Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049156 Caballeronia sp. SBC1 chromosome, complete genome 1 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 0 0 4 0
NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 1 crisprs RT 0 3 4 0
NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 0 crisprs csa3,WYL,RT 0 0 2 0
NZ_CP049160 Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence 0 crisprs c2c4_V-U1 0 0 2 0
NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 0 crisprs csa3,RT 0 0 157 0

Results visualization

1. NZ_CP049156
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049156_1 3690053-3690165 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 274290 : 326815 28 Staphylococcus_prophage(14.29%) transposase NA
DBSCAN-SWA_2 582791 : 598681 11 Hokovirus(12.5%) NA NA
DBSCAN-SWA_3 823711 : 834653 10 Streptococcus_phage(14.29%) protease NA
DBSCAN-SWA_4 2928601 : 2984317 46 Enterobacteria_phage(15.38%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP049160
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80772 : 102399 15 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_2 107211 : 177711 57 Acidithiobacillus_phage(18.18%) bacteriocin,integrase,transposase attL 128736:128751|attR 178426:178441
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP049158
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47299 : 87847 34 Tupanvirus(50.0%) holin NA
DBSCAN-SWA_2 108032 : 170322 54 Leptospira_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP049159
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049159_1 497555-497814 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049159_1 1.1|497576|43|NZ_CP049159|PILER-CR 497576-497618 43 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 497576-497618 0 1.0
NZ_CP049159_1 1.1|497576|43|NZ_CP049159|PILER-CR 497576-497618 43 NZ_CP049320 Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence 49729-49771 0 1.0
NZ_CP049159_1 1.3|497735|59|NZ_CP049159|PILER-CR 497735-497793 59 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 497735-497793 0 1.0
NZ_CP049159_1 1.3|497735|59|NZ_CP049159|PILER-CR 497735-497793 59 NZ_CP049320 Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence 49888-49946 0 1.0
NZ_CP049159_1 1.2|497640|74|NZ_CP049159|PILER-CR 497640-497713 74 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 497640-497713 14 0.811
NZ_CP049159_1 1.2|497640|74|NZ_CP049159|PILER-CR 497640-497713 74 NZ_CP049320 Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence 49793-49866 14 0.811

1. spacer 1.1|497576|43|NZ_CP049159|PILER-CR matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgatgggaaaagagaccggtacggaggatggcgagcaaaatt	CRISPR spacer
gtgatgggaaaagagaccggtacggaggatggcgagcaaaatt	Protospacer
*******************************************

2. spacer 1.1|497576|43|NZ_CP049159|PILER-CR matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgatgggaaaagagaccggtacggaggatggcgagcaaaatt	CRISPR spacer
gtgatgggaaaagagaccggtacggaggatggcgagcaaaatt	Protospacer
*******************************************

3. spacer 1.3|497735|59|NZ_CP049159|PILER-CR matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 0, identity: 1.0

gatttacgctttggcctttttgcggagatttttcgcgcttgttccggaaatccgggtac	CRISPR spacer
gatttacgctttggcctttttgcggagatttttcgcgcttgttccggaaatccgggtac	Protospacer
***********************************************************

4. spacer 1.3|497735|59|NZ_CP049159|PILER-CR matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

gatttacgctttggcctttttgcggagatttttcgcgcttgttccggaaatccgggtac	CRISPR spacer
gatttacgctttggcctttttgcggagatttttcgcgcttgttccggaaatccgggtac	Protospacer
***********************************************************

5. spacer 1.2|497640|74|NZ_CP049159|PILER-CR matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 14, identity: 0.811

ttgcatcaccgctggtccgtgctcgcgggtttttccactaaaaatatattagggaacgtc	CRISPR spacer
ttgcatcaccgctggtccgtgctcgcgggtttttccactaaaaatatattagggaacgtc	Protospacer
************************************************************

6. spacer 1.2|497640|74|NZ_CP049159|PILER-CR matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 14, identity: 0.811

ttgcatcaccgctggtccgtgctcgcgggtttttccactaaaaatatattagggaacgtc	CRISPR spacer
ttgcatcaccgctggtccgtgctcgcgggtttttccactaaaaatatattagggaacgtc	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9631 : 75163 52 Lactococcus_phage(22.22%) transposase NA
DBSCAN-SWA_2 79853 : 144055 51 Wolbachia_phage(44.44%) integrase,transposase attL 130707:130723|attR 146079:146095
DBSCAN-SWA_3 155661 : 225720 53 Acidithiobacillus_phage(25.0%) transposase NA
DBSCAN-SWA_4 693659 : 730634 29 Pseudomonas_phage(50.0%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP049157
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8401 6 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 12540 : 23342 9 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_3 27274 : 28957 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_4 34304 : 36455 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_5 39640 : 40222 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_6 45400 : 46024 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_7 50783 : 54515 2 Feldmannia_species_virus(100.0%) NA NA
DBSCAN-SWA_8 77298 : 80087 2 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_9 86358 : 90810 5 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_10 104289 : 106653 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_11 111772 : 115120 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_12 126027 : 138705 8 Bacillus_phage(16.67%) protease,transposase NA
DBSCAN-SWA_13 159482 : 160667 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 168520 : 169465 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_15 175137 : 176988 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_16 198350 : 201037 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_17 216403 : 217561 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_18 223696 : 225598 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_19 233001 : 234615 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 241791 : 245664 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_21 250774 : 251911 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_22 256697 : 258317 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_23 261952 : 264680 3 Mollivirus(100.0%) NA NA
DBSCAN-SWA_24 268813 : 270756 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_25 291600 : 299175 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_26 303859 : 306871 3 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_27 325664 : 326438 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_28 336265 : 341171 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_29 344246 : 347851 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_30 368557 : 369358 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_31 377737 : 379576 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 403842 : 407240 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_33 411947 : 412736 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_34 422885 : 423680 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_35 428227 : 428854 1 Bacillus_phage(100.0%) integrase attL 425843:425855|attR 432036:432048
DBSCAN-SWA_36 439830 : 448232 7 Pandoravirus(66.67%) NA NA
DBSCAN-SWA_37 451774 : 452557 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_38 457013 : 460472 3 Oenococcus_phage(50.0%) NA NA
DBSCAN-SWA_39 465182 : 476780 11 Bacillus_virus(40.0%) NA NA
DBSCAN-SWA_40 497703 : 500486 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_41 509175 : 510819 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 528491 : 529667 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_43 538493 : 541145 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_44 544542 : 546811 3 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_45 561928 : 562441 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_46 570821 : 572674 2 Molluscum_contagiosum_virus(50.0%) transposase NA
DBSCAN-SWA_47 577211 : 580514 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_48 586424 : 588481 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_49 602060 : 603386 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_50 608541 : 615212 4 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_51 624996 : 625791 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_52 639536 : 642070 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_53 651923 : 652910 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_54 661844 : 663695 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_55 670308 : 671583 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_56 689817 : 691134 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_57 694480 : 695383 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_58 705428 : 715018 11 Burkholderia_phage(28.57%) NA NA
DBSCAN-SWA_59 732511 : 735560 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_60 748737 : 749364 1 Streptococcus_phage(100.0%) integrase attL 742034:742046|attR 753791:753803
DBSCAN-SWA_61 753569 : 754340 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_62 766249 : 768728 2 Burkholderia_virus(50.0%) transposase NA
DBSCAN-SWA_63 778872 : 781129 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_64 792077 : 793496 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_65 800068 : 801583 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_66 807762 : 809271 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_67 814988 : 818048 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_68 826565 : 830530 2 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_69 851827 : 857668 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_70 864582 : 865575 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_71 877188 : 878562 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_72 883640 : 884039 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_73 890648 : 892043 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_74 897748 : 898840 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_75 911759 : 912839 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 920222 : 921047 1 Bacillus_virus(100.0%) holin NA
DBSCAN-SWA_77 927670 : 930156 2 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_78 937482 : 939402 1 Acanthocystis_turfacea_chlorella_virus(100.0%) NA NA
DBSCAN-SWA_79 942883 : 943735 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_80 951493 : 956504 3 Acanthocystis_turfacea_chlorella_virus(50.0%) NA NA
DBSCAN-SWA_81 959843 : 960941 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_82 970274 : 973757 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_83 994444 : 995719 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_84 1002607 : 1004134 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_85 1028819 : 1034043 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_86 1049750 : 1050947 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_87 1058288 : 1064737 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_88 1071798 : 1073893 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_89 1080898 : 1091480 9 Hokovirus(33.33%) NA NA
DBSCAN-SWA_90 1098086 : 1102521 3 Siphoviridae_environmental_samples(50.0%) NA NA
DBSCAN-SWA_91 1111575 : 1113105 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_92 1135920 : 1136991 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_93 1142492 : 1145549 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_94 1151148 : 1151916 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_95 1166356 : 1167379 1 Staphylococcus_prophage(100.0%) transposase NA
DBSCAN-SWA_96 1179733 : 1185908 5 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_97 1191198 : 1192797 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_98 1197141 : 1204353 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_99 1227166 : 1233463 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_100 1236507 : 1241150 2 Hokovirus(100.0%) NA NA
DBSCAN-SWA_101 1247063 : 1251232 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_102 1259439 : 1261164 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_103 1268979 : 1276547 6 uncultured_Caudovirales_phage(25.0%) integrase attL 1264073:1264088|attR 1286576:1286591
DBSCAN-SWA_104 1282784 : 1285946 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_105 1295640 : 1297727 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_106 1306740 : 1308306 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_107 1314570 : 1317687 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_108 1321353 : 1322247 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1329630 : 1330866 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_110 1341909 : 1343511 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_111 1351534 : 1353088 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_112 1362643 : 1363384 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_113 1367116 : 1367845 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_114 1373414 : 1373876 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_115 1401246 : 1401954 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_116 1411620 : 1413595 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_117 1424205 : 1424838 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_118 1439512 : 1446374 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_119 1453822 : 1457062 1 Feldmannia_species_virus(100.0%) NA NA
DBSCAN-SWA_120 1477512 : 1478310 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_121 1481729 : 1482530 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_122 1492355 : 1494412 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_123 1499360 : 1506898 6 Tetraselmis_virus(33.33%) NA NA
DBSCAN-SWA_124 1518538 : 1519048 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_125 1524786 : 1526300 2 Pithovirus(50.0%) NA NA
DBSCAN-SWA_126 1529867 : 1539297 7 Wolbachia_phage(33.33%) transposase NA
DBSCAN-SWA_127 1544059 : 1546921 3 Lake_Baikal_phage(50.0%) transposase NA
DBSCAN-SWA_128 1560728 : 1561004 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_129 1566169 : 1567111 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1589543 : 1591061 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1599163 : 1600096 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_132 1609543 : 1611517 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1617160 : 1618000 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_134 1621941 : 1622634 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1635826 : 1640185 4 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_136 1648211 : 1651201 2 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_137 1659813 : 1671406 10 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_138 1678712 : 1679189 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_139 1682387 : 1687770 5 Mollivirus(33.33%) NA NA
DBSCAN-SWA_140 1701163 : 1703209 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_141 1722247 : 1725445 3 Sinorhizobium_phage(50.0%) NA NA
DBSCAN-SWA_142 1729090 : 1730740 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_143 1742041 : 1753648 12 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_144 1762689 : 1763910 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_145 1771164 : 1777218 3 Burkholderia_virus(66.67%) NA NA
DBSCAN-SWA_146 1792377 : 1794039 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_147 1810236 : 1815752 4 Tupanvirus(33.33%) transposase NA
DBSCAN-SWA_148 1842986 : 1846617 3 Streptococcus_phage(33.33%) integrase attL 1842859:1842893|attR 1846724:1846758
DBSCAN-SWA_149 1862149 : 1867021 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_150 1878804 : 1886299 9 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_151 1917995 : 1922776 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_152 1931278 : 1932004 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_153 1939698 : 1941753 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_154 1949217 : 1951131 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_155 1955717 : 1959926 2 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_156 1983234 : 1984290 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_157 1993763 : 1994438 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage