Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049730 Rhizobium leguminosarum strain A1 chromosome, complete genome 3 crisprs csa3,cas3,WYL,DEDDh,RT 0 1 6 0
NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 0 crisprs NA 0 0 64 0
NZ_CP049735 Rhizobium leguminosarum strain A1 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 7 0
NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 0 crisprs WYL,csa3 0 0 77 0
NZ_CP049734 Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP049733
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8767 5 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_2 16779 : 18135 1 Wolbachia_phage(100.0%) transposase NA
DBSCAN-SWA_3 32866 : 33403 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_4 40019 : 42100 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_5 49575 : 51114 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 59256 : 59550 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_7 64109 : 65885 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_8 72732 : 74372 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_9 78943 : 79789 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_10 86397 : 87477 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_11 91805 : 95663 3 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_12 99895 : 100522 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_13 104413 : 105496 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 109312 : 110290 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_15 116947 : 117964 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_16 123247 : 124348 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 136854 : 138962 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_18 142576 : 143593 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_19 147172 : 153606 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_20 158356 : 159967 1 Pike_perch_iridovirus(100.0%) NA NA
DBSCAN-SWA_21 163087 : 163855 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_22 169760 : 171158 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 177656 : 180653 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_24 197629 : 202098 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_25 214784 : 215831 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_26 220708 : 224703 4 Bathycoccus_sp._RCC1105_virus(33.33%) NA NA
DBSCAN-SWA_27 243994 : 246139 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_28 259786 : 260245 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_29 263753 : 264839 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_30 280207 : 281038 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_31 287454 : 288537 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_32 293661 : 297086 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_33 305237 : 314327 9 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_34 320380 : 321865 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_35 333848 : 338012 4 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_36 344915 : 348117 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_37 352673 : 353459 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_38 360408 : 361941 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 367065 : 367980 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_40 372879 : 382977 10 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_41 388952 : 398002 10 Organic_Lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_42 410412 : 411201 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_43 415213 : 416764 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_44 425402 : 430947 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_45 434774 : 436397 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_46 446261 : 448277 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_47 451595 : 458155 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_48 463396 : 472841 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_49 480053 : 483461 4 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_50 490897 : 495464 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_51 509054 : 510686 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_52 514401 : 516549 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_53 521036 : 524860 4 Mollivirus(50.0%) NA NA
DBSCAN-SWA_54 528867 : 530492 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_55 540384 : 541164 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_56 547032 : 547803 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_57 553565 : 555080 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_58 561987 : 563823 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_59 569165 : 569978 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 574985 : 578009 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_61 588510 : 589227 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_62 600042 : 601125 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_63 619580 : 623233 4 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_64 629894 : 632098 2 Ochrobactrum_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP049731
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3657 2 Ochrobactrum_phage(50.0%) NA NA
DBSCAN-SWA_2 13204 : 14239 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_3 20625 : 21771 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_4 27996 : 29376 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_5 33142 : 33928 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_6 41391 : 43209 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_7 55613 : 57398 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_8 60412 : 61183 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_9 65086 : 65812 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_10 75410 : 80971 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_11 91851 : 93396 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_12 102239 : 105037 3 Mycobacterium_virus(50.0%) NA NA
DBSCAN-SWA_13 111715 : 112471 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_14 119458 : 120241 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_15 123531 : 128472 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_16 139689 : 141345 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_17 144809 : 145844 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_18 151911 : 160408 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_19 170868 : 171939 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_20 178466 : 179750 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_21 183080 : 184610 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 191535 : 198229 6 Ostreococcus_lucimarinus_virus(33.33%) NA NA
DBSCAN-SWA_23 206664 : 211104 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_24 214321 : 215341 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_25 229381 : 231839 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_26 240055 : 242026 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_27 247360 : 249917 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_28 254255 : 255986 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 260044 : 268548 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_30 273258 : 275136 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_31 279986 : 280811 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_32 284148 : 284784 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_33 291815 : 293330 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_34 305538 : 306990 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_35 314669 : 319572 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_36 332568 : 334056 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_37 344959 : 346018 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_38 352678 : 354493 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_39 358292 : 359087 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_40 363113 : 368130 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_41 371887 : 378289 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_42 384599 : 390401 4 Bradyrhizobium_phage(50.0%) NA NA
DBSCAN-SWA_43 410752 : 412230 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 418409 : 425864 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_45 433570 : 434650 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_46 443677 : 444805 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 452180 : 453326 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_48 458520 : 461854 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_49 469962 : 470709 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_50 480995 : 483593 2 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_51 487974 : 490269 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_52 497168 : 500782 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_53 507515 : 509431 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_54 512945 : 513770 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 520439 : 530856 9 Brazilian_cedratvirus(20.0%) NA NA
DBSCAN-SWA_56 533913 : 534675 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_57 538655 : 539411 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_58 551301 : 553348 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_59 559683 : 569663 8 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_60 586595 : 588251 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_61 595135 : 601572 6 Escherichia_phage(75.0%) NA NA
DBSCAN-SWA_62 616502 : 617426 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_63 627244 : 631233 6 uncultured_virus(66.67%) NA NA
DBSCAN-SWA_64 638447 : 639557 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_65 647186 : 651141 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_66 661064 : 663209 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_67 671376 : 672483 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_68 677893 : 678952 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_69 681961 : 690892 5 Leptospira_phage(33.33%) transposase NA
DBSCAN-SWA_70 704139 : 708378 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_71 713126 : 721746 4 Hokovirus(33.33%) NA NA
DBSCAN-SWA_72 731767 : 733306 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_73 749784 : 751290 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_74 755564 : 760584 5 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_75 767104 : 767935 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_76 773177 : 785009 10 Oenococcus_phage(40.0%) NA NA
DBSCAN-SWA_77 796377 : 797822 2 Pithovirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP049730
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049730_1 619619-619699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049730_2 677200-677280 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049730_3 1685466-1685567 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 253917-253951 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 253911-253945 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 320915-320949 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 753378-753412 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 635374-635408 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 401106-401140 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 64443-64477 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 518860-518894 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 304036-304070 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 427317-427351 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 126176-126210 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1045017-1045051 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1231954-1231988 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 64443-64477 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 270382-270416 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 468554-468588 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 655491-655525 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 64468-64502 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 251401-251435 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 96930-96964 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 79156-79190 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 1071556-1071590 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 182809-182843 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 706093-706127 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 96803-96837 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 458231-458265 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 70090-70124 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 79340-79374 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 543172-543206 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 10600-10634 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2165732-2165766 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 522838-522872 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 971001-971035 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 204345-204379 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 308987-309021 6 0.829
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 224898-224932 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 459738-459772 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 224909-224943 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 458522-458556 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 412746-412780 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 177832-177866 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 449539-449573 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 258383-258417 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 409221-409255 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 409221-409255 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 407662-407696 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 411909-411943 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 406027-406061 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 41505-41539 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 409221-409255 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 102929-102963 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 211094-211128 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 824051-824085 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 102802-102836 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 524892-524926 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 51941-51975 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 347915-347949 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 1094089-1094123 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 304603-304637 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032696 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence 211849-211883 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 573969-574003 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 550471-550505 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 507564-507598 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 515421-515455 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 388711-388745 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 575099-575133 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 252188-252222 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 550473-550507 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 491571-491605 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 190374-190408 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1025534-1025568 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 707971-708005 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 496657-496691 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 507565-507599 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 299813-299847 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 290782-290816 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 540154-540188 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 954035-954069 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1228387-1228421 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 90799-90833 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1842076-1842110 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1144241-1144275 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 352284-352318 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1227805-1227839 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 53676-53710 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 321605-321639 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 489565-489599 7 0.8
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 149432-149466 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1471522-1471556 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 261023-261057 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 1079583-1079617 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 676719-676753 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 328738-328772 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 63349-63383 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 74563-74597 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 73414-73448 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 488442-488476 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 820846-820880 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 38367-38401 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 820394-820428 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 38367-38401 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 524779-524813 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 147027-147061 8 0.771
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 142450-142484 9 0.743
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 221094-221128 9 0.743
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1139047-1139081 9 0.743
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 740911-740945 9 0.743
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 196761-196795 10 0.714
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1944421-1944455 10 0.714
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 701272-701306 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1374468-1374502 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 630145-630179 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 729590-729624 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 982478-982512 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 584390-584424 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 301024-301058 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 304957-304991 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1060745-1060779 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 968008-968042 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 708512-708546 12 0.657
NZ_CP049730_1 1.1|619642|35|NZ_CP049730|CRISPRCasFinder 619642-619676 35 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 220729-220763 12 0.657

1. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccgaaattgcgtaaaaaca	Protospacer
.*. ****************************.  

2. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccgaaattgcgtaaaaaca	Protospacer
.*. ****************************.  

3. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

4. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

5. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

6. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

7. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

8. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

9. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

10. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

11. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

12. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

13. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

14. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

15. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

16. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

17. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

18. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

19. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

20. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

21. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

22. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

23. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

24. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

25. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

26. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

27. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

28. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

29. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

30. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

31. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccgaaattgcgaaaaaaca	Protospacer
**  *********************** ****.  

32. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

33. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

34. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
**. ***************.************.  

35. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.829

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaaatgcgtaaaaact	Protospacer
**. ***************.** *********. *

36. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaaacggttttccgtccgaaattgcgtaaaaaca	Protospacer
.*. .***************************.  

37. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

38. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaaacggttttccgtccgaaattgcgtaaaaaca	Protospacer
.*. .***************************.  

39. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

40. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaaacggttttccgtccgaaattgcgtaaaaaca	Protospacer
.*. .***************************.  

41. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

42. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

43. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

44. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

45. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

46. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

47. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

48. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

49. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

50. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

51. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgttcggaattgcgtaaaacaa	Protospacer
**. ************.**.************ . 

52. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttgcgtccgaaattgcgtgaaaaca	Protospacer
**  ******** ***************.***.  

53. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaactgcgtaaaaaca	Protospacer
**. ***************.**.*********.  

54. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgttcggaattgcgtaaaacaa	Protospacer
**. ************.**.************ . 

55. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
.*. ***************.************.  

56. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
caaagcggttttccgtccggaattgcgtaaaaaca	Protospacer
*.. ***************.************.  

57. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcagttttccgtccggaattgcgtaaaaaca	Protospacer
**. **.************.************.  

58. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcgggtttccgtccggaattgcgtaaaacaa	Protospacer
**. **** **********.************ . 

59. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgcagcggttttgcgtccggaattgcgtaaaacaa	Protospacer
**  ******** ******.************ . 

60. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaaacggttttccgtccggaattgcgtaaaaaca	Protospacer
**. .**************.************.  

61. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaacg	Protospacer
**. ********.******.************.  

62. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

63. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

64. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaacg	Protospacer
**. ********.******.************.  

65. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttgcgtccggaattgcgtaaaacaa	Protospacer
**. ******** ******.************ . 

66. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

67. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgttaaaaca	Protospacer
**. ***************.******** ***.  

68. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
**. ********.******.************.  

69. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggagttgcgtaaaaaca	Protospacer
**. ***************.*.**********.  

70. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

71. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtggcggttttccgtccggaattgcgtgaaaaca	Protospacer
**  ***************.********.***.  

72. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

73. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

74. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

75. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcgggtttccgtccggaattgcgtaaaaaca	Protospacer
**. **** **********.************.  

76. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcttaaaaaca	Protospacer
**. ***************.****** *****.  

77. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttttcgtccggaattgcgtaaaacaa	Protospacer
**. ********.******.************ . 

78. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcgttaaaaca	Protospacer
**. ***************.******** ***.  

79. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

80. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttcccgtccggaattgcgtaaaaaca	Protospacer
**. *******.*******.************.  

81. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

82. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

83. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

84. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgtagcggttttccgtccggaattgcggaaaaaca	Protospacer
**  ***************.******* ****.  

85. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggtttcccgtccggaattgcgtaaaaaca	Protospacer
**. *******.*******.************.  

86. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 7, identity: 0.8

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cgaagcggttttccgtccggaattgcttaaaaaca	Protospacer
**. ***************.****** *****.  

87. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 7, identity: 0.8

cggcg-cggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
-gacgccggttttccgtccggaaatgcgtaaaacaa	Protospacer
 *.** **************.** ********* . 

88. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
ggcagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 *  ******** ******.************.  

89. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tattgcggttttccgtccggaattgcgtaaaaaca	Protospacer
.. .***************.************.  

90. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
ctctgctgtttttcgtccgaaattgcgtaaaacaa	Protospacer
*  .** *****.******************* . 

91. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
.*. ********.******.************.  

92. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgaagcggtttttcgtccggaattgcgtaaaaaca	Protospacer
.*. ********.******.************.  

93. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

94. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

95. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

96. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

97. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

98. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
catagcggttttccgtccggaattgcgtagaaaca	Protospacer
*.  ***************.*********.**.  

99. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cggagcggttttccgtccggaattgcgaggaaaca	Protospacer
*** ***************.******* ..**.  

100. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
catagcggttttccgtccggaattgcgtagaaaca	Protospacer
*.  ***************.*********.**.  

101. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
cggagcggttttccgtccggaattgcgaggaaaca	Protospacer
*** ***************.******* ..**.  

102. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gagagcggttttgcgtccggaattgcgtaaaaaca	Protospacer
 .* ******** ******.************.  

103. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 8, identity: 0.771

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
gtgggcggttttccgtccggaattgcgtcaaaaca	Protospacer
  * ***************.******** ***.  

104. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 9, identity: 0.743

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgtagtggtttttcgtccggaattgcgtaaaaaca	Protospacer
.*  *.******.******.************.  

105. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.743

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgtagtggtttttcgtccggaattgcgtaaaaaca	Protospacer
.*  *.******.******.************.  

106. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.743

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
aagtgcggctttccgtccggaattgcgtaagaaca	Protospacer
 .*.****.**********.**********.*.  

107. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.743

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
ggaaccggttttccgaccggaattgcgtaaaaaca	Protospacer
 *.  ********** ***.************.  

108. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 10, identity: 0.714

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tatggcggttttccgtccggaattgcgtatagatg	Protospacer
..  ***************.********* *..  

109. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.714

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tgtaacggttttccgtccggaattgcgtaatttca	Protospacer
.*  .**************.**********     

110. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

111. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

112. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

113. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

114. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

115. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

116. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

117. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

118. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

119. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

120. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

121. spacer 1.1|619642|35|NZ_CP049730|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 12, identity: 0.657

cggcgcggttttccgtccgaaattgcgtaaaaggt	CRISPR spacer
tttagcggctttccgtccgaaagtgcgtagcctca	Protospacer
.   ****.************* ******.     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 934044 : 958917 23 Pseudomonas_phage(20.0%) capsid,transposase,tail,terminase NA
DBSCAN-SWA_2 1392988 : 1402042 9 Aeromonas_phage(14.29%) NA NA
DBSCAN-SWA_3 1830451 : 1843730 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_4 2075446 : 2085667 10 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_5 3128575 : 3142002 9 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_6 4041020 : 4048134 8 Mycobacterium_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP049735
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 74979 61 Streptococcus_phage(31.25%) protease,transposase,tRNA NA
DBSCAN-SWA_2 80372 : 85672 4 Streptococcus_phage(66.67%) transposase NA
DBSCAN-SWA_3 96400 : 97402 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_4 106814 : 110300 4 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_5 113372 : 119630 5 Streptococcus_phage(75.0%) transposase NA
DBSCAN-SWA_6 129716 : 130914 1 Pseudomonas_phage(100.0%) transposase NA
DBSCAN-SWA_7 137063 : 146687 11 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage