Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP021848 Staphylococcus lugdunensis strain JICS135 6 crisprs WYL,csa3,DEDDh,cas3,DinG 3 2 10 0

Results visualization

1. NZ_AP021848
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_1 119251-120320 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_2 312387-312477 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_3 1124164-1124253 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_4 1367793-1367883 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_5 1799547-1799633 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021848_6 2318500-2318580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP021848_1 1.5|119505|46|NZ_AP021848|CRT 119505-119550 46 NZ_AP021848.1 119241-119286 2 0.957
NZ_AP021848_5 5.1|1799577|27|NZ_AP021848|CRISPRCasFinder 1799577-1799603 27 NZ_AP021848.1 2361000-2361026 2 0.926
NZ_AP021848_1 1.11|119943|70|NZ_AP021848|CRT 119943-120012 70 NZ_AP021848.1 119235-119304 12 0.829

1. spacer 1.5|119505|46|NZ_AP021848|CRT matches to position: 119241-119286, mismatch: 2, identity: 0.957

cgcagatagcgactctgatgcggacagcgactcagacgcagatagc	CRISPR spacer
cgcagatagcgattctgatgcagacagcgactcagacgcagatagc	Protospacer
************.********.************************

2. spacer 5.1|1799577|27|NZ_AP021848|CRISPRCasFinder matches to position: 2361000-2361026, mismatch: 2, identity: 0.926

gggccccaacaaagagaatttcgaaat	CRISPR spacer
gggccccaacaaagagaaatgcgaaat	Protospacer
****************** * ******

3. spacer 1.11|119943|70|NZ_AP021848|CRT matches to position: 119235-119304, mismatch: 12, identity: 0.829

ttcagacgcagatagcgactctgatgcggacagcgactcagacgcagatagcgactctga	CRISPR spacer
ttcagacgcagatagcgattctgatgcagacagcgactcagacgcagatagcgactctga	Protospacer
******************.********.********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16463-16490 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16817-16844 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17141-17168 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17279-17306 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17651-17678 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18413-18440 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19133-19160 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19811-19838 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19859-19886 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16643-16670 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16853-16880 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16955-16982 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17813-17840 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17855-17882 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18311-18338 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18899-18926 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18923-18950 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19055-19082 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19295-19322 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19337-19364 2 0.929
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18107-18134 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19589-19616 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16103-16130 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16235-16262 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16367-16394 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16775-16802 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16877-16904 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17045-17072 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17393-17420 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17447-17474 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17609-17636 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17771-17798 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17879-17906 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17951-17978 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18155-18182 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18359-18386 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18611-18638 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18647-18674 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18707-18734 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18761-18788 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18857-18884 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19079-19106 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19253-19280 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19361-19388 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19433-19460 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19985-20012 3 0.893
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16565-16592 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17243-17270 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18047-18074 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18989-19016 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19529-19556 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20099-20126 4 0.857
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16175-16202 6 0.786
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16307-16334 6 0.786
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3214-3241 6 0.786
NZ_AP021848_1 1.4|119457|28|NZ_AP021848|CRT 119457-119484 28 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 1047343-1047370 7 0.75
NZ_AP021848_1 1.6|119571|34|NZ_AP021848|CRT 119571-119604 34 MH791401 UNVERIFIED: Aeromonas phage AsFcp_2, complete genome 156769-156802 7 0.794

1. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ttcagattcagacagcgatagcgactct	Protospacer
.***********************.***

2. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

3. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ttcagattcagacagcgatagcgactct	Protospacer
.***********************.***

4. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

5. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

6. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

7. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

8. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

9. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgattca	Protospacer
*** *********************** 

10. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

11. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

12. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

13. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

14. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctcagactcagacagcgatagcgactct	Protospacer
******.*****************.***

15. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

16. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

17. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

18. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

19. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactct	Protospacer
*** ********************.***

20. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctcagactcagacagcgatagcgactct	Protospacer
******.*****************.***

21. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ttcagactcagacagcgatagcgattca	Protospacer
.*****.******************** 

22. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ttcagactcagacagcgatagcgattca	Protospacer
.*****.******************** 

23. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

24. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

25. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

26. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattctgacagcgatagcgattca	Protospacer
*** ***** ***************** 

27. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

28. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

29. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

30. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgacagcgattca	Protospacer
*** **************.******** 

31. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattctgacagcgatagcgattca	Protospacer
*** ***** ***************** 

32. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattctgacagcgatagcgattca	Protospacer
*** ***** ***************** 

33. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

34. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

35. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctcagactcagatagcgatagcgattca	Protospacer
******.*****.************** 

36. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

37. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgacagcgattca	Protospacer
*** **************.******** 

38. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctcagactcagacagcgacagcgattca	Protospacer
******.***********.******** 

39. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

40. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgacagcgattca	Protospacer
*** **************.******** 

41. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattctgacagcgatagcgattca	Protospacer
*** ***** ***************** 

42. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

43. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattctgacagcgatagcgattca	Protospacer
*** ***** ***************** 

44. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

45. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgactcagacagcgatagcgattca	Protospacer
*** **.******************** 

46. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

ctcagattcagacagcgatagcgattct	CRISPR spacer
ctctgattcagacagcgatagcgactca	Protospacer
*** ********************.** 

47. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagacagcgatagcgattca	Protospacer
*   *********************** 

48. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagacagcgatagcgattca	Protospacer
*   *********************** 

49. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagacagcgatagcgattca	Protospacer
*   *********************** 

50. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagacagcgatagcgattca	Protospacer
*   *********************** 

51. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagacagcgatagcgattca	Protospacer
*   *********************** 

52. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

ctcagattcagacagcgatagcgattct	CRISPR spacer
ttcagactcagacagcgacagcgattca	Protospacer
.*****.***********.******** 

53. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagatagcgacagcgattca	Protospacer
*   ********.*****.******** 

54. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattcagatagcgacagcgattca	Protospacer
*   ********.*****.******** 

55. spacer 1.4|119457|28|NZ_AP021848|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

ctcagattcagacagcgatagcgattct	CRISPR spacer
cagcgattccgacagcgacagcgattcg	Protospacer
*   ***** ********.******** 

56. spacer 1.4|119457|28|NZ_AP021848|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.75

ctcagattcagacagcgatagcgattct	CRISPR spacer
cctccgttcagacagcgctagcgattcc	Protospacer
*..  .*********** *********.

57. spacer 1.6|119571|34|NZ_AP021848|CRT matches to MH791401 (UNVERIFIED: Aeromonas phage AsFcp_2, complete genome) position: , mismatch: 7, identity: 0.794

ttcagattca-----gatagtgactctgatgcggacagc	CRISPR spacer
-----attcaagaacgatagcgactctgatgcggatagc	Protospacer
     *****     *****.**************.***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35065 : 95835 51 Staphylococcus_phage(46.15%) transposase NA
DBSCAN-SWA_2 371586 : 409297 34 Paramecium_bursaria_Chlorella_virus(33.33%) protease,transposase,integrase attL 384544:384561|attR 411443:411460
DBSCAN-SWA_3 1120201 : 1133374 20 Staphylococcus_phage(62.5%) terminase,integrase attL 1122151:1122170|attR 1135980:1135999
DBSCAN-SWA_4 1260147 : 1290402 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_5 1409105 : 1418136 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1544769 : 1553464 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_7 1959040 : 1967510 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2255973 : 2273754 15 uncultured_Caudovirales_phage(58.33%) NA NA
DBSCAN-SWA_9 2289018 : 2295639 8 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_10 2621292 : 2637717 24 Staphylococcus_phage(46.15%) terminase,integrase attL 2618618:2618677|attR 2631699:2631772
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage