Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022822 Enterococcus saigonensis strain VE80 1 crisprs cas14j,cas6,cas8b2,cas7,cas5,cas3,cas4,cas1,cas2,csa3,DinG,DEDDh,casR 0 3 213 0
NZ_AP022824 Enterococcus saigonensis strain VE80 plasmid pVE80-2, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP022825 Enterococcus saigonensis strain VE80 plasmid pVE80-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP022823 Enterococcus saigonensis strain VE80 plasmid pVE80-1, complete sequence 0 crisprs csa3 0 0 2 0

Results visualization

1. NZ_AP022822
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022822_1 222077-224344 Unclear NA
34 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 245023-245056 7 0.794
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NC_028821 Staphylococcus phage StB20-like, complete genome 35683-35716 8 0.765
NZ_AP022822_1 1.5|222368|35|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222368-222402 35 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 105998-106032 8 0.771
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NZ_CP045270 Bacillus megaterium strain FDU301 plasmid pFDU301H, complete sequence 7749-7782 9 0.735
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 MH460825 Paenibacillus phage Scottie, complete genome 18999-19032 9 0.735
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 17172-17205 10 0.706
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 23559-23592 10 0.706
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 3352-3385 10 0.706
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 MN694015 Marine virus AFVG_250M337, complete genome 2897-2930 10 0.706
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 367837-367870 10 0.706
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 308144-308177 10 0.706
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 11148-11181 10 0.706
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 11189-11222 10 0.706
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 343153-343186 10 0.706
NZ_AP022822_1 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222172-222205 34 MT939242 Enterococcus phage 9184, partial genome 29124-29157 11 0.676
NZ_AP022822_1 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT 222632-222665 34 NZ_CP040048 Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence 19998-20031 11 0.676

1. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 7, identity: 0.794

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
aaaggaggcattaaaatgaaaaaaattagtttta	Protospacer
* ****** ************.****.*  ** *

2. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NC_028821 (Staphylococcus phage StB20-like, complete genome) position: , mismatch: 8, identity: 0.765

acaggaggaattaaaatgaaagaaatcacattga-	CRISPR spacer
taaggaggaattaaaatgcaggaaat-acctagtt	Protospacer
  **************** *.***** ** * *  

3. spacer 1.5|222368|35|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 8, identity: 0.771

aatagataaggagtgaaatttatgtatacaaaagt	CRISPR spacer
taaggcaaaggagtgaaatttatgaatataaaact	Protospacer
 * .*  ***************** ***.**** *

4. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045270 (Bacillus megaterium strain FDU301 plasmid pFDU301H, complete sequence) position: , mismatch: 9, identity: 0.735

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
ttaaatggaattatgatgaaagaaatcacaatta	Protospacer
 .*.. ******* .*************** * *

5. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to MH460825 (Paenibacillus phage Scottie, complete genome) position: , mismatch: 9, identity: 0.735

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
ataggaggaattgaaatgaatgaaataataaatg	Protospacer
*.**********.******* ***** *.*   .

6. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.706

acaggaggaattaaaatgaaagaaatc----acattga	CRISPR spacer
gaaggaggaagtaaaatgaaagcaattcgtgata----	Protospacer
. ******** *********** ***.    *.*    

7. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 10, identity: 0.706

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
ttaggaggaattaaaatgaaaataatattaacaa	Protospacer
 .*******************. ***  .* ..*

8. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 10, identity: 0.706

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
ttaggaggaattaaaatgaaaataatattaacaa	Protospacer
 .*******************. ***  .* ..*

9. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to MN694015 (Marine virus AFVG_250M337, complete genome) position: , mismatch: 10, identity: 0.706

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
tcaggaggaagtaaaatgaaacaaaaaagaacag	Protospacer
 ********* ********** ***  * * ...

10. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 10, identity: 0.706

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
taattttgaatgtaaattatatagagtatttata	Protospacer
 *********** **** *******  *  *  .

11. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 10, identity: 0.706

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
taattttgaatgtaaattatatagagtatttata	Protospacer
 *********** **** *******  *  *  .

12. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 10, identity: 0.706

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
taattttgaatgtaaattatatagagtatttata	Protospacer
 *********** **** *******  *  *  .

13. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 10, identity: 0.706

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
taattttgaatgtaaattatatagagtatttata	Protospacer
 *********** **** *******  *  *  .

14. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 10, identity: 0.706

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
taattttgaatgtaaattatatagagtatttata	Protospacer
 *********** **** *******  *  *  .

15. spacer 1.2|222172|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to MT939242 (Enterococcus phage 9184, partial genome) position: , mismatch: 11, identity: 0.676

acaggaggaattaaaatgaaagaaatcacattga	CRISPR spacer
ttaggaggaattaaaatgttagaaataattgcat	Protospacer
 .****************  ****** *.  .. 

16. spacer 1.9|222632|34|NZ_AP022822|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040048 (Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

aaattttgaatgaaaataatatagacaaaattag	CRISPR spacer
ttattttaaatgaaaattatatagactgcttggc	Protospacer
  *****.********* ******** .  * . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13701 9 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_2 18603 : 20256 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_3 25837 : 33908 6 Streptococcus_phage(66.67%) transposase NA
DBSCAN-SWA_4 37209 : 40891 4 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 50552 : 55125 4 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_6 84960 : 90501 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_7 95373 : 96840 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_8 113972 : 115544 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_9 123725 : 127212 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_10 133461 : 135084 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_11 148541 : 151088 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_12 155790 : 159059 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_13 164814 : 166227 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_14 170663 : 173221 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_15 177084 : 178125 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 186198 : 187581 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_17 192151 : 193186 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_18 203933 : 205414 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_19 217828 : 220099 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_20 226525 : 235691 9 Acanthamoeba_polyphaga_moumouvirus(20.0%) NA NA
DBSCAN-SWA_21 245509 : 250516 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_22 257938 : 258553 1 Abalone_herpesvirus(100.0%) NA NA
DBSCAN-SWA_23 261563 : 267257 5 Synechococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_24 282189 : 285374 4 Streptomyces_phage(25.0%) NA NA
DBSCAN-SWA_25 301824 : 309046 6 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_26 317106 : 318297 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_27 321298 : 328436 5 Staphylococcus_phage(75.0%) tRNA NA
DBSCAN-SWA_28 340982 : 342931 2 Brochothrix_phage(50.0%) NA NA
DBSCAN-SWA_29 354817 : 360338 6 unidentified_phage(25.0%) transposase NA
DBSCAN-SWA_30 376637 : 386063 8 Streptococcus_phage(60.0%) NA NA
DBSCAN-SWA_31 389958 : 391260 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 395331 : 399616 4 Salmonella_phage(50.0%) tRNA NA
DBSCAN-SWA_33 407862 : 409059 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_34 414152 : 421299 7 Cafeteria_roenbergensis_virus(20.0%) NA NA
DBSCAN-SWA_35 432824 : 434099 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_36 440274 : 445852 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_37 449650 : 454804 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_38 458852 : 467301 5 Bacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_39 472648 : 478361 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_40 501329 : 502097 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_41 508543 : 514691 6 Lactococcus_phage(25.0%) NA NA
DBSCAN-SWA_42 519455 : 521581 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_43 525353 : 547635 25 Streptococcus_phage(27.27%) terminase,capsid,head,portal,tail,integrase attL 530567:530584|attR 544092:544109
DBSCAN-SWA_44 551747 : 555998 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_45 562718 : 563558 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_46 575625 : 576651 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_47 586568 : 592456 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_48 595654 : 601253 6 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_49 606590 : 612728 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_50 638028 : 641038 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_51 652794 : 656013 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_52 665457 : 669670 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_53 674520 : 675048 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_54 684774 : 687414 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_55 690603 : 701215 10 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_56 706722 : 721282 11 Bacillus_phage(40.0%) holin NA
DBSCAN-SWA_57 743079 : 746589 4 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_58 750490 : 753588 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_59 757859 : 763651 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_60 769996 : 787392 9 Moumouvirus(16.67%) NA NA
DBSCAN-SWA_61 790874 : 806011 16 Streptococcus_phage(54.55%) transposase NA
DBSCAN-SWA_62 814310 : 817368 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_63 835017 : 838105 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_64 841958 : 848927 6 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_65 854320 : 872891 17 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_66 877661 : 879098 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_67 908179 : 910390 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_68 931499 : 936120 2 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_69 943003 : 945088 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 951438 : 954318 4 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 960203 : 963331 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_72 966694 : 970420 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_73 976095 : 976986 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 983691 : 990202 6 Bodo_saltans_virus(20.0%) transposase NA
DBSCAN-SWA_75 1000795 : 1003771 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_76 1009427 : 1010970 2 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_77 1026246 : 1031639 6 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_78 1043243 : 1049623 5 Lactococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_79 1058330 : 1060448 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_80 1066362 : 1070534 5 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_81 1076181 : 1076880 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_82 1085269 : 1094614 10 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_83 1100535 : 1103535 2 Helicobacter_phage(50.0%) NA NA
DBSCAN-SWA_84 1108350 : 1110583 3 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_85 1117268 : 1118654 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_86 1123381 : 1123657 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_87 1127018 : 1128728 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_88 1135150 : 1137766 3 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_89 1141760 : 1144523 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_90 1149737 : 1156142 7 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_91 1161451 : 1163143 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_92 1167881 : 1176445 5 Flavobacterium_phage(33.33%) protease NA
DBSCAN-SWA_93 1180440 : 1185649 5 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_94 1189106 : 1190687 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_95 1197057 : 1202638 4 Cronobacter_phage(33.33%) protease NA
DBSCAN-SWA_96 1209493 : 1210231 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_97 1218039 : 1218774 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_98 1226383 : 1231230 6 Lactococcus_phage(33.33%) integrase attL 1219672:1219721|attR 1228301:1228350
DBSCAN-SWA_99 1241475 : 1246883 4 Streptococcus_phage(66.67%) tRNA NA
DBSCAN-SWA_100 1250246 : 1252901 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_101 1262184 : 1266164 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_102 1273600 : 1276328 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_103 1281553 : 1283440 2 Streptococcus_phage(50.0%) holin NA
DBSCAN-SWA_104 1287623 : 1292608 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_105 1299317 : 1299953 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_106 1310642 : 1314108 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_107 1326356 : 1328752 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_108 1334825 : 1336569 2 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_109 1339908 : 1349122 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_110 1358467 : 1363755 5 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_111 1371496 : 1372132 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_112 1377783 : 1381179 3 Halovirus(50.0%) NA NA
DBSCAN-SWA_113 1387960 : 1390603 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_114 1394768 : 1399225 6 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_115 1403770 : 1404406 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_116 1407413 : 1414672 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_117 1418462 : 1419146 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_118 1423231 : 1425808 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_119 1430203 : 1434466 2 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_120 1446214 : 1447453 1 Bacillus_virus(100.0%) protease NA
DBSCAN-SWA_121 1450637 : 1454183 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_122 1460014 : 1468012 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_123 1472558 : 1478458 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_124 1482949 : 1485774 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_125 1492950 : 1493694 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_126 1499497 : 1500850 1 Ugandan_cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_127 1504123 : 1504855 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_128 1509632 : 1515100 3 Orpheovirus(50.0%) tRNA NA
DBSCAN-SWA_129 1527798 : 1530128 3 Moumouvirus(50.0%) transposase NA
DBSCAN-SWA_130 1535188 : 1536538 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_131 1549643 : 1550384 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_132 1562106 : 1562973 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1571022 : 1579865 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_134 1588729 : 1597744 8 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_135 1603749 : 1606179 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_136 1609479 : 1609974 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_137 1617940 : 1622471 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_138 1626545 : 1648367 18 Synechococcus_phage(27.27%) NA NA
DBSCAN-SWA_139 1651974 : 1652592 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_140 1661529 : 1662231 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_141 1671056 : 1673474 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_142 1685192 : 1692225 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_143 1695606 : 1710319 13 Erwinia_phage(12.5%) tRNA,protease NA
DBSCAN-SWA_144 1728938 : 1731312 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_145 1735429 : 1747263 9 Streptomyces_phage(25.0%) NA NA
DBSCAN-SWA_146 1753034 : 1755562 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_147 1761268 : 1771073 9 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_148 1779257 : 1781867 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_149 1787356 : 1788814 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_150 1795475 : 1798052 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_151 1803457 : 1805919 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_152 1813660 : 1822877 9 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_153 1826789 : 1827859 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_154 1837339 : 1840279 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_155 1844256 : 1845981 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_156 1852458 : 1858725 6 Anomala_cuprea_entomopoxvirus(25.0%) NA NA
DBSCAN-SWA_157 1878952 : 1883041 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_158 1886434 : 1887334 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_159 1895565 : 1908793 12 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_160 1926430 : 1927132 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_161 1932841 : 1934674 1 Campylobacter_phage(100.0%) NA NA
DBSCAN-SWA_162 1939400 : 1941120 2 Lactococcus_phage(50.0%) integrase attL 1933260:1933273|attR 1947862:1947875
DBSCAN-SWA_163 1945735 : 1953787 11 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_164 1970368 : 1973208 3 Bacillus_phage(50.0%) integrase attL 1970227:1970240|attR 1971738:1971751
DBSCAN-SWA_165 1988805 : 1997469 10 Mycoplasma_phage(40.0%) NA NA
DBSCAN-SWA_166 2001784 : 2002474 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_167 2013527 : 2037949 21 Bacillus_virus(20.0%) tRNA,protease NA
DBSCAN-SWA_168 2042921 : 2046533 3 Enterococcus_phage(66.67%) NA NA
DBSCAN-SWA_169 2063865 : 2064747 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_170 2072278 : 2079047 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_171 2094332 : 2100667 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_172 2104170 : 2104904 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2133304 : 2142362 10 Lactobacillus_phage(40.0%) NA NA
DBSCAN-SWA_174 2161175 : 2165545 6 Enterobacteria_phage(33.33%) tRNA NA
DBSCAN-SWA_175 2172769 : 2177515 3 Salmonella_virus(50.0%) tRNA NA
DBSCAN-SWA_176 2181874 : 2182804 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2188230 : 2190779 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_178 2202272 : 2203790 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_179 2208218 : 2208878 1 Lactobacillus_virus(100.0%) NA NA
DBSCAN-SWA_180 2221326 : 2230155 6 uncultured_Mediterranean_phage(33.33%) tRNA,holin NA
DBSCAN-SWA_181 2237560 : 2238235 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_182 2241713 : 2245430 4 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_183 2248623 : 2255359 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_184 2261085 : 2261709 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_185 2265891 : 2266629 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2273128 : 2274331 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_187 2279711 : 2280275 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2286423 : 2287173 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_189 2295344 : 2296343 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_190 2300322 : 2305050 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_191 2312129 : 2355770 66 Streptococcus_phage(34.38%) plate,terminase,head,portal,holin,protease,capsid,tail,integrase attL 2312586:2312603|attR 2358803:2358820
DBSCAN-SWA_192 2379279 : 2379735 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_193 2400647 : 2401340 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_194 2405318 : 2407268 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_195 2418767 : 2420440 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_196 2436868 : 2437621 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_197 2443204 : 2449575 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_198 2452790 : 2453609 1 Grouper_iridovirus(100.0%) NA NA
DBSCAN-SWA_199 2457128 : 2462727 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_200 2470790 : 2502467 35 Streptococcus_phage(77.27%) integrase attL 2464015:2464032|attR 2514271:2514288
DBSCAN-SWA_201 2513408 : 2514110 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_202 2564596 : 2566447 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_203 2574237 : 2575311 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_204 2580363 : 2583370 2 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_205 2607192 : 2619920 15 Streptococcus_phage(33.33%) integrase attL 2599824:2599838|attR 2616259:2616273
DBSCAN-SWA_206 2624244 : 2630661 7 Streptococcus_phage(25.0%) transposase NA
DBSCAN-SWA_207 2634470 : 2635706 1 Leuconostoc_phage(100.0%) integrase attL 2630026:2630042|attR 2643555:2643571
DBSCAN-SWA_208 2658924 : 2666314 2 Phaeocystis_globosa_virus(50.0%) NA NA
DBSCAN-SWA_209 2681056 : 2688751 9 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_210 2692639 : 2698965 5 Organic_Lake_phycodnavirus(33.33%) protease NA
DBSCAN-SWA_211 2706192 : 2718172 11 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_212 2723762 : 2724713 1 Niemeyer_virus(100.0%) NA NA
DBSCAN-SWA_213 2732483 : 2734370 1 Organic_Lake_phycodnavirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP022823
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26833 : 61418 40 Streptococcus_phage(33.33%) integrase,transposase attL 37870:37888|attR 60684:60702
DBSCAN-SWA_2 69628 : 75668 10 Streptococcus_phage(66.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage