Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 0 crisprs csa3,DEDDh 0 0 49 0
NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP050107 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence 0 crisprs DEDDh 0 0 0 0
NZ_CP050103 Rhizobium leguminosarum bv. trifolii strain 4B chromosome, complete genome 3 crisprs DEDDh,csa3,cas3,WYL 0 3 390 0
NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP050105
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3557 2 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_2 8027 : 10553 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_3 31966 : 40425 5 Indivirus(33.33%) NA NA
DBSCAN-SWA_4 58753 : 67646 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_5 91024 : 94490 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_6 113313 : 114315 1 Brevibacillus_phage(100.0%) integrase attL 111034:111058|attR 114405:114429
DBSCAN-SWA_7 117473 : 121033 3 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_8 140012 : 141743 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_9 147103 : 155821 4 IC4_retrovirus(50.0%) NA NA
DBSCAN-SWA_10 160931 : 164459 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_11 191308 : 201034 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_12 206034 : 206694 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_13 216139 : 216769 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_14 220046 : 221582 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_15 226101 : 227799 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 233525 : 235786 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_17 241792 : 245654 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_18 257977 : 258820 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_19 265069 : 266737 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_20 273582 : 275370 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_21 283465 : 288997 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_22 302026 : 302923 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_23 315939 : 321621 6 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_24 337200 : 343283 6 Diadromus_pulchellus_ascovirus(33.33%) NA NA
DBSCAN-SWA_25 348108 : 348750 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_26 355492 : 360109 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_27 366382 : 381257 14 Acanthocystis_turfacea_Chlorella_virus(16.67%) NA NA
DBSCAN-SWA_28 391360 : 392737 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_29 400633 : 401806 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_30 404975 : 410376 5 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_31 415078 : 429347 12 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_32 433778 : 439766 6 Bacillus_virus(25.0%) holin NA
DBSCAN-SWA_33 444474 : 447939 3 Amsacta_moorei_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_34 456508 : 457366 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_35 462219 : 463734 1 Catovirus(100.0%) holin NA
DBSCAN-SWA_36 468205 : 469905 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_37 495799 : 498429 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_38 509321 : 512967 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_39 530099 : 531728 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 542626 : 543802 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_41 557863 : 562127 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_42 573070 : 580466 8 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_43 590262 : 590472 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_44 599750 : 600635 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 604293 : 605202 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_46 614123 : 617760 2 Halovirus(50.0%) NA NA
DBSCAN-SWA_47 637519 : 638290 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_48 650706 : 654436 2 Yaba_monkey_tumor_virus(50.0%) protease NA
DBSCAN-SWA_49 670017 : 670422 1 Sinorhizobium_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP050103
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050103_1 1091057-1091143 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050103_2 2254073-2254152 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050103_3 2315460-2315542 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 206969-206993 3 0.88
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 MT708547 Klebsiella phage Muenster, complete genome 328861-328885 3 0.88
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 AB897757 Klebsiella phage K64-1 DNA, complete genome 205606-205630 3 0.88
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 NZ_CP045357 Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence 317877-317901 4 0.84
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 NZ_CP046164 Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence 262286-262310 4 0.84
NZ_CP050103_1 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder 1091088-1091112 25 NZ_CP046067 Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence 10785-10809 4 0.84
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1123372-1123406 4 0.886
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 124883-124917 4 0.886
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1148791-1148825 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 132186-132220 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 657329-657363 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 438047-438081 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 384831-384865 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 336378-336412 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 207471-207505 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 207471-207505 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 205912-205946 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 210159-210193 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 204277-204311 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 97135-97169 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 207471-207505 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 132366-132400 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 869536-869570 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 137731-137765 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 132366-132400 6 0.829
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 99451-99485 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 281489-281523 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 667850-667884 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 619424-619458 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 570407-570441 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 95674-95708 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 212757-212791 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 291127-291161 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 303891-303925 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 293884-293918 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 126588-126622 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 336441-336475 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 291068-291102 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 310524-310558 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 297314-297348 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 305488-305522 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 303891-303925 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 310524-310558 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 291068-291102 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 290616-290650 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 116756-116790 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 151266-151300 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 385516-385550 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 610453-610487 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 95577-95611 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 2094575-2094609 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 372850-372884 7 0.8
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1215016-1215050 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 457573-457607 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 114741-114775 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 96361-96395 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 450840-450874 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 423635-423669 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 630457-630491 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 102359-102393 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 126257-126291 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 102034-102068 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 224405-224439 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 383036-383070 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 102028-102062 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 147137-147171 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 519945-519979 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 168710-168744 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 606742-606776 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 9676-9710 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 167124-167158 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 556774-556808 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 168753-168787 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 615190-615224 8 0.771
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 87758-87792 8 0.771
NZ_CP050103_2 2.1|2254096|34|NZ_CP050103|CRISPRCasFinder 2254096-2254129 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 179879-179912 9 0.735
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 445062-445096 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 460591-460625 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 488680-488714 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 445038-445072 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 459459-459493 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 460591-460625 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 445038-445072 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 1129906-1129940 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 14452-14486 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 14452-14486 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 14452-14486 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 14452-14486 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 14452-14486 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 350817-350851 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 293094-293128 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 272059-272093 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 27876-27910 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 399668-399702 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 179923-179957 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 352540-352574 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 174680-174714 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 119253-119287 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1698044-1698078 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1528430-1528464 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 348772-348806 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 38279-38313 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 169629-169663 9 0.743
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 78852-78886 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 447873-447907 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 474981-475015 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 461780-461814 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 474981-475015 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 444552-444586 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 456535-456569 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 151271-151305 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 2176406-2176440 10 0.714
NZ_CP050103_3 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder 2315484-2315518 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 76585-76619 10 0.714

1. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 3, identity: 0.88

gtttcgctggaattgctcttgtttc	CRISPR spacer
gattcgctggaattgctattgtttt	Protospacer
* *************** ******.

2. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 3, identity: 0.88

gtttcgctggaattgctcttgtttc	CRISPR spacer
gattcgctggaattgctattgtttt	Protospacer
* *************** ******.

3. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 3, identity: 0.88

gtttcgctggaattgctcttgtttc	CRISPR spacer
gattcgctggaattgctattgtttt	Protospacer
* *************** ******.

4. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to NZ_CP045357 (Vibrio sp. THAF64 plasmid pTHAF64_b, complete sequence) position: , mismatch: 4, identity: 0.84

gtttcgctggaattgctcttgtttc	CRISPR spacer
acttcgttggaattgttcttgtttc	Protospacer
..****.********.*********

5. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to NZ_CP046164 (Vibrio sp. THAF191c plasmid pTHAF191c_c, complete sequence) position: , mismatch: 4, identity: 0.84

gtttcgctggaattgctcttgtttc	CRISPR spacer
acttcgttggaattgttcttgtttc	Protospacer
..****.********.*********

6. spacer 1.1|1091088|25|NZ_CP050103|CRISPRCasFinder matches to NZ_CP046067 (Vibrio sp. THAF191d plasmid pTHAF191d_c, complete sequence) position: , mismatch: 4, identity: 0.84

gtttcgctggaattgctcttgtttc	CRISPR spacer
acttcgttggaattgttcttgtttc	Protospacer
..****.********.*********

7. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 4, identity: 0.886

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttcgtgttatgcatgtcgttatcccggaaccgctg	Protospacer
 ** .**.***************************

8. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.886

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttcgtgttatgcatgtcgttatcccggaaccgctg	Protospacer
 ** .**.***************************

9. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttcatgcatgtcgttatcccggaaccgcgg	Protospacer
 * .. *************************** *

10. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttatcccggaaccgctg	Protospacer
 * .. * ***************************

11. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttatcccggaaccgctg	Protospacer
 * .. * ***************************

12. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
attgattcatgcatgtcgttatcccgaaaccgctt	Protospacer
**.   ********************.******* 

13. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
attgattcatgcatgtcgttatcccgaaaccgctt	Protospacer
**.   ********************.******* 

14. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
attgattcatgcatgtcgttatcccgaaaccgctt	Protospacer
**.   ********************.******* 

15. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

16. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

17. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

18. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

19. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

20. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

21. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtcgttaccccggaaccgctg	Protospacer
 * *. .**************.*************

22. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgctttatgcatgtcgttctcccggaaccgctg	Protospacer
 *. * *.************ **************

23. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtccttatgcatgtcgttgtcccggaaccgctg	Protospacer
 * .* *.************.**************

24. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgctttatgcatgtcgttctcccggaaccgctg	Protospacer
 *. * *.************ **************

25. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 6, identity: 0.829

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgctttatgcatgtcgttctcccggaaccgctg	Protospacer
 *. * *.************ **************

26. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttattccggaaccgctg	Protospacer
 * .. *.**************.************

27. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttgtcccggaaccgctg	Protospacer
 * .. * ************.**************

28. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
cttgttttatgcatgtcgttaacccggaaccgctg	Protospacer
 *. . *.************* *************

29. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ctttttttatgcatgtcgttaacccggaaccgctg	Protospacer
 *... *.************* *************

30. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
cttgttttatgcatgtcgttaacccggaaccgctg	Protospacer
 *. . *.************* *************

31. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.************.**************

32. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttatcccggaaccgcgg	Protospacer
 * .. *.************************* *

33. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

34. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

35. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

36. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.************.**************

37. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

38. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

39. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

40. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

41. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

42. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

43. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

44. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

45. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

46. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

47. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.************.**************

48. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgttttatgcatgtcgttatccgggaaccgctg	Protospacer
 *. . *.**************** **********

49. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttctcccggaaccgctg	Protospacer
 * .. *.************ **************

50. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgcttccatgcatgtccttaccccggaaccgctg	Protospacer
 * *. .********** ***.*************

51. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtc---atgcatgtcgttatcccggaaccgctg	CRISPR spacer
---ctgtttggatgcatgtcgttatcccaaaaccgctg	Protospacer
   *.**.   *****************..********

52. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.8

atcccgtc---atgcatgtcgttatcccggaaccgctg	CRISPR spacer
---ctgtctggatgcatgtcgttatccccaaaccgcgg	Protospacer
   *.***   ***************** .****** *

53. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttgtcccggaaccgcgg	Protospacer
 * .. * ************.************ *

54. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgccgttatcccggaacggctg	Protospacer
 * .. *.*******.************** ****

55. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttccatgcatgtcgttgtcccggaaccgcta	Protospacer
 * .. .*************.*************.

56. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

57. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

58. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

59. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

60. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

61. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

62. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcacgtcgttctcccggaaccgctg	Protospacer
 * .. *.*****.****** **************

63. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcacgtcgttctcccggaaccgctg	Protospacer
 * .. *.*****.****** **************

64. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgttttttgcatgtcgttctcccggaaccgctg	Protospacer
 *. . *. *********** **************

65. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

66. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgttttatgcatgtcgttctccgggaaccgctg	Protospacer
 *. . *.************ *** **********

67. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

68. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgccccggaaccgctg	Protospacer
 * .. *.************..*************

69. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgccccggaaccgctg	Protospacer
 * .. *.************..*************

70. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgtagtcccggaaccgctg	Protospacer
 * .. *.*********** .**************

71. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttggcccggaaccgctg	Protospacer
 * .. *.************. *************

72. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttgtccaggaaccgctg	Protospacer
 * .. * ************.*** **********

73. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttatgcatgtcgttgtcccggaaccactg	Protospacer
 * .. *.************.**********.***

74. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttcttatgtatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.***.********.**************

75. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttgtcccgcaaccgctg	Protospacer
 * .. * ************.***** ********

76. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ctttgtttatgcatgtcgttgtcccggaaccgccg	Protospacer
 *..  *.************.************.*

77. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttcttatgtatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.***.********.**************

78. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ctttgtttatgcatgtcgttgtcccggaaccgccg	Protospacer
 *..  *.************.************.*

79. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttcttatgtatgtcgttgtcccggaaccgctg	Protospacer
 * .. *.***.********.**************

80. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.771

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcatgtcgttgtcccgaaaccgctg	Protospacer
 * .. * ************.*****.********

81. spacer 2.1|2254096|34|NZ_CP050103|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.735

ccatgctttaatagtgggagcatgatgttgcccg	CRISPR spacer
tctaaattatatagttggagcatgatgttgtccg	Protospacer
.*  . **  ***** **************.***

82. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

83. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

84. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

85. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

86. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

87. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

88. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

89. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctg	Protospacer
 ....  .************.**************

90. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcttttttctgcatgtcgttgtcccggaaccgctg	Protospacer
 .... *. ***********.**************

91. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcttttttctgcatgtcgttgtcccggaaccgctg	Protospacer
 .... *. ***********.**************

92. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcttttttctgcatgtcgttgtcccggaaccgctg	Protospacer
 .... *. ***********.**************

93. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcttttttctgcatgtcgttgtcccggaaccgctg	Protospacer
 .... *. ***********.**************

94. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcttttttctgcatgtcgttgtcccggaaccgctg	Protospacer
 .... *. ***********.**************

95. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgatgcacgtcgttatcccggaaccgcgc	Protospacer
 * .. * *****.*******************  

96. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
acggtttgacgcatgtcgttatcccaaaaccgctg	Protospacer
*.  . * *.***************..********

97. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttatttgacgcatgtcgttatcccaaaaccgctg	Protospacer
 *. . * *.***************..********

98. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgtttgacgcatgtcgttatcccaaaaccgctg	Protospacer
 *. . * *.***************..********

99. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttatttttgtgcatgtcgttatccgagaaccgctg	Protospacer
 * .. *..*************** .*********

100. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttgtgcatgtcgttatcccaaaaccgctg	Protospacer
 * .. *..****************..********

101. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttttgttgcatgtcgtcatcccgaaaccgctg	Protospacer
 * .. *  **********.******.********

102. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgttcttatgcatgtcgctatcccgcaaccgcta	Protospacer
 * .. *.**********.******* *******.

103. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgttttatgcatgtcgttacccgggaaccgccg	Protospacer
 *. . *.*************.** ********.*

104. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttgtgcatgtcgttatcccaaaaccgctg	Protospacer
 * .. *..****************..********

105. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttgtgcatgtcgtcatcccagaaccgctg	Protospacer
 * .. *..**********.*****.*********

106. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttgtttttgtgcatgtcgttatcccaaaaccgctg	Protospacer
 * .. *..****************..********

107. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tttgtttgacgcatgtcgttatcccaaaaccgctg	Protospacer
 *. . * *.***************..********

108. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 9, identity: 0.743

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ctttgtttatgcatgtcgtagtcccggaaccgccg	Protospacer
 *..  *.*********** .************.*

109. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ttttttccgtgcatgtcgttgtcccagaaccgcta	Protospacer
 *... .*.***********.****.********.

110. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctt	Protospacer
 ....  .************.************* 

111. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctt	Protospacer
 ....  .************.************* 

112. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctt	Protospacer
 ....  .************.************* 

113. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctt	Protospacer
 ....  .************.************* 

114. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcgtgtcgttgtcccggaaccgctg	Protospacer
 ....  .****.*******.**************

115. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
ccttttgtatgcatgtcgttgtcccggaaccgctt	Protospacer
 ....  .************.************* 

116. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
gcttttgtttgcatgtcgttgtcccggaaccgctg	Protospacer
.....  . ***********.**************

117. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tcgtttttgtgcatgtcgttatcccaaaaccgctg	Protospacer
 . .. *..****************..********

118. spacer 3.1|2315484|35|NZ_CP050103|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.714

atcccgtcatgcatgtcgttatcccggaaccgctg	CRISPR spacer
tgtttttgttgcatgtcgtcatcccgaaaccgctg	Protospacer
  ... *  **********.******.********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2350 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_2 13196 : 16038 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_3 19743 : 20541 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 28332 : 29094 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_5 47237 : 48167 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_6 60465 : 64635 4 Sphingobium_phage(33.33%) NA NA
DBSCAN-SWA_7 68339 : 77226 9 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_8 80314 : 81586 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 85693 : 88849 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_10 114170 : 116816 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_11 120568 : 121744 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_12 128995 : 130081 1 Escherichia_virus(100.0%) NA NA
DBSCAN-SWA_13 134568 : 139152 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_14 145799 : 155475 8 Caulobacter_phage(20.0%) protease NA
DBSCAN-SWA_15 163141 : 164932 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_16 179468 : 180596 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_17 190373 : 197008 5 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_18 210916 : 211966 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_19 218451 : 219873 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_20 235267 : 237241 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_21 258433 : 260224 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_22 264863 : 267229 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_23 279428 : 280574 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_24 288864 : 289920 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_25 295680 : 297336 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_26 324939 : 325608 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_27 339752 : 341554 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_28 346313 : 348107 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_29 361058 : 361763 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_30 376033 : 381220 3 uncultured_Caudovirales_phage(33.33%) tRNA NA
DBSCAN-SWA_31 396031 : 397912 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 409439 : 410093 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_33 414349 : 415369 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_34 421218 : 428867 11 Salmonella_phage(25.0%) protease,terminase,tRNA NA
DBSCAN-SWA_35 441995 : 442763 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_36 451076 : 452543 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_37 470414 : 474184 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_38 482486 : 483239 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_39 502240 : 504338 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_40 511356 : 511908 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_41 516239 : 516662 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_42 520956 : 524444 3 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_43 542030 : 543119 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_44 570167 : 571598 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_45 577949 : 580466 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_46 585294 : 586380 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_47 594287 : 596820 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_48 601959 : 603495 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_49 614272 : 615630 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_50 629868 : 630591 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_51 635847 : 637170 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_52 647438 : 652788 5 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_53 659347 : 660100 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_54 668533 : 669601 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 684624 : 686463 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_56 690449 : 696956 5 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_57 705821 : 711118 4 Vibrio_virus(33.33%) NA NA
DBSCAN-SWA_58 716747 : 717557 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_59 721148 : 725411 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_60 738888 : 739392 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_61 746588 : 755544 5 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_62 769092 : 769962 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_63 773214 : 774495 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_64 779134 : 781366 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_65 784947 : 786569 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_66 790881 : 792721 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_67 796990 : 800441 3 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_68 805971 : 807228 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_69 811213 : 812380 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_70 816302 : 818423 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_71 821800 : 828088 4 Geobacillus_phage(50.0%) NA NA
DBSCAN-SWA_72 831973 : 832351 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_73 839164 : 840292 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_74 852128 : 853325 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_75 856596 : 859928 3 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_76 866236 : 866851 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_77 871518 : 873504 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_78 881025 : 887669 6 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_79 893192 : 899984 7 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_80 910382 : 922396 13 Streptococcus_phage(40.0%) tRNA NA
DBSCAN-SWA_81 925400 : 926222 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_82 940106 : 949745 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_83 963020 : 964268 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_84 974132 : 987975 13 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_85 1006374 : 1008201 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_86 1012613 : 1014137 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_87 1018593 : 1020162 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1025592 : 1026309 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_89 1037238 : 1037946 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 1047753 : 1048833 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_91 1056068 : 1057654 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_92 1065818 : 1066892 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_93 1078144 : 1078411 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_94 1087829 : 1088453 1 Bartonella_henselae_phage(100.0%) NA NA
DBSCAN-SWA_95 1111236 : 1115267 4 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_96 1126560 : 1130739 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_97 1143747 : 1144491 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_98 1149709 : 1155211 5 Only_Syngen_Nebraska_virus(33.33%) protease NA
DBSCAN-SWA_99 1161397 : 1165693 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_100 1185691 : 1194398 6 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_101 1220222 : 1221629 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_102 1233791 : 1247179 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_103 1253927 : 1254260 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_104 1258490 : 1261334 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_105 1268239 : 1271270 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_106 1278039 : 1279098 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_107 1282983 : 1283949 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_108 1304061 : 1309045 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_109 1327228 : 1328500 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_110 1336160 : 1339976 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_111 1363851 : 1368190 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_112 1382258 : 1383794 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_113 1388754 : 1389702 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_114 1393000 : 1395717 2 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_115 1415935 : 1436325 15 Catovirus(28.57%) NA NA
DBSCAN-SWA_116 1441916 : 1447225 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_117 1452975 : 1453932 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_118 1457523 : 1462552 2 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_119 1465570 : 1467334 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_120 1472072 : 1477334 3 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_121 1505809 : 1520423 9 Bacillus_virus(28.57%) protease NA
DBSCAN-SWA_122 1525128 : 1528140 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_123 1534127 : 1535315 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_124 1578040 : 1584022 8 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_125 1592045 : 1594301 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_126 1611323 : 1613065 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_127 1628656 : 1629079 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_128 1634316 : 1636200 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_129 1640033 : 1640816 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_130 1647735 : 1649226 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_131 1657886 : 1658549 1 Cowpox_virus(100.0%) NA NA
DBSCAN-SWA_132 1662212 : 1662449 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1668915 : 1670412 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1676759 : 1681652 4 Mollivirus(50.0%) tRNA NA
DBSCAN-SWA_135 1690074 : 1691952 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_136 1695193 : 1695514 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_137 1698699 : 1705100 7 Silicibacter_phage(25.0%) NA NA
DBSCAN-SWA_138 1713894 : 1718171 4 Aggregatibacter_phage(50.0%) NA NA
DBSCAN-SWA_139 1730228 : 1732079 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_140 1741290 : 1742406 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_141 1751083 : 1752100 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_142 1795389 : 1796496 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_143 1799525 : 1801835 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_144 1807620 : 1809216 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_145 1819995 : 1820682 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_146 1833691 : 1835692 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_147 1857668 : 1861774 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_148 1884399 : 1885902 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_149 1889057 : 1889987 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_150 1897299 : 1897902 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_151 1903723 : 1904557 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_152 1931552 : 1933934 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_153 1937044 : 1946654 8 Cyanophage(25.0%) NA NA
DBSCAN-SWA_154 1951361 : 1952427 3 Pelagibacter_phage(50.0%) NA NA
DBSCAN-SWA_155 1960697 : 1962995 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_156 1981527 : 1983180 1 Klosneuvirus(100.0%) holin NA
DBSCAN-SWA_157 1987681 : 1989178 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_158 2011434 : 2012940 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_159 2038292 : 2038742 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_160 2041979 : 2042699 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_161 2051005 : 2051818 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_162 2082291 : 2083624 3 Agrobacterium_phage(50.0%) protease NA
DBSCAN-SWA_163 2090574 : 2094274 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_164 2100777 : 2104476 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_165 2109105 : 2109753 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_166 2139516 : 2142225 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_167 2150949 : 2156737 7 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_168 2162205 : 2167057 3 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_169 2176687 : 2177113 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_170 2183210 : 2183951 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_171 2206955 : 2207441 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_172 2212746 : 2213202 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_173 2219968 : 2221675 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_174 2230409 : 2247378 16 Yellowstone_lake_phycodnavirus(14.29%) tRNA NA
DBSCAN-SWA_175 2250854 : 2252900 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_176 2256292 : 2261574 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_177 2269424 : 2271356 2 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_178 2279870 : 2281130 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_179 2286531 : 2288355 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_180 2296554 : 2297415 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_181 2304603 : 2307882 4 Silicibacter_phage(50.0%) NA NA
DBSCAN-SWA_182 2310884 : 2314147 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_183 2324839 : 2330874 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_184 2336541 : 2336790 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_185 2347090 : 2355342 7 uncultured_virus(50.0%) tRNA NA
DBSCAN-SWA_186 2359876 : 2363260 4 Orpheovirus(50.0%) tRNA NA
DBSCAN-SWA_187 2376913 : 2381443 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_188 2387897 : 2391713 4 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_189 2411148 : 2418945 6 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_190 2425839 : 2431481 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_191 2437101 : 2439068 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_192 2459706 : 2462319 4 Rhizobium_phage(33.33%) NA NA
DBSCAN-SWA_193 2467718 : 2471513 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_194 2477686 : 2478829 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_195 2486712 : 2489244 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_196 2494158 : 2495634 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_197 2498891 : 2499980 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_198 2505836 : 2507779 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_199 2550604 : 2551351 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_200 2554659 : 2555049 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_201 2559775 : 2562126 3 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_202 2567061 : 2569608 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_203 2572715 : 2576866 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_204 2585970 : 2589554 2 Rhizobium_phage(50.0%) NA NA
DBSCAN-SWA_205 2599916 : 2601804 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_206 2605821 : 2606595 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_207 2615619 : 2616681 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 2621647 : 2623363 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_209 2634481 : 2646471 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_210 2650269 : 2650479 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_211 2679636 : 2684884 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_212 2690396 : 2702041 10 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_213 2710750 : 2713018 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_214 2719903 : 2721901 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_215 2729045 : 2730599 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2738139 : 2739084 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_217 2743505 : 2745206 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_218 2748208 : 2748898 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_219 2752519 : 2756446 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_220 2764594 : 2766142 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_221 2789373 : 2791371 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_222 2795214 : 2795424 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_223 2802540 : 2806353 4 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_224 2811807 : 2818912 5 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_225 2823174 : 2826813 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_226 2831698 : 2833981 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_227 2838116 : 2840843 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_228 2848817 : 2849384 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_229 2853516 : 2854569 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_230 2858063 : 2862939 7 Sinorhizobium_phage(33.33%) tRNA NA
DBSCAN-SWA_231 2867306 : 2867951 1 Ugandan_cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_232 2874124 : 2877593 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_233 2889017 : 2892050 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_234 2900406 : 2902552 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_235 2906142 : 2907105 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 2911973 : 2919321 8 Amsacta_moorei_entomopoxvirus(25.0%) NA NA
DBSCAN-SWA_237 2930586 : 2930949 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_238 2942676 : 2943411 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_239 2953609 : 2954173 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_240 2959917 : 2961498 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_241 2974740 : 2979265 6 Orpheovirus(33.33%) tRNA NA
DBSCAN-SWA_242 2982938 : 2988581 6 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_243 2997536 : 2999648 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_244 3004592 : 3005513 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_245 3012035 : 3013427 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_246 3030055 : 3037048 7 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_247 3041428 : 3045961 4 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_248 3053177 : 3054965 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_249 3060527 : 3063711 4 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_250 3070317 : 3075834 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_251 3085691 : 3093864 8 Chrysochromulina_ericina_virus(20.0%) NA NA
DBSCAN-SWA_252 3100423 : 3104599 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_253 3112931 : 3115685 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_254 3137368 : 3138178 1 Microcystis_virus(100.0%) NA NA
DBSCAN-SWA_255 3143379 : 3144834 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_256 3148350 : 3149427 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_257 3159337 : 3160348 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_258 3166283 : 3170156 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_259 3175656 : 3177957 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_260 3181975 : 3183970 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_261 3192368 : 3195778 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_262 3201491 : 3205396 3 Mycobacterium_phage(50.0%) protease NA
DBSCAN-SWA_263 3210838 : 3215791 5 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_264 3219153 : 3223343 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_265 3228789 : 3232737 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_266 3244288 : 3246724 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_267 3250904 : 3251627 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_268 3262022 : 3274944 10 Staphylococcus_phage(60.0%) tRNA NA
DBSCAN-SWA_269 3279812 : 3281429 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_270 3296391 : 3297084 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_271 3309783 : 3317474 6 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_272 3320684 : 3326976 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_273 3335752 : 3336736 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_274 3340157 : 3341699 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_275 3347782 : 3349362 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_276 3361510 : 3363274 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_277 3368844 : 3369606 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_278 3387304 : 3393721 5 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_279 3398749 : 3400567 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_280 3406620 : 3407652 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_281 3411122 : 3411923 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_282 3438493 : 3444171 4 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_283 3455819 : 3456650 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_284 3462538 : 3465453 3 Trichoplusia_ni_ascovirus(50.0%) tRNA NA
DBSCAN-SWA_285 3469415 : 3478469 8 Ostreococcus_tauri_virus(25.0%) NA NA
DBSCAN-SWA_286 3488150 : 3493049 4 Rhizobium_phage(50.0%) tRNA NA
DBSCAN-SWA_287 3496677 : 3497325 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_288 3502089 : 3502647 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_289 3506309 : 3507017 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_290 3518666 : 3519878 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_291 3523252 : 3528798 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_292 3536715 : 3537813 1 Moraxella_phage(100.0%) tRNA NA
DBSCAN-SWA_293 3544559 : 3545288 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_294 3554038 : 3557495 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_295 3575293 : 3576358 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_296 3582429 : 3583257 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_297 3596421 : 3597828 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_298 3601135 : 3602071 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_299 3616152 : 3617043 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_300 3642907 : 3647927 4 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_301 3665375 : 3666461 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_302 3681292 : 3682246 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_303 3686089 : 3689924 3 Cafeteria_roenbergensis_virus(33.33%) NA NA
DBSCAN-SWA_304 3694698 : 3698059 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_305 3704039 : 3704699 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_306 3709845 : 3711114 1 Bovine_gammaherpesvirus(100.0%) NA NA
DBSCAN-SWA_307 3721770 : 3722328 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_308 3731112 : 3734197 2 Salmonella_virus(50.0%) integrase attL 3731497:3731511|attR 3739880:3739894
DBSCAN-SWA_309 3741588 : 3742173 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_310 3751024 : 3752653 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_311 3764658 : 3764916 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_312 3768800 : 3771068 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_313 3774416 : 3779056 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_314 3787443 : 3788010 1 uncultured_marine_phage(100.0%) NA NA
DBSCAN-SWA_315 3817068 : 3825172 4 Leptospira_phage(66.67%) NA NA
DBSCAN-SWA_316 3835355 : 3845283 9 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_317 3850103 : 3853571 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_318 3859210 : 3860293 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_319 3865650 : 3873038 7 Lake_Baikal_phage(25.0%) NA NA
DBSCAN-SWA_320 3881794 : 3883705 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_321 3890064 : 3892629 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_322 3899639 : 3902944 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_323 3915493 : 3916480 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_324 3919996 : 3923977 3 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_325 3934471 : 3935998 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_326 3941559 : 3945260 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_327 3954405 : 3958802 4 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_328 3981355 : 3985795 3 Pelagibacter_phage(33.33%) NA NA
DBSCAN-SWA_329 4002208 : 4004671 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_330 4024284 : 4025376 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_331 4034884 : 4035355 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_332 4049295 : 4063285 14 Pandoravirus(40.0%) NA NA
DBSCAN-SWA_333 4069275 : 4069539 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_334 4087172 : 4087667 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_335 4095401 : 4107562 10 uncultured_Caudovirales_phage(60.0%) NA NA
DBSCAN-SWA_336 4115057 : 4116860 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_337 4121520 : 4122546 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_338 4136346 : 4137378 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_339 4146422 : 4147463 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_340 4158982 : 4159819 1 Plodia_interpunctella_granulovirus(100.0%) NA NA
DBSCAN-SWA_341 4169429 : 4172955 2 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_342 4176086 : 4180420 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_343 4184664 : 4185429 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_344 4217806 : 4218751 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_345 4231119 : 4231860 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_346 4239710 : 4240466 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_347 4243756 : 4244866 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_348 4263051 : 4264978 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_349 4275141 : 4276251 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_350 4281161 : 4285118 2 Caulobacter_virus(50.0%) NA NA
DBSCAN-SWA_351 4297378 : 4300579 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_352 4307776 : 4312675 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_353 4318666 : 4319368 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_354 4328080 : 4336739 7 Brazilian_cedratvirus(20.0%) NA NA
DBSCAN-SWA_355 4343221 : 4344743 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_356 4362693 : 4363470 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_357 4368290 : 4370858 1 Feldmannia_species_virus(100.0%) NA NA
DBSCAN-SWA_358 4380784 : 4381342 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_359 4398814 : 4400560 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_360 4405920 : 4418459 12 Catovirus(16.67%) NA NA
DBSCAN-SWA_361 4429162 : 4430929 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_362 4435255 : 4436140 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_363 4447588 : 4448014 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_364 4454133 : 4457009 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_365 4462333 : 4463290 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_366 4472787 : 4478901 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_367 4485039 : 4485822 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_368 4494829 : 4496368 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_369 4506758 : 4508492 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_370 4514550 : 4517910 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_371 4539340 : 4544055 3 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_372 4558934 : 4566745 8 Moumouvirus(25.0%) NA NA
DBSCAN-SWA_373 4579553 : 4583317 4 Bacillus_virus(50.0%) holin NA
DBSCAN-SWA_374 4604528 : 4606713 3 Pneumococcus_phage(50.0%) protease NA
DBSCAN-SWA_375 4626119 : 4627373 1 Caulobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_376 4632111 : 4636387 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_377 4640446 : 4640989 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_378 4647071 : 4653322 4 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_379 4659725 : 4664946 7 Streptococcus_phage(66.67%) tRNA NA
DBSCAN-SWA_380 4668464 : 4668680 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_381 4672653 : 4675041 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_382 4688028 : 4689003 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_383 4697634 : 4699089 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_384 4707646 : 4708567 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_385 4714066 : 4727871 10 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_386 4730883 : 4731681 1 Infectious_laryngotracheitis_virus(100.0%) NA NA
DBSCAN-SWA_387 4748760 : 4749975 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_388 4757958 : 4763917 7 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_389 4771748 : 4775522 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_390 4782171 : 4784811 3 Cedratvirus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP050106
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 93824 : 102933 9 Planktothrix_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage