Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050119 Deinococcus radiodurans strain BNK-50 plasmid pCP1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 1 crisprs NA 1 1 1 0
NZ_CP050117 Deinococcus radiodurans strain BNK-50 chromosome 2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP050116 Deinococcus radiodurans strain BNK-50 chromosome 1, complete sequence 1 crisprs cas3,c2c9_V-U4,DEDDh,csa3 0 0 1 0

Results visualization

1. NZ_CP050118
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050118_1 146621-146699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NZ_CP050116.1 529107-529137 1 0.968
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NZ_CP050116.1 776827-776857 2 0.935

1. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to position: 529107-529137, mismatch: 1, identity: 0.968

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagaagcaaaagagacgtgctgcgg	Protospacer
**********.********************

2. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to position: 776827-776857, mismatch: 2, identity: 0.935

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagcagcaaaagagacgtgctgcgg	Protospacer
********* .********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NC_000958 Deinococcus radiodurans R1 plasmid MP1, complete sequence 55186-55216 0 1.0
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 146645-146675 0 1.0
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NZ_CP050122 Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence 91142-91172 0 1.0
NZ_CP050118_1 1.1|146645|31|NZ_CP050118|CRISPRCasFinder 146645-146675 31 NZ_CP031502 Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence 101703-101733 0 1.0

1. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 0, identity: 1.0

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagaggcaaaagagacgtgctgcgg	Protospacer
*******************************

2. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 0, identity: 1.0

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagaggcaaaagagacgtgctgcgg	Protospacer
*******************************

3. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 0, identity: 1.0

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagaggcaaaagagacgtgctgcgg	Protospacer
*******************************

4. spacer 1.1|146645|31|NZ_CP050118|CRISPRCasFinder matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 0, identity: 1.0

cggagcgagaggcaaaagagacgtgctgcgg	CRISPR spacer
cggagcgagaggcaaaagagacgtgctgcgg	Protospacer
*******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1846 : 88812 61 Bacillus_phage(20.0%) integrase,transposase attL 45417:45442|attR 79701:79726
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP050116
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050116_1 509781-509870 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 852811 : 862012 9 Roseobacter_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage