Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049980 Leclercia adecarboxylata strain 707804 chromosome, complete genome 8 crisprs csa3,WYL,DEDDh,DinG,cas3,cas14j,RT 0 1 6 0

Results visualization

1. NZ_CP049980
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_1 1014761-1014862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_2 1569137-1569267 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_3 2822530-2822661 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_4 3207549-3207637 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_5 3243329-3243471 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_6 3291264-3291356 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_7 3992214-3992354 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049980_8 4199251-4199348 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049980_6 6.1|3291294|33|NZ_CP049980|CRISPRCasFinder 3291294-3291326 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 196155-196187 6 0.818

1. spacer 6.1|3291294|33|NZ_CP049980|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

caccccggctacgccagcacctggcgctgacag	CRISPR spacer
aagcccggctgcgccagcacctggcgcagcaag	Protospacer
 * *******.**************** *  **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1610825 : 1616298 7 uncultured_Caudovirales_phage(50.0%) integrase,lysis attL 1602433:1602447|attR 1626259:1626273
DBSCAN-SWA_2 1740101 : 1749578 9 uncultured_virus(16.67%) NA NA
DBSCAN-SWA_3 2367543 : 2448160 98 Enterobacteria_phage(29.63%) portal,terminase,tail,capsid,protease,tRNA,integrase,holin,head attL 2402946:2402973|attR 2445947:2445974
DBSCAN-SWA_4 2616805 : 2628060 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_5 3075100 : 3161071 94 Shigella_phage(36.54%) portal,terminase,tail,capsid,protease,tRNA,plate,transposase,holin,head NA
DBSCAN-SWA_6 3256146 : 3263595 7 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage