Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049907 Hymenobacter sp. HDW8 chromosome, complete genome 0 crisprs cas3,WYL,csa3,DEDDh 0 0 0 0
NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 1 crisprs NA 0 4 0 0
NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 0 crisprs csa3,PD-DExK,RT 0 0 0 0

Results visualization

1. NZ_CP049909
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049909_1 14079-14311 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049909_1 1.1|14102|32|NZ_CP049909|CRT 14102-14133 32 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 14102-14133 0 1.0
NZ_CP049909_1 1.2|14157|31|NZ_CP049909|CRT 14157-14187 31 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 14157-14187 0 1.0
NZ_CP049909_1 1.3|14211|22|NZ_CP049909|CRT,PILER-CR 14211-14232 22 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 14211-14232 0 1.0
NZ_CP049909_1 1.4|14256|33|NZ_CP049909|CRT,PILER-CR 14256-14288 33 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 14256-14288 0 1.0
NZ_CP049909_1 1.1|14102|32|NZ_CP049909|CRT 14102-14133 32 NZ_CP049909 Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence 14189-14220 6 0.812
NZ_CP049909_1 1.1|14102|32|NZ_CP049909|CRT 14102-14133 32 NZ_CP053905 Hymenobacter sp. BRD67 plasmid unnamed1, complete sequence 100942-100973 9 0.719

1. spacer 1.1|14102|32|NZ_CP049909|CRT matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagctaaggttcggataggtactgaagcat	CRISPR spacer
aaaagctaaggttcggataggtactgaagcat	Protospacer
********************************

2. spacer 1.2|14157|31|NZ_CP049909|CRT matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tatcccttgagaaaagtaaagtttggacagg	CRISPR spacer
tatcccttgagaaaagtaaagtttggacagg	Protospacer
*******************************

3. spacer 1.3|14211|22|NZ_CP049909|CRT,PILER-CR matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acttatccacactcataggtca	CRISPR spacer
acttatccacactcataggtca	Protospacer
**********************

4. spacer 1.4|14256|33|NZ_CP049909|CRT,PILER-CR matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttatcgcagggaatccgtgaggtatcttactt	CRISPR spacer
gttatcgcagggaatccgtgaggtatcttactt	Protospacer
*********************************

5. spacer 1.1|14102|32|NZ_CP049909|CRT matches to NZ_CP049909 (Hymenobacter sp. HDW8 plasmid p_unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaagctaaggttcggataggtactgaagcat	CRISPR spacer
aaaagctaaggtttggacaggtacttatccac	Protospacer
*************.***.******* *  **.

6. spacer 1.1|14102|32|NZ_CP049909|CRT matches to NZ_CP053905 (Hymenobacter sp. BRD67 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaaagctaaggttcggataggtactgaagcat	CRISPR spacer
aaaagctaaggtttggacaggtaaaaagtaag	Protospacer
*************.***.*****  .*.  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage