Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP039524 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 0 11 0
NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 1 crisprs DinG,RT,c2c9_V-U4 0 11 5 0
NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP039524
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039524_1 4573703-4573797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 446334 : 479592 34 uncultured_Caudovirales_phage(75.0%) head,protease,terminase,capsid,tRNA,portal,integrase,tail attL 463942:463959|attR 479937:479954
DBSCAN-SWA_2 1236913 : 1283148 61 Salmonella_phage(83.72%) head,coat,terminase,lysis,plate,capsid,tRNA,portal,integrase,tail attL 1235207:1235253|attR 1271774:1271820
DBSCAN-SWA_3 1387864 : 1453475 69 Salmonella_phage(37.25%) protease,terminase,transposase,holin,integrase,tail attL 1388859:1388876|attR 1456223:1456240
DBSCAN-SWA_4 1761772 : 1768677 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_5 1813117 : 1826434 13 Enterobacteria_phage(22.22%) transposase NA
DBSCAN-SWA_6 2822218 : 2833106 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3062178 : 3099779 58 uncultured_Caudovirales_phage(32.61%) terminase,integrase attL 3090892:3090906|attR 3096901:3096915
DBSCAN-SWA_8 3522203 : 3615154 96 Salmonella_phage(57.63%) head,integrase,protease,lysis,plate,capsid,tRNA,portal,terminase,tail attL 3577729:3577747|attR 3615229:3615247
DBSCAN-SWA_9 4054878 : 4099510 68 Salmonella_phage(25.0%) terminase,tRNA,holin,lysis NA
DBSCAN-SWA_10 4310179 : 4322070 14 Enterobacteria_phage(66.67%) transposase NA
DBSCAN-SWA_11 4790306 : 4796131 8 Enterobacteria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP039526
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039526_1 27979-28617 Orphan NA
10 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53060-53091 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17763-17794 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251766-251797 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 115104-115135 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201125-201156 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7574-7605 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31406-31437 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30539-30570 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227434-227465 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28008-28039 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300640-300671 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8343-8374 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136273-136304 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62270-62301 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332548-332579 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229626-229657 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28275-28306 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313883-313914 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 10910-10941 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 57165-57196 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3706-3737 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42016-42047 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 54347-54378 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 54409-54440 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 56677-56708 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 30695-30726 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114832-114863 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144764-144795 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75989-76020 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 51186-51217 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53594-53625 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132514-132545 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132149-132180 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279495-279526 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 28218-28249 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29296-29327 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57000-57031 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28251-28282 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 43060-43091 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59901-59932 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306137-306168 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4647-4678 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53121-53152 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32453-32484 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17641-17672 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17702-17733 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7737-7768 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251827-251858 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 115043-115074 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201064-201095 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7634-7665 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7694-7725 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223968-223999 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25434-25465 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33519-33550 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30341-30372 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30600-30631 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32453-32484 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221198-221229 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28069-28100 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139046-139077 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7758-7789 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300579-300610 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 3002-3033 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136334-136365 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30091-30122 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62331-62362 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332609-332640 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229687-229718 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28336-28367 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313822-313853 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 10971-11002 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3767-3798 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142564-142595 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37329-37360 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243834-243865 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114771-114802 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144825-144856 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168178-168209 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2472-2503 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254623-254654 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30091-30122 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32453-32484 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53655-53686 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132575-132606 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132210-132241 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29357-29388 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42784-42815 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100575-100606 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57061-57092 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85368-85399 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30155-30186 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32479-32510 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130323-130354 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28312-28343 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130407-130438 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42999-43030 0 1.0
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59840-59871 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325885-325916 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158963-158994 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31467-31498 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30661-30692 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28130-28161 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11022-11053 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP024491 Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence 2511-2542 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28397-28428 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115786-115817 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240104-240135 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP050824 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence 203-234 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP034050 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed5, complete sequence 2460-2491 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052340 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-3, complete sequence 686-717 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132636-132667 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132271-132302 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279434-279465 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29418-29449 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57122-57153 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28373-28404 0 1.0
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42938-42969 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149403-149434 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53243-53274 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8566-8597 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24709-24740 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5152-5183 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17519-17550 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30220-30251 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251888-251919 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114982-115013 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201003-201034 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7815-7846 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223846-223877 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227617-227648 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221320-221351 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28191-28222 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138924-138955 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7880-7911 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300457-300488 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8160-8191 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136395-136426 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62392-62423 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332731-332762 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229748-229779 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28519-28550 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313761-313792 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277747-277778 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30216-30247 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11154-11185 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3828-3859 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42138-42169 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95652-95683 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128123-128154 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37390-37421 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243712-243743 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114710-114741 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117545-117576 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144947-144978 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30158-30189 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60651-60682 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254562-254593 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53716-53747 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102289-102320 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54807-54838 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132697-132728 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48770-48801 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279312-279343 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29479-29510 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42845-42876 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57244-57275 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85246-85277 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30033-30064 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130445-130476 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130529-130560 0 1.0
NZ_CP039526_1 1.4|28191|32|NZ_CP039526|CRT 28191-28222 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59779-59810 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149342-149373 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53304-53335 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8505-8536 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24770-24801 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5213-5244 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30281-30312 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251949-251980 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114921-114952 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200942-200973 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227678-227709 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28252-28283 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138863-138894 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300396-300427 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8099-8130 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136456-136487 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62453-62484 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332792-332823 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229809-229840 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28580-28611 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313700-313731 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277686-277717 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30277-30308 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11215-11246 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3889-3920 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42199-42230 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95591-95622 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128062-128093 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114649-114680 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117484-117515 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145008-145039 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30219-30250 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75867-75898 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60712-60743 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53777-53808 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102350-102381 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54868-54899 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132758-132789 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48831-48862 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29540-29571 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57305-57336 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85185-85216 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28495-28526 0 1.0
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59718-59749 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53365-53396 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252010-252041 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114860-114891 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200881-200912 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31528-31559 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227739-227770 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28313-28344 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300335-300366 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8038-8069 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136517-136548 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62514-62545 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332853-332884 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229870-229901 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28641-28672 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313639-313670 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11276-11307 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3949-3980 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42260-42291 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37511-37542 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243591-243622 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114588-114619 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145069-145100 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75806-75837 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254441-254472 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53838-53869 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132819-132850 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132332-132363 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29601-29632 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42967-42998 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57366-57397 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28556-28587 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42877-42908 0 1.0
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59657-59688 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 30928-30959 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53426-53457 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252070-252101 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114799-114830 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200820-200851 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31589-31620 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227800-227831 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28374-28405 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300274-300305 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7977-8008 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136578-136609 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62575-62606 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332914-332945 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229931-229962 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28702-28733 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313578-313609 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11337-11368 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4010-4041 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42321-42352 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114527-114558 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145130-145161 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75745-75776 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53899-53930 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132880-132911 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132393-132424 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29662-29693 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57427-57458 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28617-28648 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42816-42847 0 1.0
NZ_CP039526_1 1.7|28374|32|NZ_CP039526|CRT 28374-28405 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59596-59627 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305900-305931 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149166-149197 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53487-53518 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32690-32721 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8329-8360 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24946-24977 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5389-5420 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30457-30488 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252131-252162 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114738-114769 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200759-200790 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223785-223816 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25671-25702 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33756-33787 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31650-31681 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30578-30609 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32690-32721 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227861-227892 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221381-221412 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28435-28466 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138687-138718 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8114-8145 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300213-300244 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7916-7947 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136639-136670 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30328-30359 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62636-62667 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332975-333006 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229992-230023 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28763-28794 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313517-313548 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277564-277595 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30453-30484 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11398-11429 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4071-4102 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42382-42413 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95415-95446 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127886-127917 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37686-37717 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243414-243445 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114466-114497 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117308-117339 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145191-145222 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30395-30426 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168415-168446 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75684-75715 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60888-60919 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254265-254296 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30328-30359 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32690-32721 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53960-53991 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102526-102557 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55044-55075 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132941-132972 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49007-49038 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132454-132485 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29723-29754 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43143-43174 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100338-100369 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57488-57519 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85009-85040 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29796-29827 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32655-32686 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130682-130713 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28678-28709 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130766-130797 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42755-42786 0 1.0
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59535-59566 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305839-305870 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149105-149136 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53548-53579 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32751-32782 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8268-8299 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25007-25038 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5450-5481 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323031-323062 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33374-33405 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30518-30549 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252192-252223 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114677-114708 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200698-200729 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25732-25763 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33817-33848 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31711-31742 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30639-30670 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32751-32782 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227922-227953 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28496-28527 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138626-138657 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300152-300183 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7855-7886 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136700-136731 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30389-30420 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62697-62728 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 333036-333067 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230053-230084 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28824-28855 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313457-313488 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277503-277534 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30514-30545 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11459-11490 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4131-4162 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42443-42474 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142381-142412 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95354-95385 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127825-127856 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37747-37778 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243353-243384 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114405-114436 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117247-117278 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145252-145283 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30456-30487 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168476-168507 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75623-75654 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60949-60980 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254205-254236 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30389-30420 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32751-32782 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54021-54052 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102587-102618 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55105-55136 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133002-133033 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49068-49099 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132515-132546 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33375-33406 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29784-29815 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43204-43235 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100277-100308 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57549-57580 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84948-84979 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29735-29766 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32716-32747 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130743-130774 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28739-28770 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130827-130858 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42694-42725 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59474-59505 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MK416022 Klebsiella phage ST846-OXA48phi9.2, complete genome 21169-21200 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 24972-25003 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 KY271399 Klebsiella phage 5 LV-2017, complete genome 18199-18230 0 1.0
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 28530-28561 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305778-305809 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32812-32843 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252253-252284 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325946-325977 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114616-114647 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 159024-159055 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25793-25824 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33878-33909 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31772-31803 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30700-30731 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32812-32843 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228043-228074 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28557-28588 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138565-138596 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10961-10992 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7734-7765 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136761-136792 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30450-30481 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62758-62789 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230114-230145 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28885-28916 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115847-115878 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313397-313428 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30575-30606 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11520-11551 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4192-4223 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42504-42535 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142320-142351 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127764-127795 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37807-37838 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243292-243323 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114344-114375 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30517-30548 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168537-168568 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254145-254176 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30450-30481 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32812-32843 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54082-54113 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133063-133094 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132576-132607 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29845-29876 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43265-43296 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57609-57640 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84520-84551 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84887-84918 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29674-29705 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32777-32808 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130804-130835 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28800-28831 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130888-130919 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42633-42664 0 1.0
NZ_CP039526_1 1.10|28557|32|NZ_CP039526|CRT 28557-28588 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59414-59445 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325868-325901 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158946-158979 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31450-31483 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30644-30677 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28113-28146 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28380-28413 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115769-115802 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11015-11048 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132619-132652 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132254-132287 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29401-29434 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57105-57138 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28356-28389 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11037-11070 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240119-240152 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279449-279482 0 1.0
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42953-42986 0 1.0
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 85324-85355 1 0.969
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227495-227526 1 0.969
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8282-8313 1 0.969
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_CP050828 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence 8408-8439 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28458-28489 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279373-279404 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57183-57214 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28434-28465 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306076-306107 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149464-149495 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53182-53213 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32514-32545 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8627-8658 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24648-24679 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5091-5122 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17580-17611 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30159-30190 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP036322 Klebsiella pneumoniae strain VBA2172 plasmid pCol440I 5889-5920 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7755-7786 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223907-223938 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25495-25526 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33580-33611 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30402-30433 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32514-32545 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227556-227587 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221259-221290 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138985-139016 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7819-7850 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP033949 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence 5194-5225 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300518-300549 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8221-8252 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30152-30183 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332670-332701 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP034676 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence 621-652 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277808-277839 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30155-30186 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11032-11063 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11093-11124 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP011627 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-14, complete sequence 6312-6343 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42077-42108 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142503-142534 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95713-95744 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128184-128215 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243773-243804 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117606-117637 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144886-144917 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30097-30128 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168239-168270 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75928-75959 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60590-60621 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30152-30183 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32514-32545 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102228-102259 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54746-54777 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48709-48740 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP044044 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence 6623-6654 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100514-100545 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85307-85338 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30094-30125 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130384-130415 1 0.969
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130468-130499 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37451-37482 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243651-243682 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254502-254533 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42906-42937 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29972-30003 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130506-130537 1 0.969
NZ_CP039526_1 1.5|28252|32|NZ_CP039526|CRT 28252-28283 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130590-130621 1 0.969
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8175-8206 1 0.969
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28441-28474 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11076-11109 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57166-57199 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28417-28450 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279388-279421 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53165-53198 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332653-332686 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42060-42093 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144869-144902 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300533-300566 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32497-32530 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24631-24664 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5074-5107 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30142-30175 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7738-7771 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25478-25511 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33563-33596 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30385-30418 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32497-32530 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227539-227572 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221242-221275 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7802-7835 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30135-30168 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30138-30171 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30080-30113 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168222-168255 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60573-60606 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30135-30168 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32497-32530 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102211-102244 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54729-54762 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48692-48725 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130367-130400 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130451-130484 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306091-306124 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149479-149512 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8642-8675 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17595-17628 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223922-223955 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139000-139033 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8236-8269 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277823-277856 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142518-142551 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95728-95761 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128199-128232 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243788-243821 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117621-117654 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75943-75976 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100529-100562 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85322-85355 1 0.971
NZ_CP039526_1 1.11|28113|34|NZ_CP039526|CRISPRCasFinder 28113-28146 34 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30109-30142 1 0.971
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17458-17489 2 0.938
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7875-7906 2 0.938
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7940-7971 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 109028-109059 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 2873-2904 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 21051-21082 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 35469-35500 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP011587 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence 43562-43593 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 17901-17932 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 67978-68009 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 138432-138463 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 128487-128518 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 22387-22418 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 83959-83990 2 0.938
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 43520-43551 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 5208-5239 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 4882-4913 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 32898-32929 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 24918-24949 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 10160-10191 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 79984-80015 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP012569 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence 27705-27736 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 20164-20195 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 74196-74227 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 195576-195607 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 27095-27126 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 68250-68281 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 43913-43944 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP012564 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence 32775-32806 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 30482-30513 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 37625-37656 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 9942-9973 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 37962-37993 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 4858-4889 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP032188 Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence 45171-45202 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 103264-103295 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 66379-66410 3 0.906
NZ_CP039526_1 1.8|28435|32|NZ_CP039526|CRT 28435-28466 32 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 30882-30913 3 0.906
NZ_CP039526_1 1.2|28069|32|NZ_CP039526|CRT 28069-28100 32 NZ_FO704549 Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence 2602-2633 5 0.844
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 33088-33119 6 0.812
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 191931-191962 6 0.812
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 160783-160814 6 0.812
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 191931-191962 6 0.812
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP043767 Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence 165660-165691 6 0.812
NZ_CP039526_1 1.1|28008|32|NZ_CP039526|CRT 28008-28039 32 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 191931-191962 6 0.812
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP028385 Providencia heimbachae strain 99101 plasmid unnamed, complete sequence 89463-89494 7 0.781
NZ_CP039526_1 1.3|28130|32|NZ_CP039526|CRT 28130-28161 32 KC292028 Halovirus HCTV-2, complete genome 49760-49791 9 0.719
NZ_CP039526_1 1.6|28313|32|NZ_CP039526|CRT 28313-28344 32 NZ_CP030844 Acidisarcina polymorpha strain SBC82 plasmid pACPOL3, complete sequence 49093-49124 10 0.688
NZ_CP039526_1 1.9|28496|32|NZ_CP039526|CRT 28496-28527 32 NC_019739 Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence 94385-94416 10 0.688

1. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

2. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

3. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

4. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

5. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

6. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

7. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

8. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

9. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

10. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

11. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

12. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

13. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

14. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

15. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

16. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

17. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

18. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

19. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

20. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

21. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

22. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

23. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

24. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

25. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

26. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

27. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

28. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

29. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

30. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

31. spacer 1.1|28008|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

32. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

33. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

34. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

35. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

36. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

37. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

38. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

39. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

40. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgtttccggattatatggctggaacgt	Protospacer
********************************

41. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

42. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

43. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

44. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

45. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

46. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

47. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

48. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

49. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

50. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

51. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

52. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

53. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

54. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

55. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

56. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

57. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

58. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

59. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

60. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

61. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

62. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

63. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

64. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

65. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

66. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

67. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

68. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

69. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

70. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

71. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

72. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

73. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

74. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

75. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

76. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

77. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

78. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

79. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

80. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

81. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

82. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

83. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

84. spacer 1.2|28069|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

85. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

86. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

87. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

88. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

89. spacer 1.2|28069|32|NZ_CP039526|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

90. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

91. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

92. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

93. spacer 1.2|28069|32|NZ_CP039526|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

94. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

95. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

96. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

97. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

98. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

99. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

100. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

101. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

102. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

103. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

104. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

105. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP024491 (Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

106. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

107. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

108. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

109. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP050824 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

110. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP034050 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

111. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052340 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

112. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

113. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

114. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

115. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

116. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

117. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

118. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
********************************

119. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

120. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

121. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

122. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

123. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

124. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

125. spacer 1.4|28191|32|NZ_CP039526|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

126. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

127. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

128. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

129. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

130. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

131. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

132. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

133. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

134. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

135. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

136. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

137. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

138. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

139. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

140. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

141. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

142. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

143. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

144. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

145. spacer 1.4|28191|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

146. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

147. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

148. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

149. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

150. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

151. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

152. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

153. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

154. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

155. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

156. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

157. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

158. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

159. spacer 1.4|28191|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

160. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

161. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

162. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

163. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

164. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

165. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

166. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

167. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

168. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

169. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

170. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

171. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

172. spacer 1.4|28191|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

173. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

174. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

175. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

176. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

177. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

178. spacer 1.5|28252|32|NZ_CP039526|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

179. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

180. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

181. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

182. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

183. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

184. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

185. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

186. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

187. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

188. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

189. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

190. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

191. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

192. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

193. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

194. spacer 1.5|28252|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

195. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

196. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

197. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

198. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

199. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

200. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

201. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

202. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

203. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

204. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

205. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

206. spacer 1.5|28252|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

207. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

208. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

209. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

210. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

211. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

212. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

213. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

214. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

215. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacggataccttttgcacagtgtta	Protospacer
********************************

216. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

217. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

218. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

219. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

220. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

221. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

222. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

223. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

224. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

225. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

226. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

227. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

228. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

229. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

230. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

231. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

232. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

233. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

234. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

235. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

236. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

237. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

238. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

239. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

240. spacer 1.6|28313|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

241. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

242. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

243. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

244. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

245. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

246. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

247. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

248. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggg	Protospacer
********************************

249. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

250. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

251. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

252. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

253. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

254. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

255. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

256. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

257. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

258. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

259. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

260. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

261. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

262. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

263. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

264. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

265. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

266. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

267. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

268. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

269. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

270. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

271. spacer 1.7|28374|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

272. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

273. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

274. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

275. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

276. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

277. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

278. spacer 1.7|28374|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

ttactttttggcagttggtaaaacacttttgc	CRISPR spacer
ttactttttggcagttggtaaaacacttttgc	Protospacer
********************************

279. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

280. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

281. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

282. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

283. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

284. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

285. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

286. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

287. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

288. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

289. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

290. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

291. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

292. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

293. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

294. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

295. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

296. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

297. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

298. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

299. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

300. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

301. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

302. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

303. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

304. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

305. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

306. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

307. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

308. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

309. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

310. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

311. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

312. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

313. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

314. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

315. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

316. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

317. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

318. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

319. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

320. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

321. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

322. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

323. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

324. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

325. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

326. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

327. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

328. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

329. spacer 1.8|28435|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

330. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

331. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

332. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

333. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

334. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

335. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

336. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

337. spacer 1.8|28435|32|NZ_CP039526|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

338. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

339. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

340. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

341. spacer 1.8|28435|32|NZ_CP039526|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

342. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

343. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

344. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

345. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

346. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

347. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

348. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

349. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

350. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

351. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

352. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

353. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

354. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

355. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

356. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

357. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

358. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

359. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

360. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

361. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

362. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

363. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

364. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

365. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

366. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

367. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

368. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

369. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

370. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

371. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

372. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

373. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

374. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

375. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

376. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

377. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

378. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

379. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

380. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

381. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

382. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

383. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

384. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

385. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

386. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

387. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

388. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

389. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

390. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

391. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

392. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

393. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

394. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

395. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

396. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

397. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

398. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

399. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

400. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

401. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

402. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

403. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

404. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

405. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

406. spacer 1.9|28496|32|NZ_CP039526|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

407. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

408. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

409. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

410. spacer 1.9|28496|32|NZ_CP039526|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

411. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

412. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

413. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

414. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

415. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

416. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MK416022 (Klebsiella phage ST846-OXA48phi9.2, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

417. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

418. spacer 1.9|28496|32|NZ_CP039526|CRT matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

419. spacer 1.9|28496|32|NZ_CP039526|CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtg	Protospacer
********************************

420. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

421. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

422. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

423. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

424. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

425. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

426. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

427. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

428. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

429. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

430. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

431. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

432. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

433. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

434. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

435. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

436. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

437. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

438. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

439. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

440. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

441. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

442. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

443. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

444. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

445. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

446. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

447. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

448. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

449. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

450. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

451. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

452. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

453. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

454. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

455. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

456. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

457. spacer 1.10|28557|32|NZ_CP039526|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

458. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

459. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

460. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

461. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

462. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

463. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

464. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

465. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

466. spacer 1.10|28557|32|NZ_CP039526|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

467. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

468. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

469. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

470. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

471. spacer 1.10|28557|32|NZ_CP039526|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

472. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

473. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

474. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

475. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

476. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

477. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

478. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

479. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

480. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

481. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

482. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

483. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

484. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

485. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

486. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

487. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

488. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
**********************************

489. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
agcaacgttttcggattatatggctggaacgt	Protospacer
**********.*********************

490. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

491. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

492. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_CP050828 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgtgctctcaaccgtcacccgctggctggaa	Protospacer
* ******************************

493. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

494. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

495. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

496. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

497. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

498. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

499. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
****************.***************

500. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

501. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

502. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

503. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

504. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

505. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

506. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP036322 (Klebsiella pneumoniae strain VBA2172 plasmid pCol440I) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

507. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

508. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

509. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

510. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

511. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

512. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

513. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

514. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

515. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

516. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

517. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP033949 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

518. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
****************.***************

519. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

520. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

521. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
****************.***************

522. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP034676 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

523. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

524. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

525. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgcaggctggaa	Protospacer
*********************** ********

526. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

527. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP011627 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-14, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

528. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
****************.***************

529. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

530. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

531. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

532. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

533. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

534. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
****************.***************

535. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

536. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

537. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

538. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

539. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

540. spacer 1.3|28130|32|NZ_CP039526|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

541. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

542. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

543. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

544. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP044044 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

545. spacer 1.3|28130|32|NZ_CP039526|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

546. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

547. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

548. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

549. spacer 1.3|28130|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

550. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

551. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

552. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

553. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

554. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

555. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

556. spacer 1.5|28252|32|NZ_CP039526|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.969

gcaccctcacggataccttttgcacagtgtta	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtta	Protospacer
*********** ********************

557. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.969

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
ccgagattgattaaagcaaagtaacggcggtg	Protospacer
********** *********************

558. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

559. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

560. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

561. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

562. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

563. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
*********************************.

564. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
*********************************.

565. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
*********************************.

566. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
*********************************.

567. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
*********************************.

568. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

569. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

570. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

571. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

572. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

573. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

574. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

575. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

576. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

577. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

578. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

579. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

580. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

581. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

582. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

583. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

584. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

585. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

586. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

587. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

588. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

589. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

590. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

591. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

592. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

593. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

594. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

595. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

596. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

597. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

598. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

599. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

600. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

601. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

602. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

603. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

604. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

605. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

606. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

607. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

608. spacer 1.11|28113|34|NZ_CP039526|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtggtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
****************** ***************

609. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.938

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggg	Protospacer
****************  **************

610. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.938

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggg	Protospacer
****************  **************

611. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 2, identity: 0.938

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggg	Protospacer
****************  **************

612. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

613. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

614. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

615. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

616. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP011587 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

617. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

618. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

619. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

620. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

621. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

622. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

623. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

624. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

625. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

626. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

627. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

628. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

629. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

630. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP012569 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

631. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

632. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

633. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

634. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

635. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

636. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

637. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP012564 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

638. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

639. spacer 1.8|28435|32|NZ_CP039526|CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

640. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

641. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

642. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

643. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP032188 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

644. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

645. spacer 1.8|28435|32|NZ_CP039526|CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

646. spacer 1.8|28435|32|NZ_CP039526|CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

647. spacer 1.2|28069|32|NZ_CP039526|CRT matches to NZ_FO704549 (Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence) position: , mismatch: 5, identity: 0.844

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgttctctccaccgtcacccgctggctggcg	Protospacer
* ** ***** ******************* .

648. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

649. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

650. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

651. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

652. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP043767 (Enterobacter hormaechei strain EB_P9_L5_03.19 plasmid pIMPIncH12_331kb, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

653. spacer 1.1|28008|32|NZ_CP039526|CRT matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 6, identity: 0.812

agcaacgtttccggattatatggctggaacgt	CRISPR spacer
atcggcgtttccgggttatctggctggaacgg	Protospacer
* *..*********.**** *********** 

654. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
atgtcagaaacaaaaacgccaccgaggcaggt	Protospacer
 *   ****.******* ************* 

655. spacer 1.3|28130|32|NZ_CP039526|CRT matches to KC292028 (Halovirus HCTV-2, complete genome) position: , mismatch: 9, identity: 0.719

tggtgttgtccacggttacccgctggctggaa	CRISPR spacer
ttcaccagtccacggtttcccgctggatggac	Protospacer
*    . ********** ******** **** 

656. spacer 1.6|28313|32|NZ_CP039526|CRT matches to NZ_CP030844 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL3, complete sequence) position: , mismatch: 10, identity: 0.688

cttagagaagcaaaaaccccaccgaggcaggg	CRISPR spacer
aaagcaaaagcaaaaaacccacggaggcagca	Protospacer
   . *.********* ***** ******* .

657. spacer 1.9|28496|32|NZ_CP039526|CRT matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagattgagtaaagcaaagtaacggcggtg	CRISPR spacer
tcgagattgagcaaagaaaagtaaggataaac	Protospacer
.**********.**** ******* *....  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7833 : 20138 19 Salmonella_phage(30.77%) NA NA
DBSCAN-SWA_2 32621 : 71104 29 Shigella_phage(37.5%) transposase NA
DBSCAN-SWA_3 143798 : 203851 55 Caulobacter_phage(16.67%) integrase,protease,transposase attL 142235:142262|attR 176731:176758
DBSCAN-SWA_4 223162 : 320368 96 Escherichia_phage(32.26%) integrase,transposase attL 277664:277678|attR 301702:301716
DBSCAN-SWA_5 371797 : 381413 13 Shigella_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP039525
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19311 : 26370 7 Escherichia_phage(50.0%) integrase attL 16158:16170|attR 20211:20223
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage