complete sequence 51994-52026 8 0.758
NZ_AP022871_8 8.7|350869|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 350869-350901 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 94762-94794 8 0.758
NZ_AP022871_8 8.9|350991|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 350991-351023 33 NZ_CP021213 Sinorhizobium meliloti RU11/001 plasmid pSmeRU11a, complete sequence 17229-17261 8 0.758
NZ_AP022871_9 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT 355308-355339 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 847319-847350 8 0.75
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 14444-14475 8 0.75
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 26810-26841 8 0.75
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 13607-13638 8 0.75
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 4453-4484 8 0.75
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_AP022585 Mycobacterium marseillense strain JCM 17324 plasmid pJCM17324, complete sequence 13633-13664 8 0.75
NZ_AP022871_9 9.42|355796|32|NZ_AP022871|CRISPRCasFinder,CRT 355796-355827 32 AY328852 Vibrio parahaemolyticus phage VP16T, partial sequence 23587-23618 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010613 Phaeobacter inhibens strain P92 plasmid pP92_c, complete sequence 42706-42737 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010625 Phaeobacter inhibens strain P51 plasmid pP51_b, complete sequence 42701-42732 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010670 Phaeobacter inhibens strain P57 plasmid pP57_b, complete sequence 42701-42732 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010597 Phaeobacter inhibens strain P10 plasmid pP10_b, complete sequence 42714-42745 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NC_018287 Phaeobacter inhibens DSM 17395 plasmid pPGA1_78, complete sequence 36887-36918 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010632 Phaeobacter inhibens strain P78 plasmid pP78_c, complete sequence 33353-33384 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP031954 Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence 53298-53329 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NC_018423 Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence 53184-53215 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010659 Phaeobacter piscinae strain P71 plasmid pP71_c, complete sequence 33178-33209 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010761 Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence 42698-42729 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010604 Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence 42698-42729 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP031950 Phaeobacter inhibens strain BS107 plasmid unnamed2, complete sequence 36887-36918 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010743 Phaeobacter inhibens strain P59 plasmid pP59_b, complete sequence 42699-42730 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010620 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_c, complete sequence 46377-46408 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010731 Phaeobacter inhibens strain P88 plasmid pP88_f, complete sequence 42697-42728 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010653 Phaeobacter inhibens strain P54 plasmid pP54_c, complete sequence 42677-42708 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010710 Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence 42698-42729 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010701 Phaeobacter inhibens strain P24 plasmid pP24_e, complete sequence 42701-42732 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010747 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_b, complete sequence 42705-42736 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP019310 Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-3, complete sequence 18579-18610 8 0.75
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP010738 Phaeobacter inhibens strain P72 plasmid pP72_c, complete sequence 42703-42734 8 0.75
NZ_AP022871_9 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT 356162-356192 31 NZ_CP009295 Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence 34541-34571 8 0.742
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 120732-120763 8 0.75
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 66891-66922 8 0.75
NZ_AP022871_9 9.56|356646|31|NZ_AP022871|CRISPRCasFinder,CRT 356646-356676 31 NZ_CP034650 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH29, complete sequence 4204-4234 8 0.742
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 35060-35091 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP009572 Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence 141489-141520 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592391 Vibrio phage 1.004.O._10N.261.54.A2, partial genome 21939-21970 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592449 Vibrio phage 1.072.O._10N.286.48.A12, partial genome 23196-23227 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592443 Vibrio phage 1.066.O._10N.286.46.E8, partial genome 26481-26512 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592421 Vibrio phage 1.037.O._10N.261.52.F7, partial genome 22461-22492 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592436 Vibrio phage 1.056.O._10N.261.48.C11, partial genome 26497-26528 8 0.75
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MG592445 Vibrio phage 1.068.O._10N.261.51.F8, partial genome 26545-26576 8 0.75
NZ_AP022871_9 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT 357072-357103 32 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 361016-361047 8 0.75
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 279567-279598 8 0.75
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 MN234206 Arthrobacter phage Racecar, complete genome 167568-167599 8 0.75
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 65348-65378 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 64037-64067 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 86199-86229 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 349694-349724 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 89590-89620 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 106343-106373 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NC_004719 Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence 1295-1325 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 20291-20321 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 118094-118124 8 0.742
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 441713-441743 8 0.742
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 643016-643048 8 0.758
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1251423-1251455 8 0.758
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1146401-1146433 8 0.758
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1146347-1146379 8 0.758
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 634984-635016 8 0.758
NZ_AP022871_19 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659700-7659730 31 NZ_CP053445 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eA, complete sequence 70134-70164 8 0.742
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 539022-539052 9 0.71
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 132760-132790 9 0.71
NZ_AP022871_1 1.8|287221|31|NZ_AP022871|CRISPRCasFinder 287221-287251 31 MF417932 Uncultured Caudovirales phage clone 3S_12, partial genome 12141-12171 9 0.71
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 32820-32851 9 0.719
NZ_AP022871_1 1.9|287281|32|NZ_AP022871|CRISPRCasFinder 287281-287312 32 MH697589 Microbacterium phage Neferthena, complete genome 29670-29701 9 0.719
NZ_AP022871_1 1.11|287403|32|NZ_AP022871|CRISPRCasFinder 287403-287434 32 NZ_CP007792 Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence 55567-55598 9 0.719
NZ_AP022871_1 1.11|287403|32|NZ_AP022871|CRISPRCasFinder 287403-287434 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 811367-811398 9 0.719
NZ_AP022871_1 1.12|287464|32|NZ_AP022871|CRISPRCasFinder 287464-287495 32 NC_020060 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence 203467-203498 9 0.719
NZ_AP022871_1 1.13|287525|31|NZ_AP022871|CRISPRCasFinder 287525-287555 31 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 15350-15380 9 0.71
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 379936-379967 9 0.719
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 6071-6102 9 0.719
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1752458-1752489 9 0.719
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MG872834 Gordonia phage Confidence, complete genome 37099-37130 9 0.719
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 83545-83576 9 0.719
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 76345-76376 9 0.719
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 54754-54785 9 0.719
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 MF417932 Uncultured Caudovirales phage clone 3S_12, partial genome 12140-12171 9 0.719
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 132759-132790 9 0.719
NZ_AP022871_1 1.21|287524|33|NZ_AP022871|CRT 287524-287556 33 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 15349-15381 9 0.727
NZ_AP022871_3 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 299642-299674 33 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 89782-89814 9 0.727
NZ_AP022871_3 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 299642-299674 33 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 13138-13170 9 0.727
NZ_AP022871_3 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 299642-299674 33 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 863431-863463 9 0.727
NZ_AP022871_3 3.24|299857|39|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 299857-299895 39 NC_028827 Streptomyces phage Lannister, complete genome 1786-1824 9 0.769
NZ_AP022871_3 3.26|300005|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 300005-300038 34 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 10655-10688 9 0.735
NZ_AP022871_3 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300881-300913 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1783809-1783841 9 0.727
NZ_AP022871_3 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300881-300913 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 937228-937260 9 0.727
NZ_AP022871_3 3.43|301234|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 301234-301271 38 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 41131-41168 9 0.763
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 194307-194340 9 0.735
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 246214-246247 9 0.735
NZ_AP022871_3 3.55|302122|36|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302122-302157 36 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 598246-598281 9 0.75
NZ_AP022871_4 4.29|317357|36|NZ_AP022871|CRISPRCasFinder 317357-317392 36 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 255309-255344 9 0.75
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 KX523125 Mycobacterium phage BuzzBuzz, complete genome 24575-24607 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 KC661272 Mycobacterium phage Methuselah, complete genome 24571-24603 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MF185729 Mycobacterium phage KADY, complete genome 24575-24607 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MN096368 Mycobacterium phage Soshari, complete genome 24571-24603 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MT897907 Mycobacterium phage Grif, complete genome 24571-24603 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 NC_004682 Mycobacterium virus Bxz2, complete genome 24582-24614 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MK433273 Mycobacterium phage Daishi, complete genome 23416-23448 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 KX670788 Mycobacterium phage Louie6, complete genome 24575-24607 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MN585984 Mycobacterium phage AgronaGT15, complete genome 24396-24428 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 MH513975 Mycobacterium phage Misomonster, complete genome 24574-24606 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 KP017310 Mycobacterium phage Phoxy, complete genome 24572-24604 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 NC_028757 Mycobacterium phage Tiffany, complete genome 24382-24414 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 KP017311 Mycobacterium phage Spike509, complete genome 24572-24604 9 0.727
NZ_AP022871_4 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 317869-317901 33 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 82069-82101 9 0.727
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 MN096362 Arthrobacter phage Vibaki, complete genome 37193-37224 9 0.719
NZ_AP022871_4 4.57|319437|34|NZ_AP022871|CRISPRCasFinder 319437-319470 34 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 254537-254570 9 0.735
NZ_AP022871_4 4.57|319437|34|NZ_AP022871|CRISPRCasFinder 319437-319470 34 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 168432-168465 9 0.735
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 350651-350682 9 0.719
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP042810 Acetobacter oryzoeni strain B6 plasmid unnamed2, complete sequence 82579-82610 9 0.719
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 696753-696784 9 0.719
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 309241-309272 9 0.719
NZ_AP022871_6 6.6|328151|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328151-328183 33 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 115010-115042 9 0.727
NZ_AP022871_6 6.6|328151|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328151-328183 33 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 2847-2879 9 0.727
NZ_AP022871_6 6.10|328396|32|NZ_AP022871|CRISPRCasFinder 328396-328427 32 MK310226 Halobacterium virus ChaoS9, complete genome 37114-37145 9 0.719
NZ_AP022871_6 6.10|328396|32|NZ_AP022871|CRISPRCasFinder 328396-328427 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1651315-1651346 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 662560-662591 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 182945-182976 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 146870-146901 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_019408 Caulobacter phage CcrRogue, complete genome 161061-161092 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 53325-53356 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 111409-111440 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 191107-191138 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP048420 Sphingomonas insulae strain KCTC 12872 plasmid unnamed2, complete sequence 15470-15501 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 53198-53229 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP015745 Shinella sp. HZN7 plasmid pShin-09, complete sequence 96930-96961 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP011044 Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence 9803-9834 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 240508-240539 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_015258 Polymorphum gilvum SL003B-26A1 plasmid pSL003B, complete sequence 43954-43985 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 316137-316168 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 66121-66152 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP021035 Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence 9803-9834 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP021039 Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence 9803-9834 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 283631-283662 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 2104505-2104536 9 0.719
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 719601-719632 9 0.719
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1240932-1240963 9 0.719
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 858604-858635 9 0.719
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1168025-1168056 9 0.719
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 678100-678131 9 0.719
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 KT021004 Thermobifida phage P1312, complete genome 43948-43980 9 0.727
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 465483-465515 9 0.727
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 MT639640 Gordonia phage Paries, complete genome 21363-21395 9 0.727
NZ_AP022871_7 7.6|346115|33|NZ_AP022871|CRISPRCasFinder,CRT 346115-346147 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 434960-434992 9 0.727
NZ_AP022871_7 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT 346176-346208 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 183008-183040 9 0.727
NZ_AP022871_7 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT 346357-346389 33 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 379149-379181 9 0.727
NZ_AP022871_7 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT 346357-346389 33 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 329196-329228 9 0.727
NZ_AP022871_7 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT 346357-346389 33 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 385737-385769 9 0.727
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1255131-1255162 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1309614-1309645 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1180063-1180094 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1239773-1239804 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1179160-1179191 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1212094-1212125 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1212085-1212116 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1180055-1180086 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1179411-1179442 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1180046-1180077 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 25088-25119 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1255250-1255281 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1255234-1255265 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 154180-154211 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP038257 Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence 78146-78177 9 0.719
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1255226-1255257 9 0.719
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 268995-269027 9 0.727
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 355431-355463 9 0.727
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 439060-439092 9 0.727
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 255756-255788 9 0.727
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 268061-268093 9 0.727
NZ_AP022871_7 7.20|346965|31|NZ_AP022871|CRISPRCasFinder,CRT 346965-346995 31 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 370500-370530 9 0.71
NZ_AP022871_7 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT 347511-347543 33 NZ_CP043619 Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence 120151-120183 9 0.727
NZ_AP022871_7 7.30|347572|33|NZ_AP022871|CRISPRCasFinder,CRT 347572-347604 33 NZ_CP018048 Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence 127105-127137 9 0.727
NZ_AP022871_8 8.12|351174|32|NZ_AP022871|CRISPRCasFinder,CRT 351174-351205 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 68227-68258 9 0.719
NZ_AP022871_9 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT 355308-355339 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 433682-433713 9 0.719
NZ_AP022871_9 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT 355308-355339 32 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 118390-118421 9 0.719
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NZ_CP031954 Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence 28899-28930 9 0.719
NZ_AP022871_9 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT 355735-355766 32 NC_018423 Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence 28785-28816 9 0.719
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 442258-442289 9 0.719
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 188162-188193 9 0.719
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 544919-544950 9 0.719
NZ_AP022871_9 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT 356101-356132 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 447672-447703 9 0.719
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 NC_014911 Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence 34603-34634 9 0.719
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1193246-1193277 9 0.719
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 NZ_CP029540 Aquitalea sp. USM4 plasmid unnamed, complete sequence 8420-8451 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 327578-327609 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 587643-587674 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 604620-604651 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 80272-80303 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 123572-123603 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 382307-382338 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 AB863625 Ralstonia phage RSK1 DNA, complete genome 31371-31402 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MT740732 Ralstonia phage Darius, complete genome 52283-52314 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MT740737 Ralstonia phage Firinga, complete genome 34429-34460 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MT740741 Ralstonia phage Hennie, complete genome 25745-25776 9 0.719
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 MT740740 Ralstonia phage Gervaise, complete genome 58226-58257 9 0.719
NZ_AP022871_9 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT 357072-357103 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1524962-1524993 9 0.719
NZ_AP022871_9 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT 357072-357103 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 288298-288329 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1673105-1673136 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 956552-956583 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1456212-1456243 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 964656-964687 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1047380-1047411 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 955951-955982 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 853093-853124 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1061840-1061871 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1610007-1610038 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 879794-879825 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1037675-1037706 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 180144-180175 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1056778-1056809 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1232008-1232039 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 839061-839092 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 796648-796679 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1097787-1097818 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1047387-1047418 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1385168-1385199 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 957808-957839 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1657325-1657356 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 69492-69523 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1446087-1446118 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1045426-1045457 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 925217-925248 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 761458-761489 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 970221-970252 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 872277-872308 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 852208-852239 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 857703-857734 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 857693-857724 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 966924-966955 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1202157-1202188 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1300036-1300067 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 853085-853116 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 853105-853136 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 853077-853108 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 120447-120478 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 965088-965119 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1022432-1022463 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1045415-1045446 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1202124-1202155 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1052347-1052378 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1079909-1079940 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1200929-1200960 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1299980-1300011 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 930360-930391 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1052347-1052378 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1079909-1079940 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 975976-976007 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 788375-788406 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1200966-1200997 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1052347-1052378 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 933739-933770 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 956633-956664 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 930383-930414 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1052351-1052382 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1079909-1079940 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1079909-1079940 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1079909-1079940 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1200966-1200997 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 997378-997409 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1200955-1200986 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 930383-930414 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 969394-969425 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 956631-956662 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 950075-950106 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 998022-998053 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1044172-1044203 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1105251-1105282 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1200955-1200986 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 930383-930414 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1052346-1052377 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1129272-1129303 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1202122-1202153 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 930383-930414 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 930383-930414 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1200966-1200997 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1079910-1079941 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 983569-983600 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1200977-1201008 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1200955-1200986 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 983569-983600 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 956615-956646 9 0.719
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NC_047993 Microbacterium phage Quhwah, complete genome 3272-3303 9 0.719
NZ_AP022871_9 9.67|357332|32|NZ_AP022871|CRISPRCasFinder,CRT 357332-357363 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 149412-149443 9 0.719
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 88618-88648 9 0.71
NZ_AP022871_16 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder 6490417-6490447 31 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 273634-273664 9 0.71
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_LR723678 Arsenite-oxidising bacterium NT-25 plasmid 2 126998-127030 9 0.727
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 208219-208251 9 0.727
NZ_AP022871_19 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659632-7659663 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 364119-364150 9 0.719
NZ_AP022871_19 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659700-7659730 31 NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 313721-313751 9 0.71
NZ_AP022871_19 19.9|7659915|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659915-7659947 33 MK559428 Mycobacterium phage Elephantoon, complete genome 42526-42558 9 0.727
NZ_AP022871_1 1.6|287471|33|NZ_AP022871|PILER-CR 287471-287503 33 NC_020060 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence 203467-203499 10 0.697
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 148753-148784 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN892483 Microbacterium phage SonOfLevi, complete genome 13218-13249 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MK977697 Microbacterium phage Etta, complete genome 13220-13251 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MG925352 Microbacterium phage Nattles, complete genome 13222-13253 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN234163 Microbacterium phage Calix, complete genome 13216-13247 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN807246 Microbacterium phage Chamuel, complete genome 13218-13249 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MT310856 Microbacterium phage Zada, complete genome 12927-12958 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MG839017 Microbacterium phage Baines, complete genome 13223-13254 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN062703 Microbacterium phage McGalleon, complete genome 13800-13831 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MH045563 Microbacterium phage Robinson, complete genome 12927-12958 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MG962367 Microbacterium phage Gelo, complete genome 13220-13251 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 MN617840 Microbacterium phage Klimt, complete genome 13218-13249 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MK801727 Gordonia phage ThankyouJordi, complete genome 39555-39586 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MK284520 Gordonia phage Lilas, complete genome 40047-40078 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MK433274 Gordonia phage Bradissa, complete genome 38802-38833 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MK875793 Gordonia phage WelcomeAyanna, complete genome 39702-39733 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 MH513979 Gordonia phage Pollux, complete genome 39039-39070 10 0.688
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NZ_CP018078 Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence 1833-1864 10 0.688
NZ_AP022871_1 1.16|287220|32|NZ_AP022871|CRT 287220-287251 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 539022-539053 10 0.688
NZ_AP022871_1 1.20|287463|33|NZ_AP022871|CRT 287463-287495 33 NC_020060 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence 203467-203499 10 0.697
NZ_AP022871_1 1.21|287524|33|NZ_AP022871|CRT 287524-287556 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1942359-1942391 10 0.697
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MH513979 Gordonia phage Pollux, complete genome 39038-39070 10 0.697
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 83545-83577 10 0.697
NZ_AP022871_3 3.26|300005|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 300005-300038 34 NZ_CP015988 Sphingobium sp. EP60837 plasmid pEP1, complete sequence 238803-238836 10 0.706
NZ_AP022871_3 3.28|300146|37|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 300146-300182 37 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5948058-5948094 10 0.73
NZ_AP022871_3 3.35|300659|36|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300659-300694 36 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 178362-178397 10 0.722
NZ_AP022871_3 3.39|300950|35|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300950-300984 35 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 311638-311672 10 0.714
NZ_AP022871_3 3.39|300950|35|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 300950-300984 35 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 477488-477522 10 0.714
NZ_AP022871_3 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 302052-302085 34 MK305891 Streptomyces phage Gibson, complete genome 20931-20964 10 0.706
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 NZ_CP035418 Leisingera sp. NJS204 plasmid unnamed1, complete sequence 22789-22820 10 0.688
NZ_AP022871_4 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR 318742-318773 32 NZ_CP038237 Leisingera sp. NJS201 plasmid unnamed3, complete sequence 108445-108476 10 0.688
NZ_AP022871_4 4.57|319437|34|NZ_AP022871|CRISPRCasFinder 319437-319470 34 MT639641 Microbacterium phage Phinky, complete genome 62048-62081 10 0.706
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 260512-260543 10 0.688
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 168424-168455 10 0.688
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 289083-289114 10 0.688
NZ_AP022871_6 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR 328212-328244 33 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 189666-189698 10 0.697
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 310176-310207 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 310175-310206 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 471081-471112 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 79903-79934 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 320992-321023 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP042265 Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence 6116-6147 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 93775-93806 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 369643-369674 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP022192 Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence 30483-30514 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 364872-364903 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 250922-250953 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP046053 Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence 4248-4279 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 221442-221473 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1153666-1153697 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 516823-516854 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 269731-269762 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 92610-92641 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 141682-141713 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 81376-81407 10 0.688
NZ_AP022871_6 6.11|328456|32|NZ_AP022871|CRISPRCasFinder 328456-328487 32 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 165420-165451 10 0.688
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 202722-202753 10 0.688
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 333209-333241 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 339435-339467 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 336366-336398 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1327553-1327585 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 337625-337657 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 328747-328779 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 54083-54115 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP021357 Rhodococcus sp. S2-17 plasmid pRB11, complete sequence 44253-44285 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 347918-347950 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 227298-227330 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 339435-339467 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 339447-339479 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 339468-339500 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 339434-339466 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 337643-337675 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 329279-329311 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 333234-333266 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 329282-329314 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1760237-1760269 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 329282-329314 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 347901-347933 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 333233-333265 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 347865-347897 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 341244-341276 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 339373-339405 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 329282-329314 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 329282-329314 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 329282-329314 10 0.697
NZ_AP022871_6 6.14|328637|33|NZ_AP022871|CRISPRCasFinder 328637-328669 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 333229-333261 10 0.697
NZ_AP022871_6 6.15|328698|32|NZ_AP022871|CRISPRCasFinder 328698-328729 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 144361-144392 10 0.688
NZ_AP022871_7 7.2|345871|33|NZ_AP022871|CRISPRCasFinder,CRT 345871-345903 33 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 490549-490581 10 0.697
NZ_AP022871_7 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT 346176-346208 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 469604-469636 10 0.697
NZ_AP022871_7 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT 346237-346268 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 248910-248941 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP029792 Psychrobacter sp. YP14 plasmid pYP14c, complete sequence 2064-2095 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP016291 Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence 241250-241281 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 MN657041 Psychrobacter sp. strain ANT_P17 plasmid pA17P4, complete sequence 11441-11472 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 166208-166239 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 179537-179568 10 0.688
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NZ_CP012534 Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence 10651-10682 10 0.688
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 455476-455508 10 0.697
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 454685-454717 10 0.697
NZ_AP022871_7 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT 346843-346875 33 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 438813-438845 10 0.697
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NZ_CP009252 Corynebacterium stationis strain 622=DSM 20302 plasmid pCstat1, complete sequence 49029-49061 10 0.697
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NC_020553 Corynebacterium callunae DSM 20147 plasmid pCC2, complete sequence 8023-8055 10 0.697
NZ_AP022871_7 7.28|347450|33|NZ_AP022871|CRISPRCasFinder,CRT 347450-347482 33 NZ_CP023707 Edwardsiella tarda strain KC-Pc-HB1 plasmid pEh-Pc1, complete sequence 79381-79413 10 0.697
NZ_AP022871_8 8.2|350563|33|NZ_AP022871|CRISPRCasFinder,CRT 350563-350595 33 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 92489-92521 10 0.697
NZ_AP022871_8 8.3|350624|34|NZ_AP022871|CRISPRCasFinder 350624-350657 34 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 142410-142443 10 0.706
NZ_AP022871_8 8.10|351052|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 351052-351084 33 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 562614-562646 10 0.697
NZ_AP022871_8 8.11|351113|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 351113-351145 33 NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 118053-118085 10 0.697
NZ_AP022871_8 8.11|351113|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 351113-351145 33 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 34527-34559 10 0.697
NZ_AP022871_9 9.37|355491|32|NZ_AP022871|CRISPRCasFinder,CRT 355491-355522 32 MK929790 Caulobacter phage RW, complete genome 52286-52317 10 0.688
NZ_AP022871_9 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT 356283-356314 32 MK448672 Streptococcus phage Javan117, complete genome 35880-35911 10 0.688
NZ_AP022871_9 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT 356283-356314 32 MK448849 Streptococcus phage Javan128, complete genome 35300-35331 10 0.688
NZ_AP022871_9 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT 356283-356314 32 MK448856 Streptococcus phage Javan158, complete genome 14429-14460 10 0.688
NZ_AP022871_9 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT 356585-356616 32 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 135741-135772 10 0.688
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 440750-440781 10 0.688
NZ_AP022871_9 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT 356767-356798 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 694734-694765 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 6160-6191 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 254305-254336 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 112328-112359 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 847917-847948 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 475440-475471 10 0.688
NZ_AP022871_9 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT 357271-357302 32 MN234211 Arthrobacter phage Mimi, complete genome 166739-166770 10 0.688
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 205573-205605 10 0.697
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 560702-560734 10 0.697
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 291248-291280 10 0.697
NZ_AP022871_19 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659489-7659521 33 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 402245-402277 10 0.697
NZ_AP022871_19 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 7659632-7659663 32 NZ_CP025409 Paracoccus sp. BM15 plasmid pBM151, complete sequence 11463-11494 10 0.688
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 961836-961867 11 0.656
NZ_AP022871_1 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT 287585-287616 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 492098-492129 11 0.656
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 401386-401417 11 0.656
NZ_AP022871_1 1.15|287646|32|NZ_AP022871|CRISPRCasFinder 287646-287677 32 KU963249 Gordonia phage Yeezy, complete genome 36591-36622 11 0.656
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MK801727 Gordonia phage ThankyouJordi, complete genome 39554-39586 11 0.667
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MK433274 Gordonia phage Bradissa, complete genome 38801-38833 11 0.667
NZ_AP022871_1 1.22|287645|33|NZ_AP022871|CRT 287645-287677 33 MK875793 Gordonia phage WelcomeAyanna, complete genome 39701-39733 11 0.667
NZ_AP022871_3 3.9|298757|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT 298757-298790 34 NC_015592 Sinorhizobium meliloti AK83 plasmid pSINME02, complete sequence 25532-25565 11 0.676
NZ_AP022871_3 3.42|301160|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR 301160-301197 38 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 589168-589205 11 0.711
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 MH045556 Microbacterium phage BonaeVitae, complete genome 11098-11129 11 0.656
NZ_AP022871_6 6.1|327847|32|NZ_AP022871|CRISPRCasFinder 327847-327878 32 MN234191 Microbacterium phage Naby, complete genome 11098-11129 11 0.656
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 689924-689955 11 0.656
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 390535-390566 11 0.656
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 689924-689955 11 0.656
NZ_AP022871_6 6.12|328516|32|NZ_AP022871|CRISPRCasFinder 328516-328547 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 689939-689970 11 0.656
NZ_AP022871_6 6.20|329000|32|NZ_AP022871|CRISPRCasFinder 329000-329031 32 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 279190-279221 11 0.656
NZ_AP022871_7 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT 346176-346208 33 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 15561-15593 11 0.667
NZ_AP022871_7 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT 346601-346632 32 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 368333-368364 11 0.656
NZ_AP022871_7 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT 347024-347056 33 NZ_CP016024 Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence 230890-230922 11 0.667
NZ_AP022871_7 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT 347511-347543 33 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 148933-148965 11 0.667

1. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

2. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

3. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

4. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

5. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

6. spacer 11.1|1388112|19|NZ_AP022871|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgggaccgcgccg	CRISPR spacer
gccggctgggaccgcgccg	Protospacer
*******************

7. spacer 11.7|1388346|22|NZ_AP022871|CRT matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 2, identity: 0.909

accaggtgggacggcgctgggc	CRISPR spacer
gccaggtggtacggcgctgggc	Protospacer
.******** ************

8. spacer 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 2, identity: 0.909

acctccggcgccggggaaatcc	CRISPR spacer
atatccggcgccggggaaatcc	Protospacer
*. *******************

9. spacer 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 2, identity: 0.909

acctccggcgccggggaaatcc	CRISPR spacer
atatccggcgccggggaaatcc	Protospacer
*. *******************

10. spacer 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 2, identity: 0.909

acctccggcgccggggaaatcc	CRISPR spacer
atatccggcgccggggaaatcc	Protospacer
*. *******************

11. spacer 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 2, identity: 0.909

acctccggcgccggggaaatcc	CRISPR spacer
gcccccggcgccggggaaatcc	Protospacer
.**.******************

12. spacer 16.3|6490372|22|NZ_AP022871|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

acctccggcgccggggaaatcc	CRISPR spacer
atatccggcgccggggaaatcc	Protospacer
*. *******************

13. spacer 19.2|7659418|35|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 3, identity: 0.914

tgcatcagcgcaccttgaccttccggatcacgccg	CRISPR spacer
gccatcaccgcaccttgaccttccggatcacgccg	Protospacer
  ***** ***************************

14. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.875

tacccggt-gatcgccgggctcggcgccgcgat	CRISPR spacer
-acccggcggatcgccgggcccggcgccgtgat	Protospacer
 ******. ***********.********.***

15. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP017664 (Cronobacter sp. JZ38 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.879

aatatcaagcgccagaccggcgagcttgccgcg-	CRISPR spacer
gatatcaagccccataccggcgagc-tgccgcgg	Protospacer
.********* *** ********** ******* 

16. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 5, identity: 0.839

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatcggcctggccatcctggcggc	Protospacer
****************** *******..  *

17. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 5, identity: 0.839

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatcggcctggccatcctggcggc	Protospacer
****************** *******..  *

18. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 5, identity: 0.839

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatcggcctggccatcctggcggc	Protospacer
****************** *******..  *

19. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 5, identity: 0.839

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatcggcctggccatcctggcggc	Protospacer
****************** *******..  *

20. spacer 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 5, identity: 0.853

-cggtccacgccggccgggacgcgatcggtgtgga	CRISPR spacer
gtggtccgcg-cggccgtgacgcgatcggagtgga	Protospacer
 .*****.** ****** *********** *****

21. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 5, identity: 0.844

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
cagttgtggcggctggtcacggtgaccctggc	Protospacer
*** * . **** *******************

22. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 5, identity: 0.844

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
cagttgtggcggctggtcacggtgaccctggc	Protospacer
*** * . **** *******************

23. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gcctcccgcggccgccccgcctgcccacccg-----	CRISPR spacer
gcctcccgcggccgctccgcct-----cccgcggcc	Protospacer
***************.******     ****     

24. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

gcctcccgcggccgccccgcctgcccacccg--	CRISPR spacer
gcctcccgcggccgctccgcct--ccggctgcc	Protospacer
***************.******  **. *.*  

25. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 6, identity: 0.806

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
gtccccggcggccgccccgcctgcccgcgcc	Protospacer
*.*.** *******************.* * 

26. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 6, identity: 0.812

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
agcctggtcatcggcctggccatcctggcggc	Protospacer
.****************** *******..  *

27. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 6, identity: 0.812

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
agcctggtcatcggcctggccatcctggcggc	Protospacer
.****************** *******..  *

28. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 6, identity: 0.812

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
agcctggtcatcggcctggccatcctggcggc	Protospacer
.****************** *******..  *

29. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 6, identity: 0.812

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
agcctggtcatcggcctggccatcctggcggc	Protospacer
.****************** *******..  *

30. spacer 1.21|287524|33|NZ_AP022871|CRT matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cgcctcccgcggccgccccgcctgcccacccgc-----	CRISPR spacer
cgcctcccgcggccgctccgcct-----cccgcggccg	Protospacer
****************.******     *****     

31. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 6, identity: 0.824

ccggccacggcagcgacaccagcgc--ctcggtgcc	CRISPR spacer
tcggccacggcagcgtcagcagcgcggttcggtg--	Protospacer
.************** ** ******  .******  

32. spacer 4.43|318374|34|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP008954 (Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence) position: , mismatch: 6, identity: 0.824

---cggatccggcgaactggccgcacgagttgcggct	CRISPR spacer
gaccgga---ggcgaactggccgcgcgcgttgcggcg	Protospacer
   ****   **************.** ******** 

33. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MT711977 (Streptomyces phage Dagobah, complete genome) position: , mismatch: 6, identity: 0.812

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
gccgacgggcgcggcccgctgctggtggtcgc	Protospacer
 * ** ** ******************* *.*

34. spacer 6.3|327968|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 6, identity: 0.818

cgacaacgtcctgtccgggaacccgg-ccctgtc	CRISPR spacer
ccaccacgtcctgtccgagaacccggactccgt-	Protospacer
* ** ************.******** *.*.** 

35. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

36. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MN284907 (Gordonia phage Fireball, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

37. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK864264 (Gordonia phage VanDeWege, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

38. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MH479910 (Gordonia phage Danyall, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

39. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

40. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MH479917 (Gordonia phage KimmyK, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

41. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MH669015 (Gordonia phage TillyBobJoe, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

42. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK814761 (Gordonia phage SmokingBunny, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

43. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to KX557286 (Gordonia phage Twister6, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

44. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

45. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

46. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MT310872 (Gordonia phage Evamon, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

47. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MT521998 (Gordonia phage Jambalaya, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

48. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK864265 (Gordonia phage Barb, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

49. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_030913 (Gordonia phage Wizard, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

50. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MK305889 (Gordonia phage Mutzi, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgatcgctgcgctcggcgccgcgct	Protospacer
.  ***********.* ************* *

51. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MN010760 (Gordonia phage Nubi, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgattgccgcgctcggcgccgcgct	Protospacer
.  ********.**** ************* *

52. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MN234196 (Gordonia phage CloverMinnie, complete genome) position: , mismatch: 6, identity: 0.812

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gcctcggtgatcgccgggctcggtggcgcgtt	Protospacer
  *.*******************.* **** *

53. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 6, identity: 0.812

tacccggt---gatcgccgggctcggcgccgcgat	CRISPR spacer
---ccggtggagatcgccgcgctcggcgccgcctt	Protospacer
   *****   ******** ************  *

54. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812

tcggcg-cggaccggaatggacgacgccgcagg	CRISPR spacer
-ggacgccagaccggacgggacgacgccgcagg	Protospacer
  *.** *.*******  ***************

55. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.818

cgcggcggtgagcacggtgacgaccgagccgac-	CRISPR spacer
cgcggcggtgtggacggtgacga-cgagcaggtc	Protospacer
********** * ********** ***** *.. 

56. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.818

cgcggcggtgagcacggtgacgaccgagccgac-	CRISPR spacer
cgcggcggtgtggacggtgacga-cgagcaggtc	Protospacer
********** * ********** ***** *.. 

57. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
ccgctgctgatcgtgttcggcctgttctttgt	Protospacer
 **************.*** ********  .*

58. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
aggctgctgatcgggctcgccatgttcgtcat	Protospacer
* *********** ******* *****   **

59. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
cacgacatccaggccgcgcgcgctgacgccgag	Protospacer
  *************** ******** ** * *

60. spacer 7.25|347267|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 6, identity: 0.818

tacagcctccagcttcgccgcgcacagtg-gcag	CRISPR spacer
gaatgcctccagcatcgccgcgctcagtgcgca-	Protospacer
 *  ********* ********* ***** *** 

61. spacer 7.27|347389|33|NZ_AP022871|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.818

ggtggcgaaggcgccctggtagacgacgtcgag	CRISPR spacer
ggtggcgaaggcgcccggatagacgaacgcgac	Protospacer
**************** *.*******   *** 

62. spacer 9.42|355796|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 6, identity: 0.812

cgggccgcc---cctgactgcagcccgtcaccgag	CRISPR spacer
---accgcccggccggactgcagcccgtcatcgag	Protospacer
   .*****   ** ***************.****

63. spacer 9.49|356222|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

-tgggcggacgaactgtggaaccaggtcgacct	CRISPR spacer
gtggac-gacgaactgtggacccgggtcgagcc	Protospacer
 ***.* ************* **.****** *.

64. spacer 9.53|356463|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gcgtcggctggaatgaagagaaaatgacagcg-	CRISPR spacer
gcgtcggctggaatgacgag-caatgcatgcgc	Protospacer
**************** ***  ****   *** 

65. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to MK875794 (Microbacterium phage Chepli, complete genome) position: , mismatch: 6, identity: 0.818

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
agcatccggcacgcacagcgcgaggccgacaag	Protospacer
 * ***.******* **************  **

66. spacer 22.1|9252929|30|NZ_AP022871|CRISPRCasFinder matches to NZ_CP007515 (Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8

ctcacgctccgcaccgctccgcgacccacg	CRISPR spacer
cgcctcctccgggccgctccgcgacccacg	Protospacer
* * . ***** .*****************

67. spacer 22.1|9252929|30|NZ_AP022871|CRISPRCasFinder matches to NZ_CP007517 (Rubrobacter radiotolerans strain RSPS-4 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8

ctcacgctccgcaccgctccgcgacccacg	CRISPR spacer
cgcctcctccgggccgctccgcgacccacg	Protospacer
* * . ***** .*****************

68. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatgggcctggtcatcgcctttac	Protospacer
********** ******* **** .  ** *

69. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.774

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatgggcctggtcatcgcctttac	Protospacer
********** ******* **** .  ** *

70. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.774

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatgggcctggtcatcgcctttac	Protospacer
********** ******* **** .  ** *

71. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.774

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggtcatgggcctggtcatcgcctttac	Protospacer
********** ******* **** .  ** *

72. spacer 1.11|287403|32|NZ_AP022871|CRISPRCasFinder matches to MN478374 (Bacteriophage Phobos, complete genome) position: , mismatch: 7, identity: 0.781

gtggcacccacggtgccagccactacgcgcgt-	CRISPR spacer
cgtacacccacggcgccagccacttcg-gcgtc	Protospacer
   .*********.********** ** **** 

73. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
gccgcccccggccgccccgcctgcggcggcg	Protospacer
*** *** ****************     **

74. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP007143 (Hymenobacter swuensis DY53 plasmid pHsw2, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ggctcccgcggcagccccgccggccaaggca	Protospacer
* ********** ******** *** *  *.

75. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
cctgcccgcggacggcccgcctgcccaacgg	Protospacer
 *. ******* ** ************ * *

76. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
gcgacccgcggccgccgcgccggcccaggag	Protospacer
**  ************ **** *****   *

77. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
cctgcccgcggacggcccgcctgcccaacgg	Protospacer
 *. ******* ** ************ * *

78. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG812490 (Mycobacterium phage Holeinone, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

79. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH051249 (Mycobacterium phage Boyle, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

80. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN428049 (Mycobacterium phage West99, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

81. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN586045 (Mycobacterium phage Brownie5, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

82. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH001452 (Mycobacterium phage Kheth, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

83. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH697584 (Mycobacterium phage FrenchFry, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

84. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG757162 (Mycobacterium phage Opia, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

85. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK814751 (Mycobacterium phage Bananafish, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

86. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to KT365402 (Mycobacterium phage Tres, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

87. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to JN698991 (Mycobacterium phage Hedgerow, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

88. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN586046 (Mycobacterium phage Tinciduntsolum, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

89. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT639652 (Mycobacterium phage MasterPo, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

90. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK620898 (Mycobacterium phage Coffee, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

91. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to JN699004 (Mycobacterium phage Ares, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

92. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

93. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to AY129334 (Mycobacterium phage Rosebush, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

94. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH590591 (Mycobacterium phage Sabella, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

95. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

96. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

97. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK061411 (Mycobacterium phage Faze9, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

98. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to KT880194 (Mycobacterium phage Glass, complete genome) position: , mismatch: 7, identity: 0.781

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cacccggtcaccgaccacgacccgacctgcga	Protospacer
*.* ***************  *******  * 

99. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.781

agaatctgcgcgacaaccgcctg-ggcctgagt	CRISPR spacer
agaatctgcgcggcgaccgcctgcgggtcgaa-	Protospacer
************.*.******** ** ..**. 

100. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
ggcctggtcatgggcctggtcatcgcctttac	Protospacer
*********** ******* **** .  ** *

101. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
ggcctggtcatgggcctggtcatcgcctttac	Protospacer
*********** ******* **** .  ** *

102. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.781

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
ggcctggtcatgggcctggtcatcgcctttac	Protospacer
*********** ******* **** .  ** *

103. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.781

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
ggcctggtcatgggcctggtcatcgcctttac	Protospacer
*********** ******* **** .  ** *

104. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MG872834 (Gordonia phage Confidence, complete genome) position: , mismatch: 7, identity: 0.788

--cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gccgga--ctgcgcgacaaccgcctgcgcctggag	Protospacer
  *.**  ****************** *****.. 

105. spacer 1.22|287645|33|NZ_AP022871|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.788

cagaatctgcgcgacaaccgcctg-ggcctgagt	CRISPR spacer
cagaatctgcgcggcgaccgcctgcgggtcgaa-	Protospacer
*************.*.******** ** ..**. 

106. spacer 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.788

ggcgagtaggagcagcgcgcccccgatgaccgg	CRISPR spacer
ggacaccacgagcagcgcgccctggatgaccgg	Protospacer
**  * .* *************. *********

107. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.794

ccggccacggcagcgacaccagcgcctcggtgcc-	CRISPR spacer
cctcccacggcagcgtcaccagcgcgtc-gcgcag	Protospacer
**  *********** ********* ** *.**  

108. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
gcggcgggtcgcggcccgctgcggggtcgcgc	Protospacer
 *** ***************** **   **.*

109. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.781

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
gcggcgggtcgcggcccgctgcggggtcgcgc	Protospacer
 *** ***************** **   **.*

110. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.781

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
gcggcgggtcgcggcccgctgcggggtcgcgc	Protospacer
 *** ***************** **   **.*

111. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to AP018707 (Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence) position: , mismatch: 7, identity: 0.788

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
tggtagccgctgtcgctgccgaagtgctggccg	Protospacer
**** **.****************.  **.** 

112. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to AP018708 (Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence) position: , mismatch: 7, identity: 0.788

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
tggtagccgctgtcgctgccgaagtgctggccg	Protospacer
**** **.****************.  **.** 

113. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
tggtcggtgctgtcgctgctgaaggcggagccc	Protospacer
****** ************.**** .* ..***

114. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 7, identity: 0.788

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
tggtcggtgctgtcgctgctgaaggcggaagcc	Protospacer
****** ************.**** .* .* **

115. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MN536506 (Uncultured bacterium plasmid pEN1, complete sequence) position: , mismatch: 7, identity: 0.788

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
tggtagccgctgtcgctgccgaagtgctggccg	Protospacer
**** **.****************.  **.** 

116. spacer 6.10|328396|32|NZ_AP022871|CRISPRCasFinder matches to NC_021709 (Alteromonas mediterranea 615 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

-gaacgcgccctcgacaacttccgccgcagcat	CRISPR spacer
cgcatgtg-gctcgacaacttctgccgcatcat	Protospacer
 * *.*.*  ************.****** ***

117. spacer 6.10|328396|32|NZ_AP022871|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 7, identity: 0.781

gaacgcgccctcgacaacttccgccgcagcat	CRISPR spacer
gacgccgccctcgacaagttccgcagcatcgt	Protospacer
**   ************ ****** *** *.*

118. spacer 6.10|328396|32|NZ_AP022871|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 7, identity: 0.781

gaacgcgccctcgacaacttccgccgcagcat	CRISPR spacer
gacgccgccctcgacaagttccgcagcatcgt	Protospacer
**   ************ ****** *** *.*

119. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctcgtggtgctcgccgcgctcggcgccgcgct	Protospacer
. * .**** ****** ************* *

120. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctcgtggtgctcgccgcgctcggcgccgcgct	Protospacer
. * .**** ****** ************* *

121. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to MN369758 (Gordonia phage NHagos, complete genome) position: , mismatch: 7, identity: 0.781

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gcctcagtgatcgccggtctcggtgccgcgtt	Protospacer
  *.*.*********** *****.****** *

122. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 7, identity: 0.781

-tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
atggacggc-atcgccggcctcggcgccgggat	Protospacer
 *.  ***. ******** ********** ***

123. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.781

tacccggtgatcgccgggctcggcgccgcgat--	CRISPR spacer
cacctggtggtcgccgggctcg--gccggaataa	Protospacer
.***.****.************  **** .**  

124. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 7, identity: 0.781

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gagcgggtgatcgacgggctcgccgccgagct	Protospacer
 * * ******** ******** ***** * *

125. spacer 6.16|328758|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025585 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-02, complete sequence) position: , mismatch: 7, identity: 0.781

tggtcacctgcgtgacgaccagaaggagaagc	CRISPR spacer
cggtcagctgcgtcacgaccagaagctggatc	Protospacer
.***** ****** ***********  *.* *

126. spacer 6.17|328818|32|NZ_AP022871|CRISPRCasFinder matches to NC_018532 (Arthrobacter sp. Rue61a plasmid p232, complete sequence) position: , mismatch: 7, identity: 0.781

--cgctggtacgcccactgggccgcctcgcgccg	CRISPR spacer
gccgccag--ggcccacagggccgcctcgccccg	Protospacer
  ***..*   ****** ************ ***

127. spacer 6.17|328818|32|NZ_AP022871|CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 7, identity: 0.781

--cgctggtacgcccactgggccgcctcgcgccg	CRISPR spacer
gccgccg--acgcccactgggccgccacccgcgc	Protospacer
  ***.*  ***************** * ***  

128. spacer 6.24|329253|31|NZ_AP022871|CRISPRCasFinder matches to MN334766 (Serratia phage PCH45, complete genome) position: , mismatch: 7, identity: 0.774

cagcggtccagtcagcaaagttgacctcgtc	CRISPR spacer
gagcagtccagtcagaaaagttgaagtcttt	Protospacer
 ***.********** ********  ** *.

129. spacer 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggacaa-gtcgccgtccagctcgacgatgaccca	CRISPR spacer
-gacagcttcgccttccagctcgacgaggaccgc	Protospacer
 ****.  ***** ************* ****  

130. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 7, identity: 0.781

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gaggtagagcgggtggtcacggtgtcactggc	Protospacer
 **.*   **************** * *****

131. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LQ277708 (Sequence 3 from Patent WO2016071503) position: , mismatch: 7, identity: 0.781

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gagaaacctcgggtggtaaccgtgaccctggc	Protospacer
 ***  *. ******** ** ***********

132. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LZ998058 (JP 2017534684-A/5: Phage Therapy) position: , mismatch: 7, identity: 0.781

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gagaaacctcgggtggtaaccgtgaccctggc	Protospacer
 ***  *. ******** ** ***********

133. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LQ277710 (Sequence 5 from Patent WO2016071503) position: , mismatch: 7, identity: 0.781

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gagaaacctcgggtggtaaccgtgaccctggc	Protospacer
 ***  *. ******** ** ***********

134. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LZ998056 (JP 2017534684-A/3: Phage Therapy) position: , mismatch: 7, identity: 0.781

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gagaaacctcgggtggtaaccgtgaccctggc	Protospacer
 ***  *. ******** ** ***********

135. spacer 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 7, identity: 0.788

gtgatcctcgccgtgcccgacgacacagccaca	CRISPR spacer
atgatccgcgccgtggccgacgacacctgcacg	Protospacer
.****** ******* **********   ***.

136. spacer 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788

gtgatcctcgccgtgcccgacgacacagccaca-	CRISPR spacer
ctccgcctcgccgtcgccgacgacacag-cacac	Protospacer
 *   *********  ************ **** 

137. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 7, identity: 0.781

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
accctgctgatcgtgctcgtcctgaccgtgct	Protospacer
** ****************.**** .*  * *

138. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.781

acgctgctgatcgtgctcgccctgttctggat---	CRISPR spacer
tcgcttctcatcgtgctcgccctgat---gatcgg	Protospacer
 **** ** *************** *   ***   

139. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.781

acgctgctgatcgtgctcgccctgttctggat---	CRISPR spacer
tcgcttctcatcgtgctcgccctgat---gatcgg	Protospacer
 **** ** *************** *   ***   

140. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gcggtggtgatcgtgctcgccctgaccgggct	Protospacer
.** ** ***************** .* ** *

141. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gcggtggtgatcgtgctcgccctgaccgggct	Protospacer
.** ** ***************** .* ** *

142. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.788

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
agcgccccgcaggccgcccgcgcggcggcggtg	Protospacer
* ** * . ************** * *******

143. spacer 8.10|351052|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_015162 (Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence) position: , mismatch: 7, identity: 0.788

tcctccctgccttgctggtggcctcccggccgg--	CRISPR spacer
ccctgcctgccttgctgctggcctcctg--tggtt	Protospacer
.*** ************ ********.*  .**  

144. spacer 8.14|350624|33|NZ_AP022871|CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

gcgacggtcggcgacgacaactactgggccgag-	CRISPR spacer
gcgacggtcggcgaagacatctac-ggttcgttc	Protospacer
************** **** **** ** .**   

145. spacer 9.39|355613|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 7, identity: 0.781

cacgcatagggcacgacacccgctctgacctg	CRISPR spacer
gagggcgagggcacggcacgcgctctgacctg	Protospacer
 * *   ********.*** ************

146. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

attgcca-tcgccggacaccagaccagcgccgt	CRISPR spacer
-ctgctgctcgccggacacgagaccaccgccgg	Protospacer
 .***.. *********** ****** ***** 

147. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

attgcca-tcgccggacaccagaccagcgccgt	CRISPR spacer
-ctgctgctcgccggacacgagaccaccgccgg	Protospacer
 .***.. *********** ****** ***** 

148. spacer 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.774

caacaccaacgtcacgcaaggcgcctcgcaa	CRISPR spacer
cgatgtcaacgtcacgcacggcgccgcgcag	Protospacer
*.*...************ ****** ****.

149. spacer 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT matches to MG812491 (Mycobacterium phage ItsyBitsy1, complete genome) position: , mismatch: 7, identity: 0.774

caacaccaacgtcacgcaaggcgcc----tcgcaa	CRISPR spacer
caacaccgacgtcacgcacggcgtcggtatc----	Protospacer
*******.********** ****.*    **    

150. spacer 9.59|356828|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gcatccggc----gtgagcaggacctgttgctcgat	CRISPR spacer
----ccgacgatggtgagcaggaactggtgctcgat	Protospacer
    ***.*    ********** *** ********

151. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022371 (Bosea sp. AS-1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tcctccggctcgtcggccatgtcttccagctc-	CRISPR spacer
tcgtccggctcgacggccatgtc-accggcgaa	Protospacer
** ********* **********  **.**   

152. spacer 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcccgggggcgtcgagctgtcgtccgac	CRISPR spacer
tgcgccgggggtcgtcgagctgtcggcgtac	Protospacer
  **** **** ************* *  **

153. spacer 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcccgggggcgtcgagctgtcgtccgac	CRISPR spacer
tgcgccgggggtcgtcgagctgtcggcgtac	Protospacer
  **** **** ************* *  **

154. spacer 15.1|6145232|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.774

gtcgcccgggggcgtcgagctgtcgtccgac	CRISPR spacer
tgcgccgggggtcgtcgagctgtcggcgtac	Protospacer
  **** **** ************* *  **

155. spacer 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 7, identity: 0.781

taggcgatggtcacgcccaccttcagagtctc	CRISPR spacer
caggcgatggtcacgccctccttctgcagcac	Protospacer
.***************** ***** * . * *

156. spacer 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.774

gcgacgagccgcgcgaactcgctttcgccgt	CRISPR spacer
gcgacgagccgctcggactcgctgccgttct	Protospacer
************ **.******* .**.. *

157. spacer 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.774

gcgacgagccgcgcgaactcgctttcgccgt	CRISPR spacer
gcgacgagccgctcggactcgctgccgttct	Protospacer
************ **.******* .**.. *

158. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

159. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

160. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

161. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

162. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

163. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

164. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

165. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

166. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

167. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

168. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

169. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

170. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

171. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

172. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

173. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

174. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

175. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

176. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

177. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

178. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

179. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

180. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

181. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

182. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

183. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

184. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

185. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

186. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

187. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

188. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

189. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

190. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

191. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

192. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

193. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

194. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

195. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

196. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

197. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

198. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

199. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

200. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

201. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

202. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

203. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

204. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

205. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

206. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

207. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

208. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

209. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

210. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

211. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

212. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

213. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

214. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

215. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

216. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

217. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

218. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

219. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

220. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

221. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
gtcatcgaagtggccgcgcagcccggtacctc	Protospacer
**.. ********** ******.***** *  

222. spacer 1.10|287342|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75

tcgaagtgcttcaggcgtcgcgcgtcggcgtg	CRISPR spacer
cccaataccttcaggcgtcccgcgtgggcgtc	Protospacer
.* **   *********** ***** ***** 

223. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ctgcccctcggccgccccgcctgcccgcgcc	Protospacer
 . .*** ******************.* * 

224. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ctgcccctcggccgccccgcctgcccgcgcc	Protospacer
 . .*** ******************.* * 

225. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ctgcccctcggccgccccgcctgcccgcgcc	Protospacer
 . .*** ******************.* * 

226. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ctgcccctcggccgccccgcctgcccgcgcc	Protospacer
 . .*** ******************.* * 

227. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
tcgctccccggccgccgcgcctgcccaccat	Protospacer
 * ..** ******** ************  

228. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ggccaccgcggccgccccgccggccgacgac	Protospacer
* *. **************** *** **   

229. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
ggccaccgcggccgccccgccggccgacgac	Protospacer
* *. **************** *** **   

230. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 8, identity: 0.75

agaatctgcgcgacaaccgcctgggcctgagt---	CRISPR spacer
ggaacctgcgcgactaccgcctgg---tgaacgcc	Protospacer
.***.********* *********   ***..   

231. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcctggtcatcggcctggacatcctgattcc---	CRISPR spacer
ggcctgctcatcggcctgggca---tgatctggaa	Protospacer
****** ************.**   ****..    

232. spacer 1.21|287524|33|NZ_AP022871|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcccgcggccgccccgcctgcccacccgc	CRISPR spacer
cgccgcccccggccgccccgcctgcggcggcgg	Protospacer
**** *** ****************     ** 

233. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 8, identity: 0.758

--cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gccgga--ctgcgcgataaccgcctgcgcctggag	Protospacer
  *.**  ********.********* *****.. 

234. spacer 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagtaggagcagcgcgcccccgatgaccgg	CRISPR spacer
ggcgagcaggcgcagcgcgcccccggattccac	Protospacer
******.*** **************.   **. 

235. spacer 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.758

ggcgagtaggagcagcgcgcccccgatgaccgg	CRISPR spacer
gaactgtccgagcagcgcgcctccgacgaccgg	Protospacer
*.   **  ************.****.******

236. spacer 3.4|298405|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgagtaggagcagcgcgcccccgatgaccgg	CRISPR spacer
gaagcggccgagcagcgcgaccccgatgagcgg	Protospacer
*. * *   ********** ********* ***

237. spacer 3.29|300219|35|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP045373 (Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence) position: , mismatch: 8, identity: 0.771

ggcagcaccgcggtcagcagaccgatccgctcctc	CRISPR spacer
gcgacaacctcggtcaacagaccgatccgctcggc	Protospacer
*  *  *** ******.***************  *

238. spacer 3.29|300219|35|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.771

ggcagcaccgcggtcagcagaccgatccgctcctc	CRISPR spacer
gcgacaacctcggtcaacagaccgatccgctcggc	Protospacer
*  *  *** ******.***************  *

239. spacer 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

acctcaatcgccagcaccatgacggcccgcagc	CRISPR spacer
ccctgttcggccagcaccacggcggcccgcagc	Protospacer
 ***   . **********.*.***********

240. spacer 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 8, identity: 0.758

acctcaatcgccagcaccatgacggcccgcagc	CRISPR spacer
ccctgttcggccagcaccacggcggcccgcagc	Protospacer
 ***   . **********.*.***********

241. spacer 3.52|301902|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.789

gcctcgggccgggcggcgggatcctcggcgagggcctc	CRISPR spacer
acctcgggccgggtggcggcatcctcgggcagctccgc	Protospacer
.************.***** ********  **  ** *

242. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

243. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

244. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

245. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

246. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

247. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

248. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

249. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

250. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

251. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

252. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

253. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

254. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

255. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.765

--ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
tgccga--agggcagcgaaaccagcgcctcgatgaa	Protospacer
  ***.  * ******** ************.**  

256. spacer 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.765

cggtccacgccggccgggacgcgatcggtgtgga	CRISPR spacer
cggtccgcgcgggccgggacgcgatcacccaggt	Protospacer
******.*** ***************. .  ** 

257. spacer 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP009433 (Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_1, complete sequence) position: , mismatch: 8, identity: 0.765

cggtccacgccggccgggacgcgatcggtgtgga	CRISPR spacer
cggtccacgccggccagggcgcgacgcgcgagca	Protospacer
***************.**.*****.  *.* * *

258. spacer 4.31|317505|34|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 8, identity: 0.765

cggtccacgccggccgggacgcgatcggtgtgga	CRISPR spacer
cggtccacgccggccagggcgcgacgcgcgagca	Protospacer
***************.**.*****.  *.* * *

259. spacer 4.57|319437|34|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029362 (Streptomyces globisporus strain TFH56 plasmid pTFSG1, complete sequence) position: , mismatch: 8, identity: 0.765

cctccgtgat-cgtgaagccgccggcctcgaccgg	CRISPR spacer
-tccagtagtccgtgtagcggccggcctcgaccgg	Protospacer
 ..* **..* **** *** ***************

260. spacer 4.57|319437|34|NZ_AP022871|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 8, identity: 0.765

cctccgtgat-cgtgaagccgccggcctcgaccgg	CRISPR spacer
-tccagtagtccgtgtagcggccggcctcgaccgg	Protospacer
 ..* **..* **** *** ***************

261. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 8, identity: 0.75

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gggcaggtgatcgacgggctgggcgccgcggc	Protospacer
 . * ******** ****** *********..

262. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 8, identity: 0.75

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gccgatgtgaccgccgggctccgcgccgcggt	Protospacer
  *   ****.********** ********.*

263. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 8, identity: 0.75

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gccgatgtgaccgccgggctccgcgccgcggt	Protospacer
  *   ****.********** ********.*

264. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcgccgggatcgccggcatcggcgccgcgaa	Protospacer
 .* * * *********  ************ 

265. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

-tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gtgccttac-atcgcccggctcggcgcctcgat	Protospacer
 *.**. .. ****** *********** ****

266. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 8, identity: 0.75

tacccggtg--atcgccgggctcggcgccgcgat	CRISPR spacer
--cctgacaatatcgccgggctcggcgacgagat	Protospacer
  **.*...  **************** ** ***

267. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 8, identity: 0.75

---tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gaggacc---tgctcgccgcgctcggcgccgcgga	Protospacer
    ***   ** ****** *************. 

268. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
ggcggcggcgagcgcggtgacgaccgcggtcag	Protospacer
 *******.****.************ * . * 

269. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
cgtggcggtgagcacggtgatgacctcgtcccg	Protospacer
**.*****************.****  *.*   

270. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
ggcggcggcgagcgcggtgacgaccgcggtcag	Protospacer
 *******.****.************ * . * 

271. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
gccgacggcgagcacggtgacgaccgccgcgag	Protospacer
  **.***.*****************   *** 

272. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.758

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
gggggcggtgagcacggtgaagatcgacgggtc	Protospacer
 * ***************** **.***   * *

273. spacer 6.16|328758|32|NZ_AP022871|CRISPRCasFinder matches to MT094430 (Pseudomonas phage BIM BV-45, complete genome) position: , mismatch: 8, identity: 0.75

-tggtcacctgcgtgacgaccagaaggagaagc	CRISPR spacer
gctgttg-ctgcgcgacgaccagaaagagaaac	Protospacer
 . **.. *****.***********.*****.*

274. spacer 6.17|328818|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 8, identity: 0.75

cgctggtacgcccactgggccgcctcgcgccg	CRISPR spacer
ggctcgtacgcccactgggcggccaggctcta	Protospacer
 *** *************** ***  ** *..

275. spacer 6.17|328818|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 8, identity: 0.75

cgctggtacgcccactgggccgcctcgcgccg	CRISPR spacer
ggctcgtacgcccactgggcggccaggctcta	Protospacer
 *** *************** ***  ** *..

276. spacer 6.17|328818|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 8, identity: 0.75

cgctggtacgcccactgggccgcctcgcgccg	CRISPR spacer
ggctcgtacgcccactgggcggccaggctcta	Protospacer
 *** *************** ***  ** *..

277. spacer 6.24|329253|31|NZ_AP022871|CRISPRCasFinder matches to MH590599 (Streptomyces phage Karimac, complete genome) position: , mismatch: 8, identity: 0.742

cagcggtccagtcagcaaagttgacctcgtc	CRISPR spacer
gggcaagccagtcaacaaagttgacttcgta	Protospacer
 .**.. *******.**********.**** 

278. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtg----accctggc	CRISPR spacer
aagatcttccgggtggtcacggtgcagaaccg----	Protospacer
 *****.* ***************    ***     

279. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
ctgcagctgcgggtggtcacgcagaccctcgt	Protospacer
* *   ***************  ****** *.

280. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gcgctcctgcaggtgggcacggtgacctggga	Protospacer
  * ******.***** **********. ** 

281. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc--	CRISPR spacer
gcgatgctgccggtggtcacggtga--ttggtct	Protospacer
  *** **** **************  .***.  

282. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to KC294142 (Pseudomonas phage PaP4) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

283. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_010325 (Pseudomonas phage LUZ24, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

284. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT108724 (Pseudomonas phage Epa2, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gtgaaacctcgggtggtaaccgtgaccctggc	Protospacer
  **  *. ******** ** ***********

285. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LZ998057 (JP 2017534684-A/4: Phage Therapy) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

286. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG589386 (Pseudomonas phage phiPA01_EW, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

287. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK837012 (Pseudomonas virus Pa223, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gtgaaacctcgggtggtaaccgtgaccctggc	Protospacer
  **  *. ******** ** ***********

288. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN562749 (Pseudomonas phage U47, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

289. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN553586 (UNVERIFIED: Pseudomonas phage phiKMVC5-4, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

290. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LQ277709 (Sequence 4 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

291. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_042343 (Pseudomonas phage PaP4, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

292. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH973725 (Pseudomonas phage SaPL, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

293. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT119371 (Pseudomonas phage oldone, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

294. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG589385 (Pseudomonas phage phiPA01_302, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

295. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN508619 (UNVERIFIED: Pseudomonas phage Paer4, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

296. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK837011 (Pseudomonas virus Pa222, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

297. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG432151 (Pseudomonas phage Delta, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

298. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to HG518155 (Pseudomonas phage TL complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

299. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN871484 (UNVERIFIED: Pseudomonas phage PaSz-8_45_45k, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

300. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to LN610578 (Pseudomonas phage vB_PaeP_C2-10_Ab22, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

301. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MF768469 (Pseudomonas phage SL4, complete genome) position: , mismatch: 8, identity: 0.75

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gggaaacctcgggtggtaaccgtgaccctggc	Protospacer
 .**  *. ******** ** ***********

302. spacer 7.9|346297|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtctgcaatggacacaccctccatagacg	CRISPR spacer
aaggttggcaatggacacaccctcaaggcgca	Protospacer
*****. ***************** * . .*.

303. spacer 7.16|346721|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

gcaacaagcgcaacggccatgaacgctgtttcg	CRISPR spacer
ccctcgtccgcaacggccatgaccgcagtttcg	Protospacer
 *  *.  ************** *** ******

304. spacer 7.17|346782|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 8, identity: 0.758

ggcttcgggccgccgtccgtacggacaaagaac	CRISPR spacer
atctggcggccgctgtccgtacggacaatgacc	Protospacer
. **   ******.************** ** *

305. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 8, identity: 0.758

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
aatatcaaacgccagaccggtgagtatatcggt	Protospacer
********.***********.***. *..**  

306. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
gatctgcgccgcgaggccggcgagcttgccgcg	Protospacer
.** *  . *** **.*****************

307. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
gatctgcgccgcgaggccggcgagcttgccgcg	Protospacer
.** *  . *** **.*****************

308. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
gatctgcgccgcgaggccggcgagcttgccgcg	Protospacer
.** *  . *** **.*****************

309. spacer 7.19|346904|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 8, identity: 0.758

cgttcgccttcggggagccgtgcccgcactgcg	CRISPR spacer
gcttcgccttcgggaagccgcgcccgcgcaagg	Protospacer
  ************.*****.******.* . *

310. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 8, identity: 0.758

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
aaggacatcgaggccgcccgcgcggagatgcag	Protospacer
*  ****** ************* ***..*  *

311. spacer 7.27|347389|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

ggtggcgaaggcgccctggtagacgacgtcgag	CRISPR spacer
ggtggcgccggcgccctggtagacgcggctggc	Protospacer
*******  ****************  *..*. 

312. spacer 7.28|347450|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.758

gccgtagcggcgccctcctggatggcgggactg	CRISPR spacer
gcgacggcggcggcctcctggatgccgggatgg	Protospacer
** ...****** *********** *****. *

313. spacer 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcgcggcgaccgcacctagcccggcgccgtcc	CRISPR spacer
tgcacgaggaccgcacctaccccggcgccatcg	Protospacer
  *.**. *********** *********.** 

314. spacer 7.30|347572|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_014028 (Salinibacter ruber M8 plasmid pSR56, complete sequence) position: , mismatch: 8, identity: 0.758

aggacctgcaaagcgttgtggatgctcgtgacg	CRISPR spacer
ggagctgtcaaagcgtagtagatgctcgtgacg	Protospacer
.*..*.  ******** **.*************

315. spacer 8.7|350869|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

gcggggatcatctcgtacgcctggcgggtgccg	CRISPR spacer
gcggggatcctctcctacgcctgggcggcggac	Protospacer
********* **** *********  **.*   

316. spacer 8.9|350991|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021213 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11a, complete sequence) position: , mismatch: 8, identity: 0.758

aggagctgcgccgtcgcctatacggcgcaggtc	CRISPR spacer
acccgcggcgccgtcgccgatacggcgcccatc	Protospacer
*   ** *********** *********  .**

317. spacer 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaacagccgacatcatcaacgaaaccatcgcc	CRISPR spacer
gcatgaacgacctcatctacgaaaccatcgtc	Protospacer
* *... **** ***** ************.*

318. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 8, identity: 0.75

tcccgatcccaagccttctgcttggtgtagtc	CRISPR spacer
caccacgcccaggccttctgcttggtgaaggc	Protospacer
. **.  ****.*************** ** *

319. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 8, identity: 0.75

tcccgatcccaagccttctgcttggtgtagtc	CRISPR spacer
caccacgcccaggccttctgcttggtgaaggc	Protospacer
. **.  ****.*************** ** *

320. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 8, identity: 0.75

tcccgatcccaagccttctgcttggtgtagtc	CRISPR spacer
caccacgcccaggccttctgcttggtgaaggc	Protospacer
. **.  ****.*************** ** *

321. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 8, identity: 0.75

tcccgatcccaagccttctgcttggtgtagtc	CRISPR spacer
caccacgcccaggccttctgcttggtgaaggc	Protospacer
. **.  ****.*************** ** *

322. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_AP022585 (Mycobacterium marseillense strain JCM 17324 plasmid pJCM17324, complete sequence) position: , mismatch: 8, identity: 0.75

tcccgatcccaagccttctgcttggtgtagtc	CRISPR spacer
caccacgcccaggccttctgcttggtgaaggc	Protospacer
. **.  ****.*************** ** *

323. spacer 9.42|355796|32|NZ_AP022871|CRISPRCasFinder,CRT matches to AY328852 (Vibrio parahaemolyticus phage VP16T, partial sequence) position: , mismatch: 8, identity: 0.75

cgggccgcccctgactgcagcccgtcaccgag	CRISPR spacer
cacagtccccctgacggcagcccgtcagcgag	Protospacer
*. . . ******** *********** ****

324. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010613 (Phaeobacter inhibens strain P92 plasmid pP92_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

325. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010625 (Phaeobacter inhibens strain P51 plasmid pP51_b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

326. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010670 (Phaeobacter inhibens strain P57 plasmid pP57_b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

327. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010597 (Phaeobacter inhibens strain P10 plasmid pP10_b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

328. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_018287 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_78, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

329. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010632 (Phaeobacter inhibens strain P78 plasmid pP78_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

330. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

331. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

332. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010659 (Phaeobacter piscinae strain P71 plasmid pP71_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

333. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010761 (Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

334. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010604 (Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

335. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP031950 (Phaeobacter inhibens strain BS107 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

336. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010743 (Phaeobacter inhibens strain P59 plasmid pP59_b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

337. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010620 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

338. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010731 (Phaeobacter inhibens strain P88 plasmid pP88_f, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

339. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010653 (Phaeobacter inhibens strain P54 plasmid pP54_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

340. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010710 (Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

341. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010701 (Phaeobacter inhibens strain P24 plasmid pP24_e, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

342. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010747 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

343. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP019310 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-3, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

344. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP010738 (Phaeobacter inhibens strain P72 plasmid pP72_c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tcggtcatcgccggaccccagtccagcgcctc	Protospacer
 . *.*********** **** ******** .

345. spacer 9.48|356162|31|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 8, identity: 0.742

caacaccaacgtcacgcaaggcgcctcgcaa	CRISPR spacer
gatcacgaacatcacgcaaggcgcctacccg	Protospacer
 * *** ***.***************  * .

346. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 8, identity: 0.75

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
gcgcgctaccgcagcgcgatcagcgcgatcct	Protospacer
* * *...**** **** ************* 

347. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 8, identity: 0.75

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
gcgcgctaccgcagcgcgatcagcgcgatcct	Protospacer
* * *...**** **** ************* 

348. spacer 9.56|356646|31|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP034650 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH29, complete sequence) position: , mismatch: 8, identity: 0.742

ctgtcgcatcgcgatgcgatggcgcgatcgc	CRISPR spacer
ttgtcgcgtcgctatgcgatggcgatggcgt	Protospacer
.******.**** ***********  . **.

349. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ccctccaacatgcccacgctggtggaggccac	Protospacer
 ** ********* ********** . *** .

350. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
tccaccaacgtgcggacgctggtggcgaccat	Protospacer
 ********.**** *********   .** *

351. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592391 (Vibrio phage 1.004.O._10N.261.54.A2, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

352. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592449 (Vibrio phage 1.072.O._10N.286.48.A12, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

353. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592443 (Vibrio phage 1.066.O._10N.286.46.E8, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

354. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592421 (Vibrio phage 1.037.O._10N.261.52.F7, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

355. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592436 (Vibrio phage 1.056.O._10N.261.48.C11, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

356. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG592445 (Vibrio phage 1.068.O._10N.261.51.F8, partial genome) position: , mismatch: 8, identity: 0.75

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacacgagcacgctggtcagcccatc	Protospacer
**********.* **********  ** * ..

357. spacer 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

ggttgagcatcctgaccgacgcgctgcatgtg	CRISPR spacer
ggcagagcatcctgaccggagcgctgcaaaaa	Protospacer
**. **************. ******** . .

358. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.75

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
gtctccggctcctcggccatctcttcccacgg	Protospacer
 .********* ******** ****** .*  

359. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN234206 (Arthrobacter phage Racecar, complete genome) position: , mismatch: 8, identity: 0.75

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
tcctccggctcatcggccatgtcagcgacaaa	Protospacer
***********.***********  * *    

360. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
atcgccgccgcctccgccacccggctcgccg	Protospacer
*** ******************.*   *   

361. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
ttcaccgccgcctgcgccacccaggccgaac	Protospacer
 ** ********* ***********  *...

362. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
atcgccgccgcctccgccacccggctcgccg	Protospacer
*** ******************.*   *   

363. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
gccggcgccgcctctgccacccaggaaccgg	Protospacer
..*  *********.************  * 

364. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
atcgccgccgcctccgccacccggctcgccg	Protospacer
*** ******************.*   *   

365. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
atcgccgccgcctccgccacccggctcgccg	Protospacer
*** ******************.*   *   

366. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
agctccgccgcctccgccgcccagtgcgttc	Protospacer
* ****************.***** . *  .

367. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
gtctccgccgcctccgacacgcagggcgtcg	Protospacer
.*************** *** ****. *   

368. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
gtcaccgccgcctgcgccacccaggccagca	Protospacer
.** ********* ***********  .*  

369. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.742

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
gcctccgccgcctccgccgccccggcataga	Protospacer
..****************.*** ** * .* 

370. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
cgtcactggaacgctcagcgcgaggccgggctc	Protospacer
.*   **** ******************.**  

371. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
cgtcactggaacgctcagcgcgaggccgggctc	Protospacer
.*   **** ******************.**  

372. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
cgtcactggaacgctcagcgcgaggccgggctc	Protospacer
.*   **** ******************.**  

373. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
cgtcactggaacgctcagcgcgaggccgggctc	Protospacer
.*   **** ******************.**  

374. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
cgtcactggaacgctcagcgcgaggccgggctc	Protospacer
.*   **** ******************.**  

375. spacer 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053445 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eA, complete sequence) position: , mismatch: 8, identity: 0.742

gcgacgagccgcgcgaactcgctttcgccgt	CRISPR spacer
cacacccgcccggcgaactcgctttcgccgc	Protospacer
   **  ***  ******************.

376. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
cgctggtcgccggcctggacatcctggccgg	Protospacer
  ******..****************...  

377. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 9, identity: 0.71

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
agctggtcatcggcatggtcatcctcggggc	Protospacer
. ************ *** ****** .   *

378. spacer 1.8|287221|31|NZ_AP022871|CRISPRCasFinder matches to MF417932 (Uncultured Caudovirales phage clone 3S_12, partial genome) position: , mismatch: 9, identity: 0.71

gcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gcctggccatcggcctggacgtcaccggcac	Protospacer
******.*************.** . . . *

379. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.719

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
accgacgacgtggccgcgcagctcggcgacgc	Protospacer
...***** ****** **********...** 

380. spacer 1.9|287281|32|NZ_AP022871|CRISPRCasFinder matches to MH697589 (Microbacterium phage Neferthena, complete genome) position: , mismatch: 9, identity: 0.719

gttgacgaagtggcctcgcagctcggtagcga	CRISPR spacer
atcgacgacgcggcctcgcagctcggcgtcag	Protospacer
.*.***** *.***************.. *..

381. spacer 1.11|287403|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 9, identity: 0.719

gtggcacccacggtgccagccactacgcgcgt	CRISPR spacer
tcggtggccacggtgccggccaccacgcgctc	Protospacer
 .**.. **********.*****.****** .

382. spacer 1.11|287403|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

gtggcacccacggtgccagccactacgcgcgt	CRISPR spacer
cggccggccacggtgcgatccactacgcgctg	Protospacer
  * *. ********* * ***********  

383. spacer 1.12|287464|32|NZ_AP022871|CRISPRCasFinder matches to NC_020060 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence) position: , mismatch: 9, identity: 0.719

gactccgagcgacccccgccgtcgaacctgaa	CRISPR spacer
tcttccaaccgacccccgccgtcgaacagaag	Protospacer
  .***.* ******************  .*.

384. spacer 1.13|287525|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gcctcccgcggccgccccgcctgcccacccg	CRISPR spacer
cgacgaagcggccgccccgcctgccccctcg	Protospacer
   .   ******************* *.**

385. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcg-cggtcaccgaccacgtgccgacctcagt	CRISPR spacer
-gtgtcggacaccgaccacgcgccgacccgcac	Protospacer
 *.* *** ***********.*******.  ..

386. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcg-cggtcaccgaccacgtgccgacctcagt	CRISPR spacer
-gtgtcggacaccgaccacgcgccgacccgcac	Protospacer
 *.* *** ***********.*******.  ..

387. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcg-cggtcaccgaccacgtgccgacctcagt	CRISPR spacer
-gtgtcggacaccgaccacgcgccgacccgcac	Protospacer
 *.* *** ***********.*******.  ..

388. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MG872834 (Gordonia phage Confidence, complete genome) position: , mismatch: 9, identity: 0.719

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggactgcgcgacaaccgcctgcgcctggag	Protospacer
  .. ****************** *****.. 

389. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
agaatctgcgcggtaaccgcctggcgttccaa	Protospacer
************..**********  .*  . 

390. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
cctatctgcgcgacagccgcccgggctttcat	Protospacer
   ************.*****.****.*  .*

391. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 9, identity: 0.719

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
tgaagctgcgcgacatccgcctggtgcaggac	Protospacer
 *** ********** ********  * *...

392. spacer 1.16|287220|32|NZ_AP022871|CRT matches to MF417932 (Uncultured Caudovirales phage clone 3S_12, partial genome) position: , mismatch: 9, identity: 0.719

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
ggcctggccatcggcctggacgtcaccggcac	Protospacer
*******.*************.** . . . *

393. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 9, identity: 0.719

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
gagctggtcatcggcatggtcatcctcggggc	Protospacer
*. ************ *** ****** .   *

394. spacer 1.21|287524|33|NZ_AP022871|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727

----cgcctcccgcggccgccccgcctgcccacccgc	CRISPR spacer
acgacg----aagcggccgccccgcctgccccctcgg	Protospacer
    **      ******************* *.** 

395. spacer 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.727

cgtccggctgccgccggagtgcccggagttcct	CRISPR spacer
ccgtcggctgccgccggagttcctggagccggt	Protospacer
*  .**************** **.****..  *

396. spacer 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtccggctgccgccggagtgcccggagttcct	CRISPR spacer
ccgtcggctgccgccggagttcctggagccggt	Protospacer
*  .**************** **.****..  *

397. spacer 3.21|299642|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.727

cgtccggctgccgccggagtgcccggagttcct	CRISPR spacer
ccgtcggctgccgccggagttcctggagccggt	Protospacer
*  .**************** **.****..  *

398. spacer 3.24|299857|39|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NC_028827 (Streptomyces phage Lannister, complete genome) position: , mismatch: 9, identity: 0.769

gatggccgacacctcgatgaggtgggccatcagccggtt	CRISPR spacer
tacggccgacacctcgaagaggttggccatctcgacgtt	Protospacer
 *.************** ***** *******     ***

399. spacer 3.26|300005|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.735

ccagcgtccactcccggccagcccacgtgaactc----	CRISPR spacer
ggcgcgtccacgcccgtccagcccacg----ctcccgg	Protospacer
   ******** **** **********    ***    

400. spacer 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.727

acctcaatcgccagcaccatgacggcccgcagc	CRISPR spacer
gacaatatcgccagcgccctgacggcccgccgg	Protospacer
. *   *********.** *********** * 

401. spacer 3.38|300881|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.727

acctcaatcgccagcaccatgacggcccgcagc	CRISPR spacer
gcgcagatcgccagcacgatgtcggcccgccga	Protospacer
.* . .*********** *** ******** * 

402. spacer 3.43|301234|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 9, identity: 0.763

ccgtcgaggccgagctcgaagacgcggtcctcggcgac	CRISPR spacer
ccgtcgaggccgagctcgaggacggggaggacctctac	Protospacer
*******************.**** **    *  * **

403. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 9, identity: 0.735

ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
agagcgtcaccagcgacaccagcggcccggtgcc	Protospacer
  .**  *. ************** *.*******

404. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
ccggccgcggcagcgacaccggcggcgcatccgc	Protospacer
******.*************.*** * *. .  *

405. spacer 3.55|302122|36|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.75

ggagcacacaccgatgagcaccacccagaccaccgt	CRISPR spacer
catgatcaacccgatgagcaccacacagaccgccgt	Protospacer
 . *  **  ************** ******.****

406. spacer 4.29|317357|36|NZ_AP022871|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 9, identity: 0.75

gtcccggatcgagcggggcgagctgcgcaccgaccg	CRISPR spacer
ccccctgatcgcgcggggcgagctgcgcgcgggcac	Protospacer
 .*** ***** ****************.* *.*  

407. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to KX523125 (Mycobacterium phage BuzzBuzz, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

408. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to KC661272 (Mycobacterium phage Methuselah, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

409. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MF185729 (Mycobacterium phage KADY, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

410. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MN096368 (Mycobacterium phage Soshari, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

411. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MT897907 (Mycobacterium phage Grif, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

412. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NC_004682 (Mycobacterium virus Bxz2, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

413. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MK433273 (Mycobacterium phage Daishi, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

414. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to KX670788 (Mycobacterium phage Louie6, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

415. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MN585984 (Mycobacterium phage AgronaGT15, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

416. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MH513975 (Mycobacterium phage Misomonster, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

417. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to KP017310 (Mycobacterium phage Phoxy, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

418. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NC_028757 (Mycobacterium phage Tiffany, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

419. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to KP017311 (Mycobacterium phage Spike509, complete genome) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
tacgtcgaacggcggcaacaacgtccccgcgaa	Protospacer
   * ** ***********.********* .*.

420. spacer 4.36|317869|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gtgggcgtacggcggcaacgacgtccccgaaag	CRISPR spacer
gtgggggtacggcggcatcgacgtgtgcaacgt	Protospacer
***** *********** ****** . *.* . 

421. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to MN096362 (Arthrobacter phage Vibaki, complete genome) position: , mismatch: 9, identity: 0.719

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
ttcgaagatcgcggcccgctgctggtcgagtt	Protospacer
*. **.*.****************** *.  .

422. spacer 4.57|319437|34|NZ_AP022871|CRISPRCasFinder matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.735

cctccgtgatcgtgaagccgccggcctcgaccgg	CRISPR spacer
agcaaggcatcgtgaaatcgccggcctcgaccgg	Protospacer
  .  *  ********..****************

423. spacer 4.57|319437|34|NZ_AP022871|CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.735

cctccgtgatcgtgaagccgccggcctcgaccgg	CRISPR spacer
agcaaggcatcgtgaaatcgccggcctcgaccgg	Protospacer
  .  *  ********..****************

424. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
gctcggccaggagatcgatgtcgccgtcgaac	Protospacer
.******** **.************ . .*. 

425. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP042810 (Acetobacter oryzoeni strain B6 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
gctcggcgacgaaatcgatgccgcccctcttc	Protospacer
.****** ************.****.*     

426. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
gctcggccaggagatcgatgtcgccgtcgaac	Protospacer
.******** **.************ . .*. 

427. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 9, identity: 0.719

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
ggtcggccacgaattcgatggcgcccatcagg	Protospacer
. *********** ****** ****.   **.

428. spacer 6.6|328151|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.727

gctatcgccgcccgcctggccagctgcggtgcc	CRISPR spacer
cggatcgccgcccgcctggccggccgcccggct	Protospacer
   ******************.**.**   **.

429. spacer 6.6|328151|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.727

gctatcgccgcccgcctggccagctgcggtgcc	CRISPR spacer
cggatcgccgcccgcctggccggccgcccggct	Protospacer
   ******************.**.**   **.

430. spacer 6.10|328396|32|NZ_AP022871|CRISPRCasFinder matches to MK310226 (Halobacterium virus ChaoS9, complete genome) position: , mismatch: 9, identity: 0.719

gaacgcgccctcgacaacttccgccgcagcat	CRISPR spacer
ctggacgccctcgccgacttccgccgcagcgc	Protospacer
  . .******** *.**************..

431. spacer 6.10|328396|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcgccctcgacaacttccgccgcagcat	CRISPR spacer
gcctccgacctcgacagcttccgccgcaccgc	Protospacer
*  . ** ********.*********** *..

432. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gcggcggtgatggccgggctcggcgtcgccgc	Protospacer
    ******* *************.*** ..

433. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gtgccggtgatcgccgcgctcgccgccatgca	Protospacer
   ************* ***** ****..*  

434. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gtgtcggtgatcgccgcgcttggcgccgaact	Protospacer
   .************ ***.******* . *

435. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gccgacgtgatcgccgggttcgtcgccgcgtg	Protospacer
  *   ************.*** *******  

436. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cccgagaatatcgccgggctcggcgacgagat	Protospacer
. *  *.  **************** ** ***

437. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctctcgctcatcgccgggctcggcgccaccgc	Protospacer
. *.** * ******************.* ..

438. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cccgagaatatcgccgggctcggcgacgagat	Protospacer
. *  *.  **************** ** ***

439. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP048420 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gggcggttgatcgcccggctcagcgccgcgcg	Protospacer
 . * * ******** *****.********  

440. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cccgagaatatcgccgggctcggcgacgagat	Protospacer
. *  *.  **************** ** ***

441. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP015745 (Shinella sp. HZN7 plasmid pShin-09, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gacggggcgatcgccggactcggcgccggtgc	Protospacer
 **  **.*********.**********  ..

442. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP011044 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tgggtcatcatcgccggggtcgtcgccgcgat	Protospacer
*.  . .* ********* *** *********

443. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gcctcggtaatcgccggtctcggcgccatgcg	Protospacer
  *.****.******** *********..*  

444. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_015258 (Polymorphum gilvum SL003B-26A1 plasmid pSL003B, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gacggggcgatcgccggactcggcgccggtgc	Protospacer
 **  **.*********.**********  ..

445. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgccggtgatcgacgggcttggcgcgcgtat	Protospacer
.  ********** ******.*****    **

446. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tggtcctcgatcgccggactcggcgtcgcgag	Protospacer
*. .*  .*********.*******.***** 

447. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021035 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tgggtcatcatcgccggggtcgtcgccgcgat	Protospacer
*.  . .* ********* *** *********

448. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021039 (Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tgggtcatcatcgccggggtcgtcgccgcgat	Protospacer
*.  . .* ********* *** *********

449. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tggtcctcgatcgccggactcggcgtcgcgag	Protospacer
*. .*  .*********.*******.***** 

450. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
tcttcggtgatcgcctggatcggcgccatgtc	Protospacer
* ..*********** ** ********..* .

451. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ccctcggcgatcgcccggctcggcgcctatct	Protospacer
. *.***.******* ***********    *

452. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cttgaacggaccggaatagacggcgccgctgt	Protospacer
.. * .***********.****.****** * 

453. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cttgaacggaccggaatagacggcgccgctgt	Protospacer
.. * .***********.****.****** * 

454. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cttgaacggaccggaatagacggcgccgctgt	Protospacer
.. * .***********.****.****** * 

455. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cttgaacggaccggaatagacggcgccgctgt	Protospacer
.. * .***********.****.****** * 

456. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to KT021004 (Thermobifida phage P1312, complete genome) position: , mismatch: 9, identity: 0.727

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
gcctccggtgatcacggtgacggccgagcctgt	Protospacer
  *  ****** **********.******* ..

457. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
ggcggtggtgcgcacggtgacgaccttcaccgc	Protospacer
 ****.**** **************    * .*

458. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 9, identity: 0.727

cgcggcggtgagcacggtgacgaccga-gccgac	CRISPR spacer
gtcggaggtgagcacggtgaggaccggtagtga-	Protospacer
  *** ************** *****. . .** 

459. spacer 7.6|346115|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 9, identity: 0.727

gattctgcgtcccggacatccgtcacggtggag	CRISPR spacer
gcttcagcctcccggacatccgtcaccagagtt	Protospacer
* *** ** ***************** . .*  

460. spacer 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727

ggacaagtcgccgtccagctcgacgatgaccca	CRISPR spacer
gcgcaaggcgccgtcccgctcgacgatctcgtg	Protospacer
* .**** ******** **********  * ..

461. spacer 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 9, identity: 0.727

gtgatcctcgccgtgcccgacgacacagccaca	CRISPR spacer
cttgttgacgccgcggccgacgacacagccacg	Protospacer
 * .*.  *****.* ****************.

462. spacer 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.727

gtgatcctcgccgtgcccgacgacacagccaca	CRISPR spacer
cttgttgacgccgcggccgacgacacagccacg	Protospacer
 * .*.  *****.* ****************.

463. spacer 7.10|346357|33|NZ_AP022871|CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.727

gtgatcctcgccgtgcccgacgacacagccaca	CRISPR spacer
cttgttgacgccgcggccgacgacacagccacg	Protospacer
 * .*.  *****.* ****************.

464. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

465. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

466. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

467. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

468. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

469. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

470. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

471. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

472. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

473. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

474. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
ctgatgctgatcgtcctcggcctgttcccggc	Protospacer
 .* ********** **** *******. *..

475. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

476. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

477. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gtcatcttcatcgtcctctccctgttctggat	Protospacer
..  * .* ***** *** *************

478. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gtcgtgctgatcatgctcgcgctgttcagtgt	Protospacer
..  ********.******* ****** * .*

479. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gccatgctgatcgtgctggcactgttcatggg	Protospacer
.*  ************* ** ******  *. 

480. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 9, identity: 0.727

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
ttccgcaagcgccagatcggcgagctttccggt	Protospacer
  .  ***********.********** ***  

481. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.727

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
ttccgcaagcgccagatcggcgagctttccggc	Protospacer
  .  ***********.********** ***  

482. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
ttccgcaagcgccagatcggcgagctttccggc	Protospacer
  .  ***********.********** ***  

483. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.727

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
ttccgcaagcgccagatcggcgagctttccggt	Protospacer
  .  ***********.********** ***  

484. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 9, identity: 0.727

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
ttccgcaagcgccagatcggcgagctttccggt	Protospacer
  .  ***********.********** ***  

485. spacer 7.20|346965|31|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggtcggcacatacattctgatcttcgg	CRISPR spacer
cgccgctcggcatatacatgctgatcttctt	Protospacer
.   * ******.****** *********  

486. spacer 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP043619 (Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcgcggcgaccgcacctagcccggcgccgtcc	CRISPR spacer
ccgccggcgaccgcaccgaccccggcgcctctc	Protospacer
 .  ************* * ********* ..*

487. spacer 7.30|347572|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggacctgcaaagcgttgtggatgctcgtgacg	CRISPR spacer
agaacctgcaaagcgttctggatggccagcaga	Protospacer
**.************** ****** .*.  * .

488. spacer 8.12|351174|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcgtcttgttcggtccgtccgtcgacagtgga	CRISPR spacer
tcgtcttgtccggaccgtccgtcggtgccagc	Protospacer
*********.*** **********... ..* 

489. spacer 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719

gaacagccgacatcatcaacgaaaccatcgcc	CRISPR spacer
tgctgcacgacatcatcaacgacaccttcgcc	Protospacer
 . ..  *************** *** *****

490. spacer 9.34|355308|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gaacagccgacatcatcaacgaaaccatcgcc	CRISPR spacer
tcgccgccgtcatgatcaacgaaaccatcatg	Protospacer
  .* **** *** ***************.. 

491. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tcccgatcc----caagccttctgcttggtgtagtc	CRISPR spacer
----ggtatggagcaaacattctgcttggtgtagtc	Protospacer
    *.* .    ***.* *****************

492. spacer 9.41|355735|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 9, identity: 0.719

tcccgatcc----caagccttctgcttggtgtagtc	CRISPR spacer
----ggtatggagcaaacattctgcttggtgtagtc	Protospacer
    *.* .    ***.* *****************

493. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
gccggtttcgccggaaaccagaccagcgccta	Protospacer
...* . ******** **************  

494. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
gccggtttcgccggaaaccagaccagcgccta	Protospacer
...* . ******** **************  

495. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 9, identity: 0.719

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tccgtcatcgccggaccccagtccagcggctg	Protospacer
 ..*.*********** **** ****** *  

496. spacer 9.47|356101|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccatcgccggacaccagaccagcgccgt	CRISPR spacer
tccgtcatcgccggaccccagtccagcggctc	Protospacer
 ..*.*********** **** ****** * .

497. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 9, identity: 0.719

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
gcatctacacgctgcgctacctgcgcgatcca	Protospacer
* .  *   **********.* **********

498. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
gccggccgccgctgcgatatcagcgctgtaac	Protospacer
*  **.********** ********* .*   

499. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP029540 (Aquitalea sp. USM4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
atgggcctccgctgcgctatcagcgggcagaa	Protospacer
. ***.* ***************** *    *

500. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ctccaggacatgggcacgctggtgctcgccca	Protospacer
 .*   .***** ************ ***** 

501. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ctccaggacatgggcacgctggtgctcgccca	Protospacer
 .*   .***** ************ ***** 

502. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ctccaggacatgggcacgctggtgctcgccca	Protospacer
 .*   .***** ************ ***** 

503. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ctccaggacatgggcacgctggtgctcgccca	Protospacer
 .*   .***** ************ ***** 

504. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
ctccaggacatgggcacgctggtgctcgccca	Protospacer
 .*   .***** ************ ***** 

505. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
gccaccaacatcggcacgctggtcaaggacac	Protospacer
***********  **********  . * * .

506. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
accgtcagcatgcgcacgctggtgagcgtgaa	Protospacer
.**..**.**************** ***.   

507. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
accgtcagcatgcgcacgctggtgagcgtgaa	Protospacer
.**..**.**************** ***.   

508. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
accgtcagcatgcgcacgctggtgagcgtgaa	Protospacer
.**..**.**************** ***.   

509. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
accgtcagcatgcgcacgctggtgagcgtgaa	Protospacer
.**..**.**************** ***.   

510. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 9, identity: 0.719

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
accgtcagcatgcgcacgctggtgagcgtgaa	Protospacer
.**..**.**************** ***.   

511. spacer 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

ggttgagcatcctgaccgacgcgctgcatgtg	CRISPR spacer
agacgagcatcctgatcgccgcgctgctgggc	Protospacer
.* .***********.** ********  *  

512. spacer 9.63|357072|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

ggttgagcatcctgaccgacgcgctgcatgtg	CRISPR spacer
agacgagcatcctgatcgccgcgctgctgggc	Protospacer
.* .***********.** ********  *  

513. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

514. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

515. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

516. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

517. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

518. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

519. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

520. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

521. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

522. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

523. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

524. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

525. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

526. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

527. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

528. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

529. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

530. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

531. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

532. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

533. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

534. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

535. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

536. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

537. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

538. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

539. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

540. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

541. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

542. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

543. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

544. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

545. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

546. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

547. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

548. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

549. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

550. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

551. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

552. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

553. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

554. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

555. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

556. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

557. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

558. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

559. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

560. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

561. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

562. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

563. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

564. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

565. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

566. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

567. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

568. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

569. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

570. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

571. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

572. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

573. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

574. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

575. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

576. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

577. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

578. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

579. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

580. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

581. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

582. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

583. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

584. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

585. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

586. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

587. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

588. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

589. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

590. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

591. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

592. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

593. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

594. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

595. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

596. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ccggccggcacgtcggccatgttttcctacgt	Protospacer
.*  ***** ************.**** .* .

597. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_047993 (Microbacterium phage Quhwah, complete genome) position: , mismatch: 9, identity: 0.719

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
tcctccggctcgtcggcccggtcgaggccgtc	Protospacer
******************  ***       **

598. spacer 9.67|357332|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 9, identity: 0.719

tatgccccgtcatcggctcgtcggaaggcctg	CRISPR spacer
agtgccccgtcatcgtcacgtcggactgacct	Protospacer
 .************* * *******  * *. 

599. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 9, identity: 0.71

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
tactccgcctccaccgccacccaggcccgag	Protospacer
  ******* ** ************   *. 

600. spacer 16.4|6490417|31|NZ_AP022871|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 9, identity: 0.71

atctccgccgcctccgccacccaggaagggt	CRISPR spacer
cactcggccgccaccgccacccaggtccgca	Protospacer
  *** ****** ************   *  

601. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 9, identity: 0.727

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
ccgtttgggctggctcagcgcgaggccgagccc	Protospacer
. * *. ***  *******************  

602. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 9, identity: 0.727

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
ccgtttgggctggctcagcgcgaggccgagccc	Protospacer
. * *. ***  *******************  

603. spacer 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taggcgatggtcacgcccaccttcagagtctc	CRISPR spacer
aacgcgacggtcacgctcaccttcagctctcc	Protospacer
 * ****.********.*********  ...*

604. spacer 19.6|7659700|31|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71

gcgacgagcc------gcgcgaactcgctttcgccgt	CRISPR spacer
------agtcgttgcggcgcgaactcgatttcgccgg	Protospacer
      **.*      *********** ******** 

605. spacer 19.9|7659915|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to MK559428 (Mycobacterium phage Elephantoon, complete genome) position: , mismatch: 9, identity: 0.727

cgcgctggccagttgtgggcctcagcgaccgtc	CRISPR spacer
cgtcctggccgcttgtgggcctcagcgaatcgg	Protospacer
**. ******. **************** .   

606. spacer 1.6|287471|33|NZ_AP022871|PILER-CR matches to NC_020060 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence) position: , mismatch: 10, identity: 0.697

cgactccgagcgacccccgccgtcgaacctgaa	CRISPR spacer
gtcttccaaccgacccccgccgtcgaacagaag	Protospacer
   .***.* ******************  .*.

607. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
cccgcggtcaccgaccaggtgacgatgctgaa	Protospacer
* *************** *** ***. .... 

608. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN892483 (Microbacterium phage SonOfLevi, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

609. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK977697 (Microbacterium phage Etta, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

610. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG925352 (Microbacterium phage Nattles, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

611. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN234163 (Microbacterium phage Calix, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

612. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN807246 (Microbacterium phage Chamuel, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

613. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MT310856 (Microbacterium phage Zada, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

614. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG839017 (Microbacterium phage Baines, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

615. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN062703 (Microbacterium phage McGalleon, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

616. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MH045563 (Microbacterium phage Robinson, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

617. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MG962367 (Microbacterium phage Gelo, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

618. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN617840 (Microbacterium phage Klimt, complete genome) position: , mismatch: 10, identity: 0.688

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
accgcgtacaccgaccacgtgccgagcgtgac	Protospacer
  ****  ***************** * ....

619. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MK801727 (Gordonia phage ThankyouJordi, complete genome) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggcctccgcgacaaccgcctgcgcctggag	Protospacer
  ...** *************** *****.. 

620. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggactgcgcgataaccgcctgcgcctggag	Protospacer
  .. ********.********* *****.. 

621. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggcctccgcgacaaccgcctgcgcctggag	Protospacer
  ...** *************** *****.. 

622. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MK875793 (Gordonia phage WelcomeAyanna, complete genome) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggcctccgcgacaaccgcctgcgcctggag	Protospacer
  ...** *************** *****.. 

623. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to MH513979 (Gordonia phage Pollux, complete genome) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggactccgcgacaaccgcctgcgcctggag	Protospacer
  .. ** *************** *****.. 

624. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP018078 (Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
atcgtctgcgcgtcaaccacctgggccaattc	Protospacer
*  .******** *****.******** .  .

625. spacer 1.16|287220|32|NZ_AP022871|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcctggtcatcggcctggacatcctgattcc	CRISPR spacer
tcgctggtcgccggcctggacatcctggccgg	Protospacer
   ******..****************...  

626. spacer 1.20|287463|33|NZ_AP022871|CRT matches to NC_020060 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence) position: , mismatch: 10, identity: 0.697

cgactccgagcgacccccgccgtcgaacctgaa	CRISPR spacer
gtcttccaaccgacccccgccgtcgaacagaag	Protospacer
   .***.* ******************  .*.

627. spacer 1.21|287524|33|NZ_AP022871|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcctcccgcggccgccccgcctgcccacccgc	CRISPR spacer
ttcgctccccggccgccgcgcctgcccaccatg	Protospacer
. * ..** ******** ************   

628. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MH513979 (Gordonia phage Pollux, complete genome) position: , mismatch: 10, identity: 0.697

cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
cccggactccgcgacaaccgcctgcgcctggag	Protospacer
*  .. ** *************** *****.. 

629. spacer 1.22|287645|33|NZ_AP022871|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697

cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gagaatctgcgcggtaaccgcctggcgttccaa	Protospacer
 ************..**********  .*  . 

630. spacer 3.26|300005|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015988 (Sphingobium sp. EP60837 plasmid pEP1, complete sequence) position: , mismatch: 10, identity: 0.706

ccagcgtccactcccggccagcccacgtgaactc	CRISPR spacer
ccagcggccgctcccggccagcccaggccgttcg	Protospacer
****** **.*************** *. . .. 

631. spacer 3.28|300146|37|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.73

cgctcaccgccgattgggtgagcaagcgcaccgcggc	CRISPR spacer
tccacggcagggagtgggtgagcaggcgcaccgcggc	Protospacer
. * *. *.  ** **********.************

632. spacer 3.35|300659|36|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722

ctcctcaccgcccgcgccgagccctgcgagcacggc	CRISPR spacer
gccgaagacgccctcgccgagcccggcgagcacgcc	Protospacer
 .*   . ***** ********** ********* *

633. spacer 3.39|300950|35|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 10, identity: 0.714

gtcgtaattggtgacggccagccgcttgaccgccc	CRISPR spacer
gttcggcccggtgacggccagccgctcgcccgccg	Protospacer
**.  . ..*****************.* ***** 

634. spacer 3.39|300950|35|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.714

gtcgtaattggtgacggccagccgcttgaccgccc	CRISPR spacer
cgaggagcatgtgccggccagccgcatgaccgccc	Protospacer
   * *..  *** *********** *********

635. spacer 3.54|302052|34|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to MK305891 (Streptomyces phage Gibson, complete genome) position: , mismatch: 10, identity: 0.706

ccggccacggcagcgacaccagcgcctcggtgcc	CRISPR spacer
ccggccacggcgacgacaccagcgagccagccag	Protospacer
***********..***********  .*.*.   

636. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
ccggaggatggcggcccgctgctgccgtttga	Protospacer
.******.* ************** .*  .. 

637. spacer 4.48|318742|32|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP038237 (Leisingera sp. NJS201 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

tcggagggtcgcggcccgctgctggtgggcac	CRISPR spacer
ccggaggatggcggcccgctgctgccgtttga	Protospacer
.******.* ************** .*  .. 

638. spacer 4.57|319437|34|NZ_AP022871|CRISPRCasFinder matches to MT639641 (Microbacterium phage Phinky, complete genome) position: , mismatch: 10, identity: 0.706

cctccgtgatcgtgaagccgccggcctcgaccgg	CRISPR spacer
caggtggatgcgtgatgccgccggcatcgaccgg	Protospacer
*   .* .  ***** ********* ********

639. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.688

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
cgccggccacgacatcgaggtcgcctttgcgc	Protospacer
  .********* ***** *******. . * 

640. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
cgccggccacgacatcgaggtcgcctttgcgc	Protospacer
  .********* ***** *******. . * 

641. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 10, identity: 0.688

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
catcggtcacgaaatcgatggcgccggtgacc	Protospacer
  ****.************* ****   .*  

642. spacer 6.7|328212|33|NZ_AP022871|CRISPRCasFinder,PILER-CR matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.697

tggtcgctgctgtcgctgccgaagctgtgaccc	CRISPR spacer
aacgcctcgcggtcgctgccgaagccgtgaccg	Protospacer
 .  * ..** **************.****** 

643. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cgcaatttgatcgcctggctcggccccgcggc	Protospacer
..*    ******** ******** *****..

644. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cgcaatttgatcgcctggctcggccccgcggc	Protospacer
..*    ******** ******** *****..

645. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
atgccggtgatcgccggcatcggcgccagccc	Protospacer
   **************  ********.   .

646. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
atgccggtgctcgccgggctctgcgccatcgc	Protospacer
   ****** *********** *****.. ..

647. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
atgccggtgatcgccggcatcggcgccagccc	Protospacer
   **************  ********.   .

648. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gatggcgtgatcgccgggttcggcaccgcagg	Protospacer
 *.   ************.*****.****.. 

649. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cgcgacgtgctcgtcgggctcggcgccgctga	Protospacer
..*   *** ***.*************** . 

650. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcgacgtgatcgtcgggctcggcaccgccgg	Protospacer
 .*   *******.**********.**** . 

651. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
cggctggtcatcgccgggctcggccccggatc	Protospacer
.. *.*** *************** *** . .

652. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcgacgtgatcgtcgggctcggcaccgccgg	Protospacer
 .*   *******.**********.**** . 

653. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcagcctgatcgcggtgctcggcgccgcgga	Protospacer
 .*    ******* * *************. 

654. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP046053 (Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctttcggtgatcgccgagctcgacgccaaggg	Protospacer
. ..************.*****.****. *. 

655. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gcggcggtgatcggcgggctctgcgccctgtc	Protospacer
    ********* ******* ***** .* .

656. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcgacgtgatcgtcgggctcggcaccgccgg	Protospacer
 .*   *******.**********.**** . 

657. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcgacgtgatcgtcgggctcggcaccgccgg	Protospacer
 .*   *******.**********.**** . 

658. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ggcagcctgatcgcggtgctcggcgccgcgga	Protospacer
 .*    ******* * *************. 

659. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctttcggtgatcgccgagctcgacgccaaggg	Protospacer
. ..************.*****.****. *. 

660. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
ctgtcggtgatcgccgagctcgacgccaaggg	Protospacer
.  .************.*****.****. *. 

661. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
catgcggtgaccgccaggctcggcgccttccg	Protospacer
.*. ******.****.*********** .   

662. spacer 6.11|328456|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tacccggtgatcgccgggctcggcgccgcgat	CRISPR spacer
gccgcggtgatcgccggcctcgccgccttcgc	Protospacer
  * ************* **** **** . ..

663. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 10, identity: 0.688

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
ggggcgcggaccgggatcgacgacggggggac	Protospacer
  ************.** *******  * .. 

664. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

665. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

666. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

667. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

668. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

669. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

670. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

671. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP021357 (Rhodococcus sp. S2-17 plasmid pRB11, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tgcggcggtgagcatggtgatgaccaccagggt	Protospacer
.*************.*****.****.    *..

672. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

673. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

674. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

675. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

676. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

677. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

678. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

679. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

680. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

681. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

682. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

683. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

684. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

685. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

686. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

687. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

688. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

689. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

690. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

691. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

692. spacer 6.14|328637|33|NZ_AP022871|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

cgcggcggtgagcacggtgacgaccgagccgac	CRISPR spacer
tctcgcgctgaacacggtgacgaccgaggtcgc	Protospacer
. . *** ***.**************** . .*

693. spacer 6.15|328698|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gaccccgccccggtgtggaccgacctcaccgc	CRISPR spacer
cctcatcccccggtgtggaccgaactcccctg	Protospacer
  .* . **************** *** **  

694. spacer 7.2|345871|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 10, identity: 0.697

gcggatctcccagtcgatcgcttggctgaggcg	CRISPR spacer
cgccttcacccagtcgatcgcttggccgacgtc	Protospacer
     ** ******************.** *. 

695. spacer 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 10, identity: 0.697

ggacaagtcgccgtccagctcgacgatgaccca	CRISPR spacer
gctgcgtccggcgtccagctcgacggtgacccg	Protospacer
*    . .** **************.******.

696. spacer 7.8|346237|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctgcgggtggtcacggtgaccctggc	CRISPR spacer
gctctcctgccggcggtcacggtgaccggcga	Protospacer
    ****** **.*************   * 

697. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP029792 (Psychrobacter sp. YP14 plasmid pYP14c, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
tcgctgctgatcgcgctcgcgctggcatcaga	Protospacer
 ************.****** *** . * .. 

698. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gaggcgctcttcgtgctcgccctgttctactg	Protospacer
. * .***  ******************.   

699. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN657041 (Psychrobacter sp. strain ANT_P17 plasmid pA17P4, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
tcgctgctgatcgcgctcgcgctggcatcaga	Protospacer
 ************.****** *** . * .. 

700. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gaggcgctcttcgtgctcgccctgttctactg	Protospacer
. * .***  ******************.   

701. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gaggcgctcttcgtgctcgccctgttctactg	Protospacer
. * .***  ******************.   

702. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP012534 (Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence) position: , mismatch: 10, identity: 0.688

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
tcgctgctgatcgcgctcgcgctggcatcaga	Protospacer
 ************.****** *** . * .. 

703. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 10, identity: 0.697

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
gcccacacgcgccagacccgcgagcttgccatc	Protospacer
. .  ** ********** ***********.. 

704. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 10, identity: 0.697

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
gcccacacgcgccagacccgcgagcttgccatc	Protospacer
. .  ** ********** ***********.. 

705. spacer 7.18|346843|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.697

aatatcaagcgccagaccggcgagcttgccgcg	CRISPR spacer
tttccacagcaccagatcggcgagcttgccgac	Protospacer
  * .  ***.*****.**************  

706. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP009252 (Corynebacterium stationis strain 622=DSM 20302 plasmid pCstat1, complete sequence) position: , mismatch: 10, identity: 0.697

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
gagcgcaccgaggccgcccgcgctgaggctgca	Protospacer
.   .**.* ******************* *..

707. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_020553 (Corynebacterium callunae DSM 20147 plasmid pCC2, complete sequence) position: , mismatch: 10, identity: 0.697

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
gagcgcaccgaggccgcccgcgctgaggctgca	Protospacer
.   .**.* ******************* *..

708. spacer 7.28|347450|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP023707 (Edwardsiella tarda strain KC-Pc-HB1 plasmid pEh-Pc1, complete sequence) position: , mismatch: 10, identity: 0.697

gccgtagcggcgccctcctggatggcgggactg	CRISPR spacer
gccgtggtggcgccctcctggatgctccctgta	Protospacer
*****.*.**************** .     *.

709. spacer 8.2|350563|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 10, identity: 0.697

acccacgaaccggcggtgttggagccggccacg	CRISPR spacer
caggacgaaccggcggagttcgagccggacggc	Protospacer
    ************ *** ******* *.  

710. spacer 8.3|350624|34|NZ_AP022871|CRISPRCasFinder matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

gcgacggtcggcgacgacaactactgggccgagg--------	CRISPR spacer
gcgacggtcggcgaagacatctac--------ggttcgttcc	Protospacer
************** **** ****        **        

711. spacer 8.10|351052|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

tcctccctgccttgctggtggcctcccggccgg	CRISPR spacer
cgccgtagaccttcctcgtggcctcccggccgg	Protospacer
. *. .  .**** ** ****************

712. spacer 8.11|351113|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 10, identity: 0.697

ccacagcggcatggccttcgggcgtcgcccacg	CRISPR spacer
aggtcgcggcatagccgtcgggcgtcgccatca	Protospacer
  .. *******.*** ************  *.

713. spacer 8.11|351113|33|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 10, identity: 0.697

ccacagcggcatggccttcgggcgtcgcccacg	CRISPR spacer
ctggtctcccatggccttcgggcgtcgacgacg	Protospacer
*..   .  ****************** * ***

714. spacer 9.37|355491|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgacgctgaatccacgcgcaaggtggc	CRISPR spacer
aacaccgacgccgaagccacgcgcatcaccaa	Protospacer
.**********.*** *********  .. . 

715. spacer 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 10, identity: 0.688

catccacttgtagatagcgcatgggaaggggc	CRISPR spacer
gcagcacttgtcgatagcgcatcggaagaata	Protospacer
    ******* ********** *****..  

716. spacer 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 10, identity: 0.688

catccacttgtagatagcgcatgggaaggggc	CRISPR spacer
gcagcacttgtcgatagcgcatcggaagaata	Protospacer
    ******* ********** *****..  

717. spacer 9.50|356283|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MK448856 (Streptococcus phage Javan158, complete genome) position: , mismatch: 10, identity: 0.688

catccacttgtagatagcgcatgggaaggggc	CRISPR spacer
gcagcacttgtcgatagcgcatcggaagaata	Protospacer
    ******* ********** *****..  

718. spacer 9.55|356585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 10, identity: 0.688

gagggtcgccgctgcgctatcagcgcgatcca	CRISPR spacer
gcatcgcgccgctgcgctataatcgcgatggc	Protospacer
* .   ************** * ******   

719. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
cttcaggacatgggcacgctggtgctcgccca	Protospacer
 ..   .***** ************ ***** 

720. spacer 9.58|356767|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 10, identity: 0.688

gccaccaacatgcgcacgctggtgcgcgccct	CRISPR spacer
tcggtcaacatgcgcacgctggtccccgttgc	Protospacer
 * ..****************** * **.. .

721. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
aacagaacttcgtcggccatgcctgccagctc	Protospacer
  *   . .************.** *******

722. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
cgggtcagctcgtcggcgatctcttccagcag	Protospacer
.   .*.********** ** *********  

723. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ctggcgagctcgtcgaccgtgtcttccagcgg	Protospacer
..  * .********.**.***********  

724. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
ctggcgagctcgtcgaccgtgtcttccagcgg	Protospacer
..  * .********.**.***********  

725. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
aacagaacttcgtcggccatgcctgccagctc	Protospacer
  *   . .************.** *******

726. spacer 9.66|357271|32|NZ_AP022871|CRISPRCasFinder,CRT matches to MN234211 (Arthrobacter phage Mimi, complete genome) position: , mismatch: 10, identity: 0.688

tcctccggctcgtcggccatgtcttccagctc	CRISPR spacer
tcctcaggctcatcggccatgtcgttggcgaa	Protospacer
***** *****.*********** *. .    

727. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
caagggcagcacgatcagcgcgaggcagagcag	Protospacer
....  ..***** ************ ******

728. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
gatgcccatcacgctcatcgcgagggcgagcag	Protospacer
 . ..*.. ******** ******* *******

729. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.697

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
gatgcccatcacgctcatcgcgagggcgagcag	Protospacer
 . ..*.. ******** ******* *******

730. spacer 19.3|7659489|33|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.697

tggatctggcacgctcagcgcgaggccgagcag	CRISPR spacer
gatgcccatcacgctcatcgcgagggcgagcag	Protospacer
 . ..*.. ******** ******* *******

731. spacer 19.5|7659632|32|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025409 (Paracoccus sp. BM15 plasmid pBM151, complete sequence) position: , mismatch: 10, identity: 0.688

taggcgatggtcacgcccaccttcagagtctc	CRISPR spacer
gcggcgatggtgtcgcccaccttcaccagaac	Protospacer
  *********  ************  .   *

732. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 11, identity: 0.656

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
aaggcggtcaccgcccgcgtgccgacgcggac	Protospacer
 . ********** **.********* . ...

733. spacer 1.14|287585|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 11, identity: 0.656

cgcgcggtcaccgaccacgtgccgacctcagt	CRISPR spacer
aaggcggtcaccgcccgcgtgccgacgcggac	Protospacer
 . ********** **.********* . ...

734. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.656

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gttcggtgcgcgacatccgcctggggctggag	Protospacer
.     ********* ********* ***.. 

735. spacer 1.15|287646|32|NZ_AP022871|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 11, identity: 0.656

agaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
ccggcctccgcgacaaccgcctgcgcctcgaa	Protospacer
  ...** *************** **** .. 

736. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MK801727 (Gordonia phage ThankyouJordi, complete genome) position: , mismatch: 11, identity: 0.667

cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gccggcctccgcgacaaccgcctgcgcctggag	Protospacer
   ...** *************** *****.. 

737. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 11, identity: 0.667

cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gccggcctccgcgacaaccgcctgcgcctggag	Protospacer
   ...** *************** *****.. 

738. spacer 1.22|287645|33|NZ_AP022871|CRT matches to MK875793 (Gordonia phage WelcomeAyanna, complete genome) position: , mismatch: 11, identity: 0.667

cagaatctgcgcgacaaccgcctgggcctgagt	CRISPR spacer
gccggcctccgcgacaaccgcctgcgcctggag	Protospacer
   ...** *************** *****.. 

739. spacer 3.9|298757|34|NZ_AP022871|PILER-CR,CRISPRCasFinder,CRT matches to NC_015592 (Sinorhizobium meliloti AK83 plasmid pSINME02, complete sequence) position: , mismatch: 11, identity: 0.676

cgtagtattcggcgcgcgagacaagcgcgacctg	CRISPR spacer
cgtcgtattcggcgcccgagacaacaccagtgaa	Protospacer
*** *********** ********   *...  .

740. spacer 3.42|301160|38|NZ_AP022871|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 11, identity: 0.711

cggcaggcgatgcgcgccctgcacctgcaccgcaccgc	CRISPR spacer
catgaggcgatgcgcgccctgcccctccaccgacagat	Protospacer
*.  ****************** *** *****    ..

741. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to MH045556 (Microbacterium phage BonaeVitae, complete genome) position: , mismatch: 11, identity: 0.656

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
cgtcggccacgaactcgatgtagccgaggccg	Protospacer
  *********** ******* ***  ..  .

742. spacer 6.1|327847|32|NZ_AP022871|CRISPRCasFinder matches to MN234191 (Microbacterium phage Naby, complete genome) position: , mismatch: 11, identity: 0.656

actcggccacgaaatcgatgtcgcctcaaaga	CRISPR spacer
cgtcggccacgaactcgatgtagccgaggccg	Protospacer
  *********** ******* ***  ..  .

743. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 11, identity: 0.656

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cgcctgctgaccggaatggacgacgtcgatat	Protospacer
.   .** *****************.**  . 

744. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 11, identity: 0.656

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cgcctgctgaccggaatggacgacgtcgatat	Protospacer
.   .** *****************.**  . 

745. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 11, identity: 0.656

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
cgcctgctgaccggaatggacgacgtcgatat	Protospacer
.   .** *****************.**  . 

746. spacer 6.12|328516|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

tcggcgcggaccggaatggacgacgccgcagg	CRISPR spacer
gaacagcgcatcggaatggacgacgccgacct	Protospacer
  .  *** *.*****************    

747. spacer 6.20|329000|32|NZ_AP022871|CRISPRCasFinder matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

ggtcgagcgaccatccgggaaatgcaaagtct	CRISPR spacer
aaggcggcgaccatccgggaactgaaaagctg	Protospacer
..   .*************** ** ****.. 

748. spacer 7.7|346176|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667

ggacaagtcgccgtccagctcgacgatgaccca	CRISPR spacer
ttcgcgttcgccgtccagcgcgacgatgcccgt	Protospacer
     . ************ ******** **  

749. spacer 7.14|346601|32|NZ_AP022871|CRISPRCasFinder,CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 11, identity: 0.656

acgctgctgatcgtgctcgccctgttctggat	CRISPR spacer
gaagcgctcttcgtgctcgccctgttctactg	Protospacer
. . .***  ******************.   

750. spacer 7.21|347024|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 11, identity: 0.667

atcgacatccaggccgcccgcgctgaggcggtg	CRISPR spacer
ccagacaaccaggccgccctcgctgagagacca	Protospacer
 . **** *********** *******. . ..

751. spacer 7.29|347511|33|NZ_AP022871|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.667

gtcgcggcgaccgcacctagcccggcgccgtcc	CRISPR spacer
ccatcggcgtccgcacatagcccggcgctactg	Protospacer
 .  ***** ****** ***********.... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6445386 : 6483766 39 Paenibacillus_phage(25.0%) transposase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage